168 

Significance of β-actin gene in Cerebrospinal fluid for the Cellular and Molecular Characterization of Tuberculosis Meningitis

Sharma, Narotam1; Rawat, Anita2; Gupta, Komal3; Agarwal, Ruchi1; Ghanshyam4; Anand4; Ram, Rishi4; Garg, Neelam4; Dhingra, Gulshan K.5

Received: December 20, 2017 Accepted: March 29, 2017 Online: June 30, 2017

Abstract

Tuberculosis meningitis (TBM) is a serious

Central Nervous System infection associated

with significant mortality and morbidity among

the survivors and thus early diagnosis and plays

an important role. The current study signifies

about the clinical relevance of the β-actin gene

in Cerebrospinal fluid in cases with

neurological disorders.

Keywords: Cerebrospinal fluid | Polymerase

chain reaction | Tuberculosis Meningitis | beta

actin gene | latent and active tuberculosis

Introduction

Tuberculous meningitis (TB Meningitis) is a

debilitating form of Central Nervous System

(CNS) tuberculosis with a high morbidity and

mortality in spite of treatment. Though India is

the second-most populous country in the world,

one fourth of the global incident tuberculosis

(TB) cases occur in India annually. Tuberculous

meningitis (TBM) is characterized by a slowly

progressing granulomatous inflammation of the

basal meninges. Individuals with increased risk

for TBM include young children with primary

TB and patients with immunodeficiency caused

by aging, malnutrition, or disorders such as HIV

and cancer (Berenguer et al., 1992; Farer et al.,

1979). Tuberculous meningitis composes of 5-

10% of all tuberculosis cases and is a critical

disease in terms of fatal outcome and permanent

sequel in spite of anti- tuberculosis treatment,

requiring rapid diagnosis and treatment

(Thwaites GE et al., 2002). Many prognostic

factors for TBM have been reported, including

age, the stage of the disease, level of

consciousness, presence of extra-central

nervous system tuberculosis, isolation of

ESSENCE - International Journal for Environmental Rehabilitation and Conservation

Volume VIII: No. 1 2017 [168 – 178] [ISSN 0975 - 6272]

[www.essence-journal.com]

For correspondence: 1Central Molecular Research Laboratory, Shri Guru Ram Rai Institute of Medical and Health Sciences, SGRR University, Dehradun, Uttarakhand, India 2Uttaranchal P. G College of Biomedical Sciences and Hospital, Dehradun, Uttarakhand, India 3Kanya Gurukul Campus, Gurukul Kangri University, Haridwar,(U.K), India 4Kurukshetra University, Kurukshetra, Haryana, India 5Deptt. of Botany, Pt. L.M. P.G. Collge, Rishikesh, Uttarakhand, India

Sharma et al./Vol. VIII [1] 2017/168 – 178 

169 

Mycobacterium tuberculosis from

cerebrospinal fluid, pathologic biochemical

findings of cerebrospinal fluid (CSF),

hydrocephalus and cerebral infarction (Lu CH

et al., 2001). The diagnosis of TBM is based on

the detection of acid-fast bacilli (AFB) in CSF

smears, and, more commonly, by the isolation

of M tuberculosis from CSF cultures.

Approximately 80 % of the total CSF protein is

derived from the plasma, upon crossing the

blood–brain barrier and another 20 % is secreted

by the CNS (Kroksveen et al., 2011). The

Polymerase Chain Reaction (PCR) is most

sensitive, rapid and a versatile technique and is

increasingly being used in rapid diagnosis of

TB. This study was undertaken to evaluate the

role of TB PCR and significance of β-actin gene

in CSF for the cellular and molecular

characterization of Tuberculous meningitis. We

used primers for beta actin which is a conserved

repetitive element with specificity for M.

tuberculosis complex. The aim of this study was

to compare the efficiency of a PCR with a target

chosen from this cloned fragment with that of a

PCR with the widely used IS6110 sequence in

detecting M. tuberculosis in cerebrospinal fluid

(CSF) samples from patients suspected with

tuberculous meningitis. Materials and Methods:

In this study, a total of 70 CSF samples were

collected from different departments viz.

Medicine, Intensive Care Unit (ICU), Medical

Intensive Care Unit (MICU), High Dependency

Unit (HDU), Pediatrics, Neurosurgery and

Emergency of Shri Mahant Indiresh Hospital,

Dehradun (U.K.) to evaluate the significance of

Beta actin gene in CSF for the cellular and

molecular characterization of patient suspected

of tuberculosis meningitis. All the CSF samples

were processed further for various parameters.

A whole CSF sample was centrifuged at 13,000

rpm for 10 minutes at 4°C. The supernatant was

separated from CSF & then subjected for

nucleic acid extraction. DNA ISOLATION:

Spin column-based nucleic acid purification

was employed for DNA isolation from CSF

specimens. The multiplex PCR was utilized by

the usage of IS6110 gene along with the beta

actin gene (as tabulated in table 5.) as an internal

control, yielding an amplicon size of 123 base

pair for IS6110 and 306 base pair for β-actin

gene.

Gene Sequence (5’ to 3’) Size (bp)

β-actin F TCACCCACACACTGTGCCCATCTACGA 306

β-actin R CAGCGGAACCGCTCATTGCCAATGG 306 Table 1: Oligonucleotide primers used

Results

For the diagnosis of tuberculosis meningitis

samples were subjected to Pathological,

Biochemical, Microbiological, Cellular and

Molecular Profiling of cerebrospinal fluid.

Pathological Profiling

In pathological profiling, RBC, WBC,

Lymphocyte and Neutrophil count were

estimated (Table no. 12). In Pathological

examination RBC, WBC, Lymphocyte and

Neutrophil count were determined, RBC

appeared whenever bleeding was there. Red

cells in CSF signal subarachnoid hemorrhage,

stroke, or traumatic tap. A high WBC count may

indicate infection, inflammation or bleeding.

Lymphocytes should be 40-80%; viral infection

is usually associated with an increase in

lymphocytes counts. In early bacterial

Sharma et al./Vol. VIII [1] 2017/168 – 178 

170 

meningitis the proportion of neutrophils usually

exceeds from their normal range (0-6%).

Biochemical Profiling

In Biochemical examination, Glucose CSF,

Micro-protein CSF and ADA levels were

determined (Table no. 12). Acute bacterial

meningitis is usually associated with a CSF

protein concentration between 100 and 500

mg/dl, CSF protein is almost always high

tuberculous meningitis. A decreased glucose

level is seen in tuberculous meningitis,

Determination of ADA levels in CSF is a rapid

test to distinguish TBM from non- TB

Meningitis especially in Immunocompetent

hosts. Its sensitivity ranges from 75% to 94%

and specificity from 86% to 97%. But the role

of CSF ADA level determination is still

controversial in meningitis patient.

Cellular and Molecular Profiling

In Cellular and Molecular Profiling, DNA from

all the CSF samples was isolated and further

targeted for IS6110 gene, yielding an amplicon

size of 123 base pair and 306 base pair for β-

actin gene. It was seen that out of 70 specimens,

03 came Positive for both the targets i.e., IS6110

gene and β-actin gene, 09 were Positive for

IS6110 gene only and negative forβ-actin gene,

07 were positive for β-actin gene and negative

for IS6110 gene. In CSF examination, Positive

cases for both IS6110 gene and β-actin gene

show different CSF parameter i.e. high level of

RBC in two cases (1 and 70, as shown in Table

no. 12), WBC and lymphocyte in two cases (52

and 70), High level of Glucose in one case (01),

and low level in one case (70), High level of

Micro-protein in all the three cases (1,52,70),

and ADA level in two cases (52,70) were seen.

Positive cases for IS6110 shows high level of

RBC in four cases (10,21,32,43), high level of

WBC in six cases (10,21,26,32,43,61), high

level of Lymphocyte in three cases (8,21,26),

high neutrophils level in four cases

(10,32,43,61), high glucose level in four cases

(8,21,43,61), low level of glucose in two cases

(10,26) high level of micro-protein in six cases

(8,10,16,26,32,43), and high level of ADA in

four cases (10,16,17,26) were seen. Positive

cases for β-actin show high level of RBC in six

cases (34,37,46,48,59,63), WBC in three cases

(37,59 and 67), lymphocytes in all seven cases

(34,37,46,48,59,63,67), high level of glucose in

four cases (34,37,48,63), high level of micro-

protein in three cases (34,37,67) and high level

of ADA in one case (37) were seen.

Gender and Age Wise Analysis

07 Male came positive for both IS6110 and β-

actin gene, whereas 05 Female were positive for

IS6100 gene and 03 Positive for β-actin gene.

Most of the Positivity rate for mycobacterial

infection in CSF cases were in between 21-40

years (06 cases) when IS6110 gene was

amplified and β-actin gene was present in 05

cases in the same age group i.e. in between 21-

40 years of age.

Significance of Beta actin gene: Beta actin gene

can be a very important gene for the diagnosis

of tuberculous meningitis because it shows the

inflammation in brain due to bacterial

infections, the cases which are negative for

IS6110 Gene and positive for Beta actin shows

that there is an inflammation in brain other than

M. Tuberculosis, these includes N.

Meningitides. S. Pneumonia, L.

Monocytogenes, H. Influenza, S.pneumoniae.

Sharma et al./Vol. VIII [1] 2017/168 – 178 

171 

Sharma et al./Vol. VIII [1] 2017/168 – 178 

172 

Sharma et al./Vol. VIII [1] 2017/168 – 178 

173 

Case No.

Gender/Age Molecular Assay

ZN staining

Result Interpretation β –actin

(306 bp) IS6110 (123 bp)

1 Female/48 years Positive Positive Negative Positive for both IS6110 and β actin gene 2. Female/55 years Negative Negative Negative Negative for both IS6110 and β actin gene3. Female/38 years Negative Negative Negative Negative for both IS6110 and β actin gene 4. Female/21 years Negative Negative Negative Negative for both IS6110 and β actin gene 5. Male/60 years Negative Negative Negative Negative for bothIS6110 and β actin gene 6. Male/22 years Negative Negative Negative Negative for both IS6110 and β actin gene 7. Male/19 years Negative Negative Negative Negative for both IS6110and β actin gene 8. Female/35 years Negative Positive Negative Positive for IS6110and Negative for β actin gene 9. Female/4 days Negative Negative Negative Negative for both IS6110 and β actin gene 10. Male/45 years Negative Positive Negative Positive for IS6110and Negative for β actin gene 11. Female/40 years Negative Negative Negative Negative for both IS6110and β actin gene 12. Male/28 years Negative Negative Negative Negative for both IS6110 and β actin gene 13. Male/41 years Negative Negative Negative Negative for both IS6110and β actin gene 14. Female/1month Negative Negative Negative Negative for bothIS6110 and actin gene15. Female/19 years Negative Negative Negative Negative for both IS6110 and β actin gene 16. Female/45 years Negative Positive Negative Positive for IS6110and negative for β actin 17. Male/23 years Negative Positive Negative Positive for IS6110 and negative for β actin gene 18. Male/14 years Negative Negative Negative Negative for both IS6110 and β actin gene 19. Male/22 years Negative Negative Negative Negative for both IS6110and β actin gene 20. Male/16 years Negative Negative Negative Negative for bothIS6110 and β actin gene 21. Male/40 years Negative Positive Negative Positive for IS6110 and negative for β actin gene 22. Male/62 years Negative Negative Negative Negative for both IS6110 and β actin gene 23. Female/43 years Negative Negative Negative Negative for both IS6110 and β actin gene 24. Male/55 years Negative Negative Negative Negative for both IS6110 and β actin gene 25. Male/28 years Negative Negative Negative Negative for both IS6110 and β actin gene 26. Male/30 years Negative Positive Negative Positive for IS6110 and Negative for β actin gene 27. Female/28 years Negative Negative Negative Negative for both IS6110 and β actin gene 28. Male/60 years Negative Negative Negative Negative for both IS6110 and β actin gene 29. Female/45 years Negative Negative Negative Negative for both IS6110 and β actin gene 30. Male/17 years Negative Negative Negative Negative for both IS6110 and β actin gene 31. Male/58 years Negative Negative Negative Negative for both IS6110 and β actin gene 32. Male/7 years Negative Positive Negative Positive for IS6110 and negative for β actin gene 33. Female/17 years Negative Negative Negative Negative for both IS6110 and β actin gene 34. Female/25 years Positive Negative Negative Negative for IS6110 and Positive for β actin gene 35. Female/32 years Negative Negative Negative Negative for both IS6110 and β actin gene 36. Male/28 years Negative Negative Negative Negative for both IS6110 and β actin gene 37. Male/24 years Positive Negative Negative Negative for IS6110 and Positive for β actin gene 38. Female/6months Negative Negative Negative Negative for both IS6110 and β actin gene 39. Male/14 years Negative Negative Negative Negative for both IS6110 and β actin gene 40. Male/18 years Negative Negative Negative Negative for both IS6110 and β actin gene 41. Female/24 years Negative Negative Negative Negative for both IS6110 and β actin gene 42. Female/52 years Negative Negative Negative Negative for both IS6110 and β actin gene 43. Female/19 years Negative Positive Negative Positive for IS6110 and negative for β actin gene 44. Male/62 years Negative Negative Negative Negative for both IS6110 and β actin gene 45. Male/48 years Negative Negative Negative Negative for both IS6110 and β actin gene 46. Male/70 years Positive Negative Negative Negative for IS6110 and Positive for β actin gene 47. Male/40 years Negative Negative Negative Negative for both IS6110 and β actin gene 48. Male/14 years Positive Negative Negative Negative for IS6110 and Positive for β actin gene 49. Female/23 years Negative Negative Negative Negative for both IS6110 and β actin gene 50. Female/23 years Negative Negative Negative Negative for both IS6110 and β actin gene 51. Female/35 years Negative Negative Negative Negative for both IS6110 and β actin gene 52. Female/65 years Positive Positive Negative Positive for both IS6110 and β actin gene 53. Male/8 years Negative Negative Negative Negative for both IS6110 and β actin gene 54. Female/35 years Negative Negative Negative Negative for both IS6110 and β actin gene 55. Male/6 years Negative Negative Negative Negative for both IS6110 and β actin gene 56. Male/57 years Negative Negative Negative Negative for both IS6110 and β actin gene 57. Female/16 years Negative Negative Negative Negative for both IS6110 and β Beta actin gene

Sharma et al./Vol. VIII [1] 2017/168 – 178 

174 

58. Male/22 years Negative Negative Negative Negative for both IS6110 and β actin gene 59. Male/39 years Positive Negative Negative Negative for IS6110 and Positive for β actin gene 60. Male/13 years Negative Negative Negative Negative for both IS6110 and β actin gene 61. Male/22 years Negative Positive Negative Positive for IS6110 and Negative for β actin gene 62. Male/08 years Negative Negative Negative Negative for both IS6110 and β actin gene 63. Male/26 years Positive Negative Negative Negative for IS6110 and Positive for β actin gene 64. Male/42 years Negative Negative Negative Negative for both IS6110 and β actin gene 65. Male/36 years Negative Negative Negative Negative for both IS6110 and β actin gene 66. Male/9 years Negative Negative Negative Negative for both IS6110 and β actin gene 67. Male/30 years Positive Negative Negative Negative for IS6110 and Positive for β actin gene 68. Male/59 years Negative Negative Negative Negative for both IS6110 and β actin gene 69. Male/66 years Negative Negative Negative Negative for both IS6110 and β actin gene 70. Male/19 years Positive Positive Negative Positive for both IS6110 and β actin gene *bp = Base pair Table 3. Cellular and Molecular Profiling of CSF

Cases

Total number of case for Tuberculosis

meningitis Positive cases for IS6110gene Positive cases for β actin gene

70 12 10 Table 4. Total number of positive cases for IS6110 gene and β actin

gene

Gender Number of cases Positive IS6110 β-actin

Male 44 7 7 Female 26 5 3

Table 5. Gender wise Distribution of Positive cases for Male and Female

Age groups (years) Number of cases Positive for IS6110 Positive for β-actin

0-20 21 2 2 21-40 28 6 5 41-60 16 2 1

Above 60 05 2 2 Table 6: Age wise distribution of Positive cases for IS6110 and β-

actin genes

Sharma et al./Vol. VIII [1] 2017/168 – 178 

175 

A: shows 306 base pair amplicon size for β-actin gene in 1 and 2 well B: shows 306 base pair amplicon size for β-actin gene in 1,2 and 6 well C: shows 306 base pair amplicon size for β-actin gene in 1 well D: shows 306 base pair amplicon size for β-actin gene in 2,6 and 7 Well

Sharma et al./Vol. VIII [1] 2017/168 – 178 

176 

Discussion

Βeta actin is a highly conserved protein

expressed in all eukaryotic cells. It is a stable

cytoskeleton protein which is used as a Loading

control in PCR. Our study was undertaken in

clinical samples of patients from Uttarakhand

and its adjoining states. In our study, 70 CSF

samples were processed, which were with the

history of fever, headache, vomiting, neck

rigidity, altered mental status (i.e. confusion,

coma) and altered sensorium. In CSF

examination, 10 cases out of 70 were positive

for β-actin gene and 12 for IS6110 gene. The

above results show that patient having any

neurological disorder have presence of RBC,

high WBC, lymphocytes, Micro-protein and

low level of Glucose in their CSF. These

parameters show sign of inflammation in

Central nervous system. The PCR for β-actin

gene was most likely to give a positive result

when the CSF sample being tested came from a

patient having any neurological disorder, so it

can be hypothesized thatβ- actin gene can be an

important marker for any neurological disorder

whether it is due to M. Tuberculosis or any other

pathogenic micro-organisms. The presence of

β-actin gene was found in the patients with

neurological disorders other than TBM which is

an important finding as this can be utilized to

differentiate the TBM and other inflammations

of the brain. It could be possible that the

presence of highly specificβ-actin gene in 07

patients which came negative for tuberculosis

meningitis have inflammation of other

pathogenic microorganisms. It could be a

useful tool in supporting diagnosis, in particular

when patients is not suffering from tuberculosis

meningitis but have all symptoms of meningitis,

so presence of beta actin gene can confirm the

presence of other pathogenic micro-organisms

which are responsible for meningitis. It can also

be useful when radiological methods have failed

to establish the presence of pathogenic micro-

organisms in central nervous system.

Interestingly, the 09 patients investigated which

are positive for IS6110 gene comes out negative

for the presence of β-actin gene.

Conclusion

TBM is a serious CNS infection associated with

significant mortality and high morbidity among

the survivors. The only way to reduce mortality

and morbidity is by early diagnosis and timely

recognition of complications following the

progression of the disease and in post-treatment

follow-up.A correlation between disease

severity and PCR positivity could be clinically

useful but, given the variability in the clinical

manifestation of TBM and other neurological

infections need to be evaluated further. The

above protocol for β-actin gene can be further

standardized by multiplexing with IS6110 and

mbp 64 genes for the diagnosis and validation

of internal control for M. Tuberculosis complex.

These methods can be utilized for the

prevalence of strains of M. Tuberculosisin India

and its neighboring countries like Pakistan,

Bhutan, Nepal, and Bangladesh etc. The cases

which were positive for IS6110 gene and

negative for β-actin gene, there can be a

possibility of latent Tuberculosis which can be

further studied by interferon gamma release

assays etc. which will differentiate between

Latent and Active tuberculosis.

Sharma et al./Vol. VIII [1] 2017/168 – 178 

177 

Acknowledgment

The authors are grateful to Honorable

Chairman, Shri Guru Ram Rai Education

Mission for his kind support and guidance.

References

Anderson, J. M. and McMillan, J. J. (1975): Intracranial tuberculoma – an increasing problem in Britain. J Neurol Neurosurg Psychiatr. 38: 194.

Anne, C.; Andersen, B. A.; Thomsen, V.; Peter, H.A. and Johansen, S. I. (2011): Tuberculous meningitis in Denmark: a review of 50 cases BMC Infectious Diseases. 11: 47.

Arestis, N.; Than, Y. J. and Melynbyre, P.B. (1999): A population study of children with cerebral tuberculosis in New South Wales. M d J Aust. 171: 197–200.

Arnvig, K.B. and Young, D. B. (2009): "Identification of small rnas inmycobacterium tuberculosis". Mol. Microbiol. With a further 56 predicted in a bioinformatics screen.

Livny, J.; Brencic, A.; Lory, S. and Waldor, M. K. (2006):"Identification of 17 Pseudomonas aeruginosa srnas and prediction of srna-encoding genes in 10 diverse pathogens using the bioinformatic tool srnapredict

Gupta, B. K.; Bharat, A.; Debapriya, B. and Baruah, H. (2010): “Adenosine deaminase levels in CSF of tuberculous meningitis patients,” Journal of Clinical Medicine Research. 2(5):220–224.

Barry, S. M.; Lipman, M. C. and Johnson, M. A. (1999): Respiratory infections in immuno compromised patients.

Berenguer, J.; Moreno, S. and Lagua, F. (1992): Tuberculous meningitis in patients infected with human immunodefi ciency virus. N Engl J Med. 326: 668–72.

Berger, C.; Braegger, C. P. and Albisetti, M. (1996): Cerebral tuberculosis presenting as complex febrile convulsions. Neuropediatr. 27: 161–63.

Bhishagratna, K. K. L. and Bhaduri, S. L. (1916): “An English Translation of the Sushruta Samhita”, Calcutta.

Bradfield, E. (1938) “An Indian Medical Review”, New Delhi, Government of India Press.

Brennan, P. J. and Draper, P. (1994): In Tuberculosis: Pathogenesis, Protection, and Control (ed. Bloom, B. R.) 271–284 (Am. Soc. Microbiol., Washington DC.

Brierley, R. (2005): Hunterian Museum re-opens. Lancet Infect Dis. 5: 207.

Brooks, J. B. and Chaudhary G. C. (1977): Electron capture gas liquid chromatography and mass spectrum identifi cation of 3-(2’- ketohexyl) indoline in spinal fluids of patients with tuberculous meningitis. J Clin Microbiol. 5: 625–28.

Burstein, J.; Papile, L. A. and Burstein, R. (1979): Intraventricular hemorrhage and hydrocephalus in premature newborns: a prospective study with CT. AJRAm J Roentgenol. 132(4): 631-635.

Sharma et al./Vol. VIII [1] 2017/168 – 178 

178 

Vinnard, C.; Winston, C. A.; Wileyto, E. P.; Macgregor, R. R. and Bisson, G. P. (2010): “Isoniazid resistance and death in patients with tuberculous meningitis: retrospective cohort study,” British Medical Journal. 341: C4451,

Cave, A. J. E. (1939): The evidence for the incidence of tuberculosis in ancient Egypt. Br J Tuberc. 33: 142–152.

CDC, “Reported Tuberculosis in the United States,” Atlanta, Ga, USA, U.S. Department of Health and Human Services, CDC, Surveillance Report,

Centers for Disease Control and Prevention. Trends in tuberculosis: United States 2012. MMWR Morb Mortal Wkly Rep 2013; 62:201–205

Choi, S. H.; Kim, Y. S. and Bae, I. G. (2002): The possible role of cerebrospinal fluid adenosine deaminase activity in diagnosis of tuberculous meningitis adults. Clin Neurol Neurosurg.104: 10–15.

Conwell, W. E. (1829): “Observations chiefly on Pulmonary Disease in India and an essay on the use of the stethoscope”, missionpress.

Cruciani, M.; Scarparo, C.; Malena, M.; Bosco, O.; Serpelloni, G. and Mengoli, C. (2004): Meta-analysis of BACTEC MGIT 960 and BACTEC 460 TB, with or without solid media, for detec-tion of mycbacteria. J Clin Microbiol. 42:2321–25.

Czosnyka, M.; Czosnyka, Z. and Agarwal-Harding, K. J. (2012): Modelling of CSF dynamics: legacy of Professor Anthony Marmarou. Acta NeurochirSuppl. 113:9-14.

Kennedy, D. H. and Fallon, R. J. (1979): “Tuberculous meningitis,” Journal of the American Medical Association. 241(3): 264–268.

Dolin, P.J.; Raviglione, M. C. and Kochi, A. (1994): Global tuberculosis incidence and mortality during 1990–2000. Bull WHO. 72: 213–20.

Donoghue, H. D.; Spigelman, M. and Greenblatt, C. L. (2004): Tuberculosis: from prehistory to Robert Koch, as revealed by ancient DNA. Lancet Infect Dis. 4: 584–592.

Donoghue, H. D. (2013): Insights into ancient leprosy and tuberculosis using metagenomics. Trends Microbiology. 21: 448–450.

Drancourt, M. and Raoult, D. (2005): Paleomicrobiology: current issues and perspectives. Nat Rev Microbiol. 3: 23–35.

Eltringham, I. J. and Drobniewski, F. (2006): Multiple drug resistant tuberculosis resistant tuberculosis, Epidemiological and clinical features,” International Journal of Tuberculosis and Lung Disease. 10(1): 99–103.

Ewart, J. “Scrofula, Tuberculosis, and Phthisis in India”, The British Medical Journal, May 21, 1 881, 809.