Running Title: Or reduces β-carotene turnover · has no effect on the transcript levels of...

1

1

Corresponding author: 2

Yaakov Tadmor 3

Department of Vegetable Research, ARO, Newe Ya’ar Research Center, P.O. Box 1021, 4

Ramat Yishay 30095, Israel 5

Email: [email protected]. 6

7

The author responsible for distribution of materials integral to the findings presented in 8

this article in accordance with the policy described in the Instructions for Authors 9

(www.plantphysiol.org) is: Yaakov Tadmor ([email protected]). 10

11

Running Title: Or reduces β-carotene turnover 12

13

Research Area: biochemistry and metabolism 14

15

16

Plant Physiology Preview. Published on November 11, 2016, as DOI:10.1104/pp.16.01256

Copyright 2016 by the American Society of Plant Biologists

www.plantphysiol.orgon August 11, 2019 - Published by Downloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

Distinct Mechanisms of the ORANGE Protein in Controlling Carotenoid 17

Flux 18

Noam Chayut, Hui Yuan, Shachar Ohali, Ayala Meir, Uzi Sa‘ar, Galil Tzuri, Yi Zheng, 19

Michael Mazourek, Shimon Gepstein, Xiangjun Zhou, Vitaly Portnoy, Efraim Lewinsohn, 20

Arthur A. Schaffer, Nurit Katzir, Zhangjun Fei, Ralf Welsch, Li Li, Joseph Burger, and 21

Yaakov Tadmor*. 22

23

Department of Vegetable Research, ARO, Newe Ya’ar Research Center, P.O. Box 1021, 24

Ramat Yishay 30095, Israel (NC, SO, AM, US, GT, VP, EL, AAS, NK, JB, YT), Plant Breeding 25

and Genetics Section, School of Integrative Plant Science, Cornell University, Ithaca, New 26

York 14853, USA (HY, MM, XZ, LL), Boyce Thompson Institute, Cornell University, Ithaca, 27

NY 14853, USA (YZ, ZF), Faculty of Biology, Technion – Israel Institute of Technology, 28

Haifa 32000, Israel (NC, SG), Department of Vegetable Research, ARO, Volcani Center, 29

Agricultural Research Organization, P.O. Box 6, Bet Dagan 50250, Israel (AAS), USDA-ARS 30

Robert W. Holley Center for Agriculture and Health, Ithaca, NY 14853, USA (ZF, LL), 31

Faculty of Biology II, University of Freiburg, Freiburg, Germany (RW) 32

33 * Corresponding author 34

35

One sentence summary 36

CmOr 'golden' SNP dramatically affects carotenoid content and plastid fate in 37

melon by inhibiting metabolism downstream to β-carotene 38

List of author contributions 39

NC conducted the experiments and analyses, and wrote the manuscript. 40

HY, SO, AM, US, GT, and XZ provided technical assistance and performed protein 41

analyses. 42

ZF supervised bioinformatics analyses. 43

MM, SG, VP, EL, AS, NK, RW, LL and JB participated in the experiments designs. 44

RW and LL supervised the protein analyses, and significantly contributed to manuscript 45

writing. 46



3

YT designed the experiments, selected the plant materials, supervised the research and 47

edited the manuscript 48

49

All the authors have read and approved the final manuscript. 50

51

52

Funding information (if any) Funding for this research was provided by the United 53

States-Israel Binational Agricultural Research and Development Fund (BARD) US-4423- 54

11 and US-4918-16CR, by the Israeli Ministry of Agriculture Chief Scientist grant no. 256- 55

1103-15 and in part by the ‘Center for the Improvement of Cucurbit Fruit Quality’, ARO, 56

Israel. R.W. was supported by the Harvestplus Research Consortium. 57

58

Present addresses (if any) 59

60

Keywords: Carotenoids, β-carotene, chromoplast, fruit ripening, Cucumis melo, CmOr, 61

phytoene synthase, carotenoid isomerase, metabolic inhibition. 62

63



4

ABSTRACT 64

β-carotene adds nutritious value and determines the color of many fruits including 65

melon. In melon mesocarp, β-carotene accumulation is governed by the Orange gene 66

(CmOr) ‘golden’ SNP through a yet to be discovered mechanism. In Arabidopsis, OR 67

increases carotenoid levels by posttranscriptionally regulating phytoene synthase (PSY). 68

Here we identified a CmOr nonsense mutation (Cmor-lowβ), which lowered fruit β- 69

carotene levels with impaired chromoplast biogenesis. Cmor-lowβ exerted a minimal 70

effect on PSY transcripts but dramatically decreased PSY protein levels and enzymatic 71

activity, leading to reduced carotenoid metabolic flux and accumulation. However, the 72

‘golden’ SNP was discovered to not affect PSY protein levels and carotenoid metabolic 73

flux in melon fruit, as shown by carotenoid and immunoblotting analyses of selected 74

melon genotypes and by using chemical pathway inhibitors. The high β-carotene 75

accumulation in ‘golden’ SNP melons was found to be due to a reduced further 76

metabolism of β-carotene. This was revealed by genetic studies with double mutants 77

including crtiso (‘yofi’), a carotenoid-isomerase nonsense mutant, which arrests the 78

turnover of prolycopene. The ‘yofi’ F2 segregants accumulated prolycopene 79

independently of the ‘golden’ SNP. Moreover, Cmor-lowβ was found to inhibit 80

chromoplast formation and chloroplast disintegration in fruits from 30 days after 81

anthesis until ripening, suggesting that CmOr regulates chloroplast-to-chromoplast 82

transition. Taken together, our results demonstrate that CmOr is required to achieve 83

PSY protein levels for maintaining carotenoid biosynthesis metabolic flux, but that the 84

mechanism of the CmOr 'golden' SNP involves an inhibited metabolism downstream to 85

β-carotene to dramatically affect both carotenoid content and plastid fate. 86

87

88



5

INTRODUCTION 89

β-Carotene, a C-40 isoprenoid molecule, is the major source of vitamin A in the human 90

diet (Maiani et al., 2009). Lack of dietary vitamin A is a common cause of premature 91

death and child blindness in developing countries. β-Carotene is abundant in diverse 92

edible plant tissues such as pumpkin fruits, sweet potato tubers, carrot roots, kale 93

leaves, mango and orange-flesh melon fruits (Howitt and Pogson, 2006; Yuan et al., 94

2015b). In green tissues, two β-carotene molecules are located in each photosystem II 95

reaction center to facilitate electron transfer and to provide photo-protection by 96

quenching singlet oxygen products (Telfer, 2002). In many fruits and flowers, β-carotene 97

serves as yellow-orange colorant and as a precursor for aromatic molecules to attract 98

pollinators and seed dispersers (Walter and Strack, 2011). 99

β-Carotene is a metabolite in the carotenoid biosynthesis pathway, which 100

receives its precursors from the plastid-localized methyl-erythritol phosphate (MEP) 101

pathway. Carotenoid biosynthesis starts with the condensation of two geranylgeranyl 102

diphosphate (GGPP) molecules, yielding the colorless carotene phytoene in a reaction 103

catalyzed by phytoene synthase (PSY) (Nisar et al., 2015). Two desaturases, phytoene 104

desaturase (PDS) and ζ-carotene desaturase (ZDS), introduce four double bonds into 105

phytoene to convert phytoene into lycopene. The cis-configured carotene double bonds 106

are isomerized to the trans configuration by two enzymes ζ-carotene isomerase (Z-ISO) 107

and carotenoid isomerase (CRTISO). Z-ISO isomerizes the 15-cis double bond in 9,15,9′- 108

tri-cis-ζ-carotene, a reaction that can also be catalyzed by light in green tissues (Chen et 109

al., 2010). CRTISO isomerizes all four cis double bonds in prolycopene (7,9,7′,9′-tetra-cis- 110

lycopene). These isomerizations yield all-trans-lycopene, the substrate for lycopene β- 111

and ε-ring cyclases (Isaacson et al., 2002). CRTISO deficiency results in an arrest of 112

pathway flux in tissues without a functional photosynthetic apparatus; for instance, 113

CRTISO mutant tomato or melon fruits accumulate mainly prolycopene (Isaacson et al., 114

2002; Galpaz et al., 2013). 115

All-trans-lycopene can be cyclized twice by lycopene β-cyclase (β-LCY) into β- 116

carotene or, alternatively, by β-LCY and lycopene ε-cyclase (ε-LCY) into α-carotene. β- 117



6

carotene is further hydroxylized and epoxidized to form xanthophylls. β-carotene and 118

other carotenoids also serve as substrates for various carotenoid cleavage dioxygenases 119

(CCD) to produce apocarotenoids, including phytohormone abscisic acid (ABA) and 120

strigolactones, and volatiles and scent molecules (Nisar et al., 2015; Yuan et al., 2015b) 121

(Fig. 1) 122

Melon, Cucumis melo L. (Cucurbitaceae), is an important crop with an estimated 123

annual yield of more than 32 million tons worldwide (http://faostat3.fao.org). Fruit flesh 124

(mesocarp) color is an important commercial trait and can be categorized into three 125

distinctive phenotypes: white, green and orange (Chayut et al., 2015). The orange 126

phenotype is a result of massive β-carotene accumulation in the fruit mesocarp 127

governed by the ‘golden’ SNP of the Orange (CmOr) gene (Tzuri et al., 2015). Melon 128

plants carrying a dominant CmOr allele bear orange-flesh fruits, while homozygous 129

recessive Cmor plants bear white or green-flesh fruits. The ‘golden’ SNP transversion 130

alters arginine to histidine at position 108, thus the recessive and dominant alleles will 131

be termed hereafter Cmor-Arg and CmOr-His, respectively. CmOr natural allelic variation 132

has no effect on the transcript levels of carotenogenesis genes (Chayut et al., 2015) and 133

its mechanism of action in melon fruit is still largely unknown. 134

The Or gene was originally discovered in cauliflower (Brassica oleracea L. var. 135

botrytis L.; BoOr) and shown to enhance sink strength by triggering the biogenesis of 136

chromoplasts in non-green tissues (Lu et al., 2006). Carotenoid biosynthetic gene 137

expression was not changed by the BoOr mutation (Li et al., 2001). OR protein is 138

targeted to the plastid and contains a cysteine-rich zinc finger domain that is found in 139

DnaJ co-chaperones. However, OR lacks the J domain that defines this class of proteins 140

(Giuliano and Diretto, 2007). In Arabidopsis, OR proteins were shown to directly interact 141

and posttranscriptionally regulate PSY in controlling carotenoid biosynthesis (Zhou et al., 142

2015). Overexpression of the Arabidopsis OR protein mutagenized in the corresponding 143

site of the melon ‘golden’ SNP (altering arginine to histidine) resulted in high β-carotene 144

levels (Yuan et al., 2015a). The high β-carotene accumulation in these cases has been 145

associated with chromoplast biogenesis (Lu et al., 2006; Yuan et al., 2015a). However, 146



7

how OR regulates various processes in ultimately affecting carotenoid accumulation 147

remains elusive. 148

In this work, we isolated an EMS induced nonsense mutation in CmOr ('low-β'), 149

which dramatically lowered β-carotene level in melon fruit mesocarp. By comparing 150

'low-β' to its isogenic progenitor, we show that an active CmOr is required to maintain 151

PSY protein level and activity in developing melon fruit mesocarp. However, by 152

examining various melon accessions, differing in the ‘golden’ SNP, we found that 153

regulation of PSY level and activity is not the mechanism by which CmOr natural allelic 154

variation governs fruit β-carotene levels in melon. Our biochemical inhibition and 155

genetic studies show that the ‘golden’ SNP variation does not change β-carotene 156

synthesis rate. Chemical inhibition and genetic arrest of the carotenogenic flux resulted 157

in the accumulation of carotenoids, independently of the ‘golden’ SNP. Thus, we suggest 158

that CmOr-His stabilizes β-carotene and inhibits its turnover, resulting in β-carotene 159

accumulation and chromoplast formation potentially as a metabolite derived process. 160

161

RESULTS 162

163

Isolation of an EMS Induced ‘low β’ Mutant and its Fruit Phenotype Analysis 164

To further study the molecular role of CmOr in melon fruit, we screened M2 families of 165

the previously described orange flesh CEZ-based EMS library for fruit color changes 166

(Tadmor et al., 2007; Galpaz et al., 2013). Twelve plants from each of 1,000 M2 families 167

were grown in the field and the mature fruit were visually phenotyped. The M2 family 168

cem1697 showed lower flesh color intensity, which was inherited recessively monogenic 169

as concluded from segregation analyses. One pale-fleshed individual of cem1697 was 170

backcrossed to the parent line CEZ and then self-pollinated followed by selection of a 171

green-fruited individual, which was self-pollinated for additional two generations. The 172

line obtained was isogenic to CEZ but with green-fleshed fruits, and was named 'low β' 173

(Fig. 2A). 174



8

Comparative visualization of over 100 'low β' and CEZ plants under commercial 175

field and greenhouse conditions did not reveal any phenotypic variation except the 176

modified fruit flesh color. The first slightly visible color difference between ’low β’ and 177

CEZ fruit appeared at 20 days after anthesis (DAA) (Fig. 2A). The color difference became 178

most notable at 30 DAA; CEZ flesh turned orange, while 'low β' flesh remained green. 179

When the fruit matured (40-42 DAA), CEZ flesh became uniformly deep orange whereas 180

the mutant flesh was green with pale orange tissue adjacent to the seed cavity (Fig. 2A). 181

We measured flesh carotenoid concentration in CEZ and 'low β' developing fruit 182

by HPLC. β-Carotene level was 11.7- and 30.1-fold lower at 30 DAA and at the mature 183

stage, respectively, in the flesh of the mutant as compared to CEZ (Fig. 2B and Fig. S1). 184

Other carotenoids were detected at low levels. Lutein was found only in ‘low β’ mature 185

fruits but not in CEZ, while α-carotene was present only in CEZ but not in ‘low β’ (Fig. 186

S1). During CEZ fruit development from 10 to 30 DAA, total chlorophyll levels increased 187

3.2-fold and then almost completely disappeared at the mature stage. During early ‘low 188

β’ fruit development, the total chlorophyll levels increased similarly until 30 DAA. 189

However, unlike CEZ, ‘low β’ chlorophyll levels declined only mildly at the mature stage 190

(Fig. 2C). 191

Light microscopy of thin cross sections of mature CEZ fruit mesocarp revealed 192

the existence of one or two orange bodies, probably chromoplasts, per cell (Fig. 2D). In 193

contrast, most ‘low β’ mesocarp cells were colorless or spotted with a small number of 194

green chloroplasts, which were usually concentrated in a single area (Fig. 2E). In 195

protoplasts isolated from CEZ fruit mesocarp, orange β-carotene structures were 196

sometimes seen inside chromoplasts (Fig. 2F, and Fig. S2A,B), but often as large floating 197

crystals with lengths of up to the entire protoplast diameter (Fig. 2F, and Fig. S2C). In 198

contrast, isolated protoplasts of ‘low β’ mesocarp cells contained chloroplasts, but did 199

not contain chromoplasts and visible carotenoid crystals (Fig. 2G and Fig. S2E,F). The 200

crystal shapes found in CEZ fruit were diverse, as fine rods (Fig. 2F and Fig. S2G), thin 201

plane polygons (Fig. S2G), spiral threads (Fig. 2F) or shapeless aggregates (Fig. S2C,H). 202

Most of the ‘low β’ protoplasts contained up to 20 chloroplasts (Fig. 2G), seldom up to 203



9

~100 chloroplasts in one protoplast (Fig. S2E,F). Chlorophyll autoflorescence was never 204

observed in CEZ protoplasts of mature fruit mesocarp cells, indicating complete absence 205

of chloroplasts in these cells (Fig. S2D). Protoplast sizes varied tremendously in both 206

lines; ranging from approximately 25 µm to approximately 85 µm in diameter (Fig. S2I 207

and Fig. S2B). In summary, the microscopic analysis indicated that ‘low β' mature fruit 208

mesocarp cells contained chloroplasts and lacked free β-carotene crystals structures, as 209

opposed to CEZ mature fruit mesocarp cells. 210

211

'low β' Carries a Mutation in the CmOr Gene 212

Based on the phenotypic similarity with the recessive homozygous Cmor-Arg melon 213

fruits (Tzuri et al., 2015), we hypothesized that ‘low β’ was mutated either in the CmOr 214

gene or alternatively in a structural gene of the carotenoid metabolic pathway. To 215

differentiate between these two options, we conducted a genetic complementation 216

test. We crossed 'low β' as well as its parental line CEZ (homozygous for CmOr-His) with 217

a panel of non-orange lines (NY, NA, ED, TAD, PDS, all homozygous for Cmor-Arg; Table 218

1). As control, crossings were made also with CmOr-His homozygous orange lines (INB, 219

DUL, CEZ; Table 1). We visually phenotyped the color of the hybrid fruit flesh. 220

Complementation of the ‘low β’ phenotype through a cross with a non-orange line 221

would indicate that the ‘low β’ mutation is not allelic to CmOr. In all crosses with CEZ, 222

the F1 hybrid showed the expected orange-flesh phenotype (Fig. 3A; i-p). Similarly, when 223

‘low β’ was crossed with homozygous dominant CmOr-His lines, the F1 was also orange- 224

fleshed (Fig. 3A; f-h). However, in all crosses between ’low β’ and homozygous Cmor-Arg 225

lines, the F1 had a non-orange flesh color, indicating that the ‘low β’ mutation was not 226

complemented (Fig. 3A; a-e). These results strongly suggested that the 'low β' 227

phenotype was caused by a mutation at the CmOr locus; a presumably third CmOr allele 228

hereby designated Cmor-lowβ. 229

230

The 'low β' Mutation Leads to Reduced CmOr Transcript and CmOR Protein Levels 231



10

Sequence analysis of the CmOr cDNA in 'low β' revealed a transversion of A487 to T, 232

which altered CmOR Lys163 to a 'STOP' codon (AAG to TAG; Fig. 3B, full coding sequence 233

in Fig. S3). CmOr mRNA levels were found to be significantly lower in ‘low β’ as 234

compared with CEZ at all the tested fruit developmental stages (Fig. 3C). We compared 235

CmOR protein levels by Western blot analysis and used high density (15%) separating 236

gels in order to include the predicted truncated CmOR with an expected size of 18 kD 237

(Fig. S4). CmOR was not detected in any fruit developmental stage of 'low β', while in 238

CEZ CmOR-His was more abundant at 20 and 30 DAA than at the mature stage (Fig. 3D), 239

correlating with CmOr expression pattern (Fig. 3C). 240

The N-terminal region of OR is required for interaction with PSY, while the C- 241

terminal of OR is crucial for dimerization (Zhou et al., 2015). We therefore analyzed 242

whether the CmOR truncation in lowβ affected the capacity to form dimers and to 243

interact with PSY. For these purposes, we used the yeast split-ubiquitin system and co- 244

expressed proteins fused to either the N-terminal (Nub) or C-terminal (Cub) ubiquitin 245

moiety. Interaction-growth test and quantification of the reporter gene lacZ activity 246

confirmed that CEZ CmOR-His formed homodimers, consistent with previous findings 247

(Zhou et al., 2015; Fig. 3E). However, CmOR-lowβ lost its ability to form homodimers 248

(Fig. 3E), while the N-terminal 162 amino acids were sufficient to interact with PSY 249

similarly as CmOR-His (Fig. S5). 250

251

The 'low β' Mutation Dramatically Reduces PSY Protein Level 252

While β-carotene levels were significantly lower in 'low β' fruits compared with CEZ, our 253

fruit transcriptome analysis revealed that the carotenoid biosynthetic pathway genes 254

were expressed similarly at 10, 20 and 30 DAA (Table S1). However, in the mature ‘low 255

β’ fruit, transcripts of several genes of the MEP and carotenoid pathways were up- 256

regulated compared with CEZ (Fig. S6). These genes included 1-deoxy-D-xylulose-5- 257

phosphate synthase (DXS), geranylgeranyl diphosphate synthase (GGPPS) and PSY-1. 258

PSY-1 is one of the three PSY paralogs in melon genome, which was shown to correlate 259

with fruit carotenoid accumulation (Qin et al., 2011). This was confirmed by our 260



11

transcriptome analysis (Fig. 4A). PSY-2 expression was much lower than PSY-1 and 261

showed different pattern during fruit ripening (Fig. 4B). 262

To test if the strong reduction of CmOR protein in ‘low β’ fruit mesocarp affects 263

PSY protein levels, we performed Western blot analysis of the fruit PSY-1, in ‘low β’ and 264

in its isogenic progenitor line (CEZ) during fruit development. In CEZ, PSY protein 265

maintained high levels at 20 and 30 DAA with a slight reduction in mature fruit. In 266

contrast, PSY was almost absent in 'low β' fruit flesh at 20 and 30 DAA, but increased at 267

the mature stage to similar levels as found in CEZ (Fig. 4C). This correlates with fruit 268

colors, showing maximal difference between ‘low β’ and CEZ at 30 DAA and the 269

appearance of orange coloration around the ‘low β’ mature fruit seed cavity (Fig. 2A). 270

Since AtOr-like (AT5G06130.2) partially compensates AtOR in maintaining PSY protein 271

level in Arabidopsis (Zhou et al., 2015), we examined the expression of CmOr-like 272

(MELO3C024554). CmOr-like expression was stable from 10 to 30 DAA but raised about 273

2-fold in the mature fruit, providing a possible explanation for the increased PSY levels 274

found in the mature fruits of 'low-β' in the absence of CmOr (Fig. S7A,B). 275

276

Biochemical Inhibition of Carotenogenesis Shows Lower Metabolic Flux in ‘low β’ 277

Apparently, the low PSY protein level in ‘low β’ was responsible for the reduced 278

accumulation of β-carotene in the ‘low β’ fruits. To confirm this, we determined the 279

metabolic flux following chemical inhibition. Phytoene levels upon norflurazon (NF) 280

inhibition are considered to be directly correlated with PSY activity (Beisel et al., 2011; 281

Lätari et al., 2015). We treated developing fruit flesh discs of ‘low β’ and CEZ with NF 282

and determined phytoene accumulation by HPLC at 12 and 24 h after treatment. At 30 283

DAA when fruit carotenoid metabolic flux peaks (Fig. S8A), 12 h of NF treatment 284

resulted in a substantial elevation of phytoene in CEZ fruit discs (Fig. 4D; a) but only in a 285

minor elevation in ‘low β’ (Fig. 4D; c). Trace levels of phytoene were also detected in 286

water-treated control fruit discs of CEZ but not in ‘low β’ (Fig. 4D; b,d). On average, CEZ 287

accumulated 6.7 and 3.6-fold more phytoene than ‘low β’ during 12 and 24 h of 288



12

treatment, respectively (Fig. 4E). In 20 DAA fruit discs, CEZ accumulated 2.8 and 1.8-fold 289

more phytoene than ‘low β’ during 12 and 24 h of inhibition, respectively (Fig. S8B). 290

Flux differences between ‘low β’ and CEZ were further confirmed by the use of 2- 291

(4-chlorophenylthio) triethylamine (CPTA), an inhibitor of lycopene cyclase (Fig. 1), 292

followed by lycopene quantification by HPLC. CPTA-treated CEZ fruit discs accumulated 293

about 2-fold more lycopene than ‘low β’ after 24 h of treatment in 20 and 30 DAA fruit 294

discs (Fig. S8C,D). Clearly, carotenogenesis inhibition by both inhibitors suggested a 295

lower carotenoid biosynthesis rate in fruits of the ‘low β’ mutant than in CEZ, which was 296

likely due to the reduced PSY protein levels resulting from the dysfunctional CmOR in 297

the ‘low β’ mutant. 298

299

CmOr-lowβ Reduces the Metabolic Flux in Developing Fruits of crtiso Mutant 300

To confirm the CmOr-lowβ effect on the metabolic flux in vivo, we designed a double 301

mutant experiment using the melon crtiso mutant called ‘yofi’. This line exhibits a 302

dysfunctional crtiso due to a premature stop codon, which prevents carotenoid 303

isomerization in the fruit flesh and causes the accumulation of light yellow prolycopene 304

(Galpaz et al., 2013). The prolycopene amounts in a CRTISO-deficient background would 305

indicate pathway flux without the impact of further metabolism of β-carotene, similar to 306

chemical inhibition of carotenoid biosynthesis performed so far. 307

'yofi' carries the CmOr-His allele, as CEZ is also its wild-type progenitor. We 308

crossed ‘low β’ with ‘yofi’. The F1 hybrid fruit flesh color was orange as expected, since 309

they were heterozygous at both the CRTISO as well as the CmOr loci. The F2 offspring 310

segregated as expected for two independent recessive genes. We used physiological 311

and molecular markers to select four combinations of CRTISO and Or as follows: the 312

double wild-type alleles, the two single gene mutants and the double mutant (Fig. 5A). 313

Representative fruits of these genotypes, at 20 DAA and at the mature stage, were 314

analyzed for carotenoid composition by HPLC (Fig. 5C and Table S2). Since ‘yofi’ 315

accumulates prolycopene in the female flower ovules (Galpaz et al., 2013), we also 316

examined the color of transected female flowers at the day of anthesis. 317



13

At 20 DAA, ‘yofi’ mutant fruit exhibited pale yellow color (Fig. 5A) due to 318

substantial amounts of prolycopene and phytoene and very low level of β-carotene (Fig. 319

5C and Table S2). At the same fruit developing stage, the F2 progeny of the ‘low β’ X 320

‘yofi’ cross that carried a wild-type functional CRTISO allele exhibited light green color 321

similar to the ‘low β’ parental line (Fig. 5A; a,c). However, progeny that carried mutated 322

crtiso was either pale yellow in fruits that carried CmOr-His, or light green in fruits that 323

carried the Cmor-lowβ allele (Fig. 5A; b,d). Accordingly, at 20 DAA prolycopene levels in 324

crtiso/Cmor-lowβ fruit flesh were 2.46-fold lower than in crtiso/CmOr-His fruit (Fig. 5C 325

and Table S2). Phytoene levels were also reduced; fruit flesh of F2 progeny carrying 326

crtiso/CmOr-His contained similar amount of phytoene as the ‘yofi’ parental line, while 327

fruit flesh of progeny carrying crtiso/Cmor-lowβ contained only a trace amount of 328

phytoene (Fig. 5C and Table S2). Thus, the Cmor-lowβ mutant allele conferred lower 329

prolycopene and phytoene levels at 20 DAA under the metabolic inhibition caused by 330

CRTISO deficiency. This confirms that Cmor-lowβ had a reduced carotenoid biosynthetic 331

metabolic flux in developing fruits compared to its wild-type progenitor. The reduction 332

of carotenogenesis in the double mutant was also evident on the day of flower anthesis; 333

crtiso yellow ovule phenotype was completely masked in the background of Cmor-lowβ, 334

which exhibited green ovule phenotype (Fig. S9). 335

336

CmOr-lowβ Retained the Chloroplastic Carotenoids in Ripe crtiso Mutant Fruit 337

The mature fruit flesh of ‘yofi’ exhibited yellow color due to increased accumulation of 338

prolycopene (Fig. 5A) and contained high phytoene levels (Fig. 5D and Table S2). Mature 339

F2 fruits of the ‘low β’ X ‘yofi’ cross, which carried wild-type functional CRTISO, exhibited 340

the expected phenotypes, depending on the CmOr allele present in ‘low β’ or CEZ 341

progenitor lines (Fig. 5A; e,g and Fig. 2A). However, while the mature fruit flesh of 342

crtiso/CmOr-His was light yellow, similar to ‘yofi’ as expected (Fig. 5A; f), the mature 343

fruit of the double mutant crtiso/Cmor-lowβ was, surprisingly, neither green nor yellow. 344

Its hue was between yellow and orange (Fig. 5A; h). Accordingly, the carotenoid profile 345

of F2 progeny carrying homozygous crtiso and CmOr-His was, as expected, similar to 346



14

‘yofi’ with trace levels of β-carotene, high levels of prolycopene and phytoene, and no 347

detectable lutein (Fig. 5D and Table S2). The double mutant crtiso/Cmor-lowβ mature 348

fruit carotenoid profile was a mixture of the parental phenotypes, with lutein and β- 349

carotene levels similar to ‘low β’ alongside high prolycopene levels similar to ‘yofi’ (Fig. 350

5D and Table S2). This indicates that an active CmOr-His is necessary for chloroplast 351

disintegration, or chloroplast to chromoplast transition, but not for prolycopene 352

accumulation, which happens in a crtiso background, independently of the presence or 353

absence of CmOr. 354

355

The ‘Golden’ SNP does not Govern PSY Protein Level and Activity 356

The results described so far indicated that the low PSY protein levels in ‘low β’ reduced 357

carotenoid levels in fruits by lowering the metabolic flux. The similarity in fruit flesh 358

color between ‘low β’ and homozygous Cmor-Arg melon lines suggested a similar 359

decrease of PSY protein abundance in non-orange melon fruits as compared with orange 360

fruits. We therefore analyzed PSY protein levels in fruits of six melon accessions: three 361

orange-fruited accessions harboring CmOr-His and three Cmor-Arg non-orange fruit 362

flesh accessions (Table 1). We also included ‘low-β’ in the analysis. Fruits were sampled 363

at 30 DAA, a time point when carotenoid synthesis rate and PSY-1 transcript level peaks 364

(Fig. S8A and Fig. 4A). PSY levels in low-β were much lower than in the six analyzed 365

inbred lines in which the highest PSY protein level was measured in a CmOr-His orange- 366

fruited line (VEP) and the lowest was measured in a Cmor-Arg green-fruited line (TAD). 367

However, PSY protein levels were similar in the remaining four lines independent from 368

the CmOr natural allelic variation (Fig. 6A). This suggested a lack of association between 369

PSY protein levels and the natural allelic variation of CmOr in different melon accessions. 370

To determine the effect of the ‘golden’ SNP on PSY protein levels while 371

minimizing the possible effects of additional genes, we crossed a CmOr-His line (DUL) 372

with a Cmor-Arg line (TAD) and analyzed PSY protein levels in green-fleshed (genotype: 373

homozygous Cmor-Arg) and orange-fleshed (genotype: homozygous CmOr-His) bulks of 374

75 fruits equally representing 25 F3 families. The bulked green- or orange-fruited plants 375



15

inherited their respective fruit flesh color by the CmOr alleles, but all their other CmOr- 376

unlinked traits segregated arbitrarily (Chayut et al., 2015). In all analyzed fruit 377

developmental stages, the bulks of the green and the orange fruit flesh exhibited similar 378

levels of PSY protein (Fig. 6B), confirming that PSY level was indeed inherited 379

independently of CmOr natural allelic variation in developing fruit. 380

We treated fruit flesh discs of CmOr-His accessions (CEZ and DUL) and of Cmor- 381

Arg accessions (NA and NY) with NF and determined phytoene accumulation 24 h after 382

NF treatment by HPLC. Phytoene levels were not significantly different between CmOr- 383

His and Cmor-Arg lines (Fig. 6C). Thus, high and low β-carotene levels in fruit mesocarp 384

did not correlate with PSY protein abundance or PSY enzymatic activity. 385

386

Carotenoid Metabolic Flux in Developing Fruits is Independent of CmOr-His/Cmor-Arg 387

Natural Allelic Variation 388

PSY protein levels and activity across melon germplasm suggested that the CmOr natural 389

allelic variation does not govern carotenogenesis metabolic flux (Fig. 6). To confirm this 390

in planta we crossed ‘yofi’ (crtiso/crtiso; CmOr-His/CmOr-His) with the green-fleshed 391

accession ‘NY’ (CRTISO/CRTISO; Cmor-Arg/Cmor-Arg) and generated F2 segregants. We 392

selected again the four genotypes for CRTISO and CmOr (Fig. 5B) and analyzed 393

carotenoids in representative 20 DAA fruitlets and in mature fruit (Table S2). 394

At 20 DAA, ‘NY’ parent exhibited light green color (Fig. 5B) and contained lutein 395

that was not detectable in ‘yofi’ and eight-fold more β-carotene than ‘yofi’ (Table S2). 396

The F2 segregants of the ‘NY’ x ‘yofi’ had light green fruit flesh if they contained a 397

functional CRTISO allele and pale yellow in a homozygous mutated crtiso allele 398

background, regardless of the CmOr allele (Fig. 5B; a-d). Accordingly, prolycopene levels 399

in the homozygous recessive crtiso F2 segregants were similar, regardless of the CmOr 400

allele (Table S2). This confirmed that pathway flux at this early fruit developmental stage 401

was not affected by CmOr-His/Cmor-Arg natural allelic variation. 402

403



16

Crtiso is Epistatic to CmOr-His/Cmor-Arg Natural Allelic Variation in Regulating Ripe 404

Fruit Color and Carotenoid Composition 405

The mature fruit flesh of ‘NY’ had its characteristic distinctive intense-green color (Fig. 406

5B). Mature fruit flesh of ‘NY’ X ‘yofi’ F2 segregants carrying a functional CRTISO was 407

intense-green or orange depending on the CmOr allele (Fig. 5B; e and g). However, 408

similar to the results from 20 DAA fruits, mature fruit flesh color and carotenoid levels in 409

mature fruits of CRTISO-deficient crosses were similar and independent from the CmOr 410

allele (Fig. 5B; f,h and Table S2). Prolycopene levels in these fruit were similar, regardless 411

of the CmOr allele (Table S2). Thus, the fruit flesh color phenotype of the F2 segregants 412

derived from a cross between ‘NY’ and ‘yofi’ revealed an epistatic interaction between 413

CmOr and CRTISO genes. CRTISO regulated carotenoid levels and composition regardless 414

of CmOr natural allelic variation. In other words, these results indicated that in planta 415

CmOr natural allelic variation did not affect the carotenoid synthesis rate. Instead, it 416

affected β-carotene accumulation by inhibiting metabolism downstream of β-carotene. 417

418

DISCUSSION 419

420

The natural occurrence of a large copia-like retrotransposon insertion in the cauliflower 421

BoOr gene revealed the ability of the highly conserved Orange (Or) gene to induce 422

carotenoid accumulation in non-colored plant tissues (Lu et al., 2006). However, the 423

mechanism by which the cauliflower mutated Or gene operates remains elusive. The 424

pleiotropic effects of BoOr and the multiple alternatively sliced transcripts of the 425

naturally occurring BoOr active allele make it hard to resolve the Or mechanism of 426

action. We recently reported that β-carotene accumulation in melon fruit flesh is 427

governed by a single SNP in CmOr, providing a precise biological tool to study OR 428

function (Tzuri et al., 2015) and to utilize it in biotechnology (Yuan et al., 2015a). The 429

identification of the novel ‘low β’ mutant provides an invaluable tool for further 430

deciphering the Or gene mechanism of action in the regulation of carotenoid 431

accumulation. Studies reported here show that carotenoid biosynthesis is fully active 432



17

and functional in non-orange melon fruit and the specific inhibition of carotenoid 433

metabolism leads to carotenoid accumulation and chromoplast formation. In addition, 434

we show that CRTISO, whose deficiency arrests carotenoid metabolism at prolycopene, 435

is epistatic to CmOr. Thus, a CRTISO-deficient background was used to show that 436

carotenoids are synthesized in melon fruit regardless of the ‘golden’ SNP allelic variation 437

(Fig. 7). 438

439

The Roles of OR 440

Recent studies of OR proteins of melon (Chayut et al., 2015; Tzuri et al., 2015), 441

Arabidopsis (Yuan et al., 2015a; Zhou et al., 2015), sweet potato (Ipomoea batatas) 442

(Park et al., 2015) and previous works with cauliflower (Li et al., 2006; Li et al., 2012) and 443

potato (Lopez et al., 2008; Li et al., 2012) suggest two complementary roles of OR in 444

carotenoid accumulation: posttranscriptional regulation of PSY protein and biogenesis 445

of chromoplasts. Stabilization of PSY protein in controlling carotenoid pathway flux has 446

been shown in Arabidopsis (Zhou et al., 2015) and transgenic potato (Lopez et al., 2008). 447

Our analyses of the nonsense mutation of Cmor-lowβ reaffirm that OR is required to 448

maintain PSY level, and suggest that OR is involved in chloroplast-to-chromoplast 449

transition during fruit development. Moreover, our results provide solid evidence that 450

PSY levels are not the cause for OR-mediated high carotenoid accumulation in melon 451

fruit, therefore reopening the question on the exact mechanism by which Or operates. 452

Results of our experiments with chemical (NF and CPTA) and genetic (yofi, a CRTISO 453

mutant) metabolic flux inhibitors indicate that OR facilitates β-carotene accumulation by 454

inhibiting the carotenoid metabolism downstream of β-carotene (hydroxylation or 455

degradation). This is also evidenced by the presence of only traces of lutein while other 456

xanthophylls are not detected in orange melon fruit (Chayut et al., 2015, Table S2). We 457

suggest that in melon and probably in other fruit, chromoplast biogenesis is triggered in 458

a metabolite dependent mechanism, similarly to what have been suggested in 459

transgenic tomatoes overexpressing PSY (Fraser et al., 2007). 460

461



18

Facilitation of Active PSY Enzyme 462

Immunoblotting analysis showed that the nonsense mutation of Cmor-lowβ dramatically 463

reduced fruit mesocarp PSY protein level but not Psy gene expression at 20 and 30 DAA 464

(Fig. 4A,B,C, and Fig. S8A). The Cmor-lowβ allele encoded a truncated CmOR protein, 465

and was also associated with significantly suppressed Cmor-lowβ transcript levels (Fig. 466

3C), probably by a nonsense-mediated mRNA decay mechanism (Kerényi et al., 2008). 467

The truncated CmOR-lowβ protein was unable to dimerize (Fig. 4E), which is expected to 468

negatively affect its stability (Zhou et al., 2015). The inability to dimerize and the 469

significantly reduced Cmor-lowβ mRNA levels lead to the absence of CmOR protein in 470

‘low β’ melon fruits (Fig. 3D and Fig. S4). 471

As OR was shown to be a major posttranslational regulator of PSY, we concluded 472

that the absence of CmOR in ‘low β’ melons results in low levels of PSY protein, similar 473

to OR-deficient Arabidopsis lines (Zhou et al., 2015). As PSY catalyzes the rate-limiting 474

step in carotenoid biosynthesis (Arango et al., 2014), the reduction of PSY protein could 475

account for the reduced carotenoid accumulation in ‘low β’ fruit. This was confirmed by 476

determination of phytoene accumulation in detached developing melon fruit tissues 477

upon inhibition of PDS activity by NF, an indicative assay for PSY activity (Beisel et al., 478

2011; Lätari et al., 2015). The ‘low β’ mutant accumulated significantly less phytoene 479

than CEZ (Fig. 4D,E), confirming that OR mediated PSY protein activity. The lower PSY 480

activity in ‘low β’ fruit reduced the metabolic flux toward β-carotene synthesis, 481

indicating that CmOr promoted the carotenoid metabolic flux toward β-carotene 482

synthesis in wild-type melon fruits. 483

However, the ‘golden’ SNP, which governs fruit flesh β-carotene levels across a 484

wide spectrum of melon germplasm (Tzuri et al., 2015), was not associated with a 485

reduction in PSY protein level. Green and orange 30 DAA melon fruits showed similar 486

levels of PSY protein independently of the ‘golden’ SNP genotype and accumulated 487

similar amount of phytoene 24 h after NF inhibition (Fig. 6A,B,C). PSY localization was 488

shown to be a major mode of regulation of PSY activity (Shumskaya et al., 2012); it has 489

been previously shown that the ‘golden’ SNP did not alter PSY localization (Yuan et al., 490



19

2015a). Our study confirms that the 'golden' SNP-induced carotenoid accumulation acts 491

independently of PSY levels and activity. 492

In malfunctioning crtiso genetic background, CmOr-lowβ lowered pro-lycopene 493

levels in female flowers (Fig S9) and in developing fruit but not in the mature fruit (Table 494

S2 and Fig. 5D). The latter phenomenon is not surprizing since PSY protein level, the 495

carotenogenic flux determinant, were not significantly affected in ‘low β’ mature fruit 496

although they were severely lowered at 20 and 30 DAA (Fig. 5C). Increased expression of 497

PSY at the mature fruit stage has also been observed by Galpaz et al. (2013) when they 498

compared ‘yofi’ and ‘CEZ’ at the mature stage. CRTISO has been suggested as a 499

regulatory node in the carotenoid pathway (Cazzonelli and Pogson, 2010), however, the 500

exact mechanism by which it operates is still unclear. The mature ‘low-β’ fruit 501

accumulated orange β-carotene in its inner part close to the seed cavity (Fig 2A), 502

showing the incomplete nature of the ‘low β’ phenotype. While β-carotene accumulated 503

at trace amounts in the mature ‘low-β’ fruit (Fig. 2B), prolycopene accumulated 504

significantly in mature fruit regardless of OR (Fig. 5D). This can probably be best 505

explained by the efficient inhibition of the carotenoid biosynthesis metabolic flux by 506

crtiso in chromoplast, as opposed to chloroplast in which photoisomerization may occur 507

(Isaacson et al., 2002). 508

509

Regulation of Plastid Fate 510

In orange cauliflower, it was suggested that the BoOr mutant allele triggers the 511

biogenesis of chromoplasts, the specialized plastids which synthesize and store 512

carotenoids (Lu et al., 2006; Li and Yuan, 2013). Chromoplasts were also formed in 513

potato tubers overexpressing BoOr (Lopez et al., 2008) and in Arabidopsis 514

overexpressing engineered AtOr-His (Yuan et al., 2015a). We show here that ‘low β’ 515

carries a loss of function allele of CmOr, resulting in the absence of orange 516

chromoplasts, which were observed in fruit mesocarp cells of CEZ, the isogenic 517

progenitor of ‘low β’ (Fig. 3D-G and Fig. S2). This supports the suggested role of OR as a 518

molecular switch of chromoplast biogenesis. 519



20

While cauliflower curd, potato tubers and Arabidopsis calli grown in dark are 520

non-green tissues, containing non-colored proplastids and amyloplasts, melon fruit 521

mesocarp contains chloroplasts during the first stages of fruit development, as 522

evidenced by the presence of chlorophylls in young fruit (Chayut et al., 2015). Here we 523

show that both CEZ and ‘low β’ similarly accumulated chlorophylls until 30 DAA (Fig. 2C). 524

However, while CEZ fruits degraded all fruit flesh chlorophylls from 30 DAA until 525

maturation, ‘low β’ mature fruit maintained high chlorophyll levels. Accordingly, our 526

microscopy study of mature fruit mesocarp cells revealed chloroplasts in ‘low β’ but not 527

in CEZ and chromoplasts in CEZ but not in ‘low β’ (Fig. 2D-G, Fig. S2). Our biochemical 528

analysis identified lutein, the major chloroplastic carotenoid (Jahns and Holzwarth, 529

2012), present in ‘low β’ but absent in CEZ (Fig. S1, Table S2). This observation further 530

supports that Cmor-lowβ affected chloroplast occurrence in mature fruit mesocarp. 531

These findings suggest that Cmor-lowβ nonsense mutation inhibited chromoplast 532

formation and chloroplast disintegration from 30 DAA until fruit ripening. While our 533

results cannot exclude the possibility that chromoplast formation and chloroplast 534

disintegration are independent, they strongly suggest that melon plastids follow 535

chloroplast-to-chromoplast transition under the control of CmOr. Such a transition has 536

been well characterized in pepper and in tomato fruit (Egea et al., 2010), but was never 537

previously associated with the Or gene. 538

Furthermore, Cmor-lowβ in a CRTISO-deficient background (double mutant 539

segregant of a 'yofi' x ‘lowβ’ cross) maintained its chloroplast-specific carotenoid pattern 540

(lutein and low levels of β-carotene) in the mature fruit accompanied with a high 541

accumulation of prolycopene, a chromoplast-specific carotenoid (Fig. 5B and Table S2). 542

Moreover, both Cmor-lowβ and Cmor-Arg increased chlorophyll levels in mature fruits 543

compared to CmOr-His (Fig. 2C; Chayut et al., 2015). Therefore, the mature double 544

mutant phenotype suggests that the CmOr-His allele is needed for chloroplast 545

disintegration in the late fruit ripening stage. However, the induction of high carotenoid 546

accumulation in fruit by OR can be replaced by carotenogenic flux inhibition resulting 547

from a mutated CRTISO. The accumulation of carotenoids in a 'yofi'/‘low β’ double 548



21

mutant fruit despite low carotenoid metabolism (Fig. 5B and Table S2) and the low PSY 549

protein levels at early fruit development stages (Fig. 4C) are most probably caused by 550

the efficient inhibition of carotenoids metabolism by ‘yofi’. The presence of carotenoids 551

downstream to prolycopene in the absence of a functional CRTISO in these segregants is 552

probably due to the extended presence of photosynthetic organelles where light 553

induced photoisomerization of cis-configured carotenes could occur (Isaacson et al., 554

2002). 555

556

Inhibition of β-carotene Turnover 557

Does the biogenesis of chromoplasts trigger carotenoid buildup or does carotenoid 558

buildup trigger the plastid rearrangement leading to chromoplasts? Plastid development 559

in white- and red-fleshed grapefruits indicates differentiation of distinctive plastids 560

could be correlated with a characteristic carotenoid content (Lado et al., 2015). While 561

the red-fruited cultivar (‘Star Ruby’) accumulates high carotenoid levels in the ripe fruit 562

(predominantly phytoene, phytofluene and lycopene), the white-fruited cultivar 563

(‘Marsh’) accumulates very low carotenoid levels (phytoene and violaxanthin). A 564

comparative transcriptional study of carotenoid biosynthesis genes suggests that low 565

expression of β-LCY causes the high lycopene accumulation in the red-fruited cultivar 566

(Alquezar et al., 2013). Microscopic analysis indicates that the white grapefruit pulp 567

exhibited fewer chromoplasts per cell and carotenoids crystalloid structures were 568

absent, while in the red grapefruit pulp chromoplasts were more abundant and 569

frequently contained crystals (Lado et al., 2015). In this example, the differences in 570

carotenoid composition and accumulation were reflected by the development of a 571

specific chromoplast types. It therefore seems that in grapefruit, lycopene 572

accumulation, caused by a specific inhibition of carotenoid metabolism flux, resulted 573

from low β-LCY transcription, triggers this characteristic chromoplast biogenesis. 574

In early developmental stage of tomato fruit overexpressing PSY-1, alteration of 575

plastid type was found alongside with higher carotenoid levels and different carotenoid 576

composition. The authors suggested a ‘metabolite-induced chloroplast-to-chromoplast 577



22

transition’ (Fraser et al., 2007). The induced chromoplasts lacked the distinctive 578

crystalline lycopene structures found in ripe tomato fruits most probably as a result of 579

high β-carotene which was more abundant than lycopene in the studied fruitlets of the 580

mature green stage. In non-green tissues (roots and callus) of Arabidopsis, increase of 581

carotenogenic flux by overexpression of PSY caused carotenoid accumulation in 582

crystalline-type chromoplasts (Maass et al., 2009). Thus chromoplast could be formed 583

from high carotenoid abundance, which can result from flux elevation or from the 584

interruption within an existing carotenoid metabolism flux. 585

It was previously shown that the natural allelic variation of CmOr does not 586

change the expression of carotenogenesis genes in melon fruit (Chayut et al., 2015). In 587

the present work, we show that fruit PSY protein levels were similarly unchanged by the 588

‘golden’ SNP. For example, we found high PSY levels in ‘NY’, a green-fruited melon 589

containing the Cmor-Arg allele, as well as in CEZ, an orange-fruited CmOr-His variety 590

(Fig. 6A). In a CRTISO-deficient background, both naturally occurring CmOr alleles 591

allowed high prolycopene levels, which are thus independent of CmOr natural allelic 592

variation (Fig. 6C and Table S2). However, if pathway flux is allowed to proceed beyond 593

prolycopene (as in functional CRTISO background), β-carotene accumulates only if 594

CmOR-His is present. This indicates that CmOR-His did not affect carotenoid pathway 595

flux upstream of β-carotene, but had a major impact on the stability and further 596

metabolism of β-carotene, correlated with the formation of chromoplasts. Thus, the 597

surprising epistasis of CRTISO over Or arises because in the carotenoid metabolic 598

pathway, the production of prolycopene precedes the production of β-carotene (Fig. 1 599

and Fig. 7). 600

Our results suggest that naturally regulated expression of CmOR-His suppresses 601

downstream metabolism of β-carotene in melon fruits, and show that in mature CmOR- 602

His melon fruit, only traces of lutein could be found while other xanthophylls are not 603

detected (Table S2 and Chayut et al., 2015). However, previous studies have shown that 604

overexpression of CmOr-His or AtOr-His induce high accumulation of β-carotene 605

together with significant amount of lutein, in non-green tissue (calli) of Arabidopsis 606



23

(Tzuri et al., 2015; Yuan et al., 2015). Lutein was also amassed in potato tubers 607

overexpressing BoOr (Lu et al., 2006) and in sweet potato calli overexpressing 608

engineered IbOr (Kim et al., 2013). These results suggest that inhibition of carotenooid 609

metabolism flux by OR could also affect lutein fate and is not limited to β-carotene. The 610

‘golden’ SNP specific stabilization of β-carotene and possibly lutein depending on plant 611

species may imply for its yet to be elucidated molecular mechanism. 612

613

Conclusion 614

Global food security demands pro-vitamin A bio-fortified staple crops (Graham et al., 615

2001; Fraser and Bramley, 2004). The Orange gene, a molecular switch that induces 616

carotenoid accumulation, is a promising tool for this purpose (Lu et al., 2006). The 617

discovery of the ‘golden’ SNP in the melon CmOr gene (Tzuri et al., 2015) and the 618

confirmation of this SNP potency (Yuan et al., 2015a) precisely defines the site for DNA 619

editing as a possible new path toward β-carotene biofortification of crops via a non- 620

transgenic approach. The current study sheds new light on the mechanism of action of 621

the Orange gene in melon fruit, with its possible applications in other crop systems. 622

We showed that the induced nonsense mutation in CmOr in 'low β' melons 623

reduced the abundance of functional CmOR protein and, in consequence, of PSY 624

protein, which dramatically affected both carotenoid content and plastid fate. By 625

contrast, the natural allelic variations of CmOr in melon fruits, CmOr-His and Cmor-Arg, 626

similarly enhanced carotenoid biosynthesis by posttranscriptionally regulating PSY 627

protein amounts. However, only the ‘golden’ SNP allele CmOR-His prevents further 628

metabolism of β-carotene, resulting in its accumulation in chromoplasts. This suggests 629

metabolic flux analysis as a necessary criterion when selecting potential superior 630

germplasm for DNA editing to introduce the Or ‘golden’ SNP into other crops. 631



24

MATERIALS and METHODS 632

Plant Material 633

CEZ is a ‘Charentais’ type melon (Cucumis melo L. subsp. melo var. cantalupensis 634

Naudin). The ‘low β’ and ‘yofi’ (CRTISO) mutants are EMS mutated CEZ isogenic lines 635

produced as described (Tadmor et al., 2007). All C. melo varieties used in this work are 636

listed and described in Table 1. 637

638

Table 1 639

Accessions full names and genetic backgrounds 640

Variety full name

Variety short name

Marketing type

Taxonomic group*

CmOr Allele Mature fruit flesh

color CEZ CEZ Charentais Cantalupensis CmOr-His Orange

low β-carotene

low β Charentais Cantalupensis CmOr-low β Green

Dulce DUL Cantaloupe Reticulatus CmOr-His Orange

Tam-Dew TAD Honey Dew Inodorus Cmor-Arg Green

Noy Amid NA Yellow Canary Inodorus Cmor-Arg Green-

white

Noy Yizre'el NY Ha‘Ogen Cantalupensis Cmor-Arg Green

Vedrantais VEP Charentais Cantalupensis CmOr-His Orange

Indian Best INB - Chandalc CmOr-His Light

orange

Ein Dor ED Ananas Reticulatus Cmor-Arg Cream

white

Piel De Sapo

PDS Piel de Sapo Inodorus Cmor-Arg Green-

white

Yellow Orange Flesh I

yofi Charentais Cantalupensis CmOr-His Yellow

641

*After (Pitrat, 2000). 642



25

We also used 50 F3 families selected from a segregarting population originated 643

from a cross between DUL and TAD. Each family resulted from the self-pollination of a 644

single F2 plant. We used CAPS molecular marker and fruit color visualization of F3 645

families to select 25 orange fruited families that are homozygouse CmOr-His and 25 646

green fruited families that are homozygous CmOr-Arg as described (Chayut et al., 2015). 647

648

Double Mutant Production 649

To generate double mutant plants, we crossed the crtiso mutant ‘yofi’ (Galpaz et al., 650

2013) with ‘low β’ and with NY. Light yellow instead of green cotyledon is the first 651

visualized phenotypic marker for homozygous crtiso (‘yofi’) mutation (Galpaz et al., 652

2013). A total of 600 F2 seeds of each cross were germinated in light and temperature 653

controlled growth room (12 hours artificial light, 27°C / 12 hours darkness, 20°C). After 654

emergence, ‘yofi’ plants were selected by their yellow cotyledon color. A total of 148 655

and 157 plantlets resembled 'yofi' in the cross with ‘low β’ and with NY, respectively. 656

After 5-8 days, all seedlings looked alike due to photo-isomerization of prolycopene and 657

grew alike under the experiment condition. For both genotypes (crtiso/crtiso and 658

CRTISO/-), we genotyped 100 seedlings for CmOr allele using cleaved amplified 659

polymorphic sequence (CAPS) of CmOr gene. In the analysis of segregants derived from 660

the cross of ‘yofi’ with ‘NY’, we defined the natural allelic variation genotype with the 661

previously described CAPS marker using the forward primer GTATCATAGAGGGACCGG 662

and the reverse primer CCCAATGCAGCTAAGTCAA (Tzuri et al., 2015). The PCR resulted 663

amplicon was subjected to enzymatic digestion with HinfI which cuts only the dominant 664

allele. For the genotyping of segregants derived from the cross of ‘yofi’ with ‘low β’, we 665

used the forward primer ATGTAGGTTCGTCGGCTGAG and the reverse primer 666

ACCTTAGCTGCATTGGGAGA, which amplified a novel polymorphic fragment. The 667

amplicon was subjected to enzymatic digestion with AcuI which cleaves the wild-type 668

allele and does not cleave the ‘low β’ allele. For each cross, 8-10 plants of each of the 669

four possible genotypes were grown in a semi-controlled greenhouse. We manually self- 670

pollinated two female flowers on each trellised plant and marked the anthesis date. 671



26

Three fruits (the first successfully pollinated) from three plants of each genotype, at 20 672

DAA and upon fruit maturation, were visually phenotyped, sampled and stored at -80°C 673

until use. For each developmental stage, the three fruit were sampled on the same day. 674

Non-pollinated female flowers, at the day of anthesis, were picked from all plants for 675

ovule color phenotyping. 676

677

Carotenoid and Chlorophyll Analyses 678

Hexane:acetone:ethanol (2:1:1, v/v/v) mixture was used to extract carotenoid pigments 679

as described (Tadmor et al., 2005). Separation of carotenoids was carried out on a C18 680

Nova-Pak (Waters, Milford, MA, USA) column (250 x 4.6 mm i.d.; 60A ; 4 mm), and a 681

Nova-Pak Sentry Guard cartridge (Waters, Milford, MA, USA) using a Waters 2695 HPLC 682

apparatus equipped with a Waters 996 PDA detector (Milford, MA, USA) as described 683

(Tadmor et al., 2000). Carotenoids were identified by their characteristic absorption 684

spectra, distinctive retention time and comparison with authentic standards 685

(ExtraSynthase, France). Quantification of specific carotenoids was performed using 686

Millennium chromatography software (Waters, Milford, MA) that integrates the peak 687

areas of the HPLC results and calculates concentration using authentic standard curves. 688

To distinguish undetected from unquantifiable levels, we defined as ‘trace’ amount any 689

carotenoids with integrated peak area lower than 20,000 (AU*min). 690

Total chlorophylls were quantified by recording the absorbance at 661.6 nm and 691

at 644.8 nm of 10x diluted acetone extracts as described (Lichtenthaler, H. K. 1987). The 692

following equation was used to quantify chlorophyll: Chla+Chlb (µg/mL acetone) = 693

(11.24×A661.6– 2.04×A644.8)+(20.13×A644.8 – 4.19×A661.6). 694

695

Microscopy 696

Protoplasts were isolated by gentle shaking of 1 gram mature fruit mesocarp in 1.5 ml 697

solution of 18% (w/v) mannitol, 1% w/v cellulose, 0.3% w/v macerozyme and 0.05% w/v 698

pectolyase at 28°C overnight (enzymes manufactured by Duchefa Biochemie, The 699

Netherland). Protoplasts and manually sliced mature fruit mesocarp tissues were 700



27

observed under a phase contrast and direct interference contrast compound 701

microscope (BX61, Olympus) equipped with high-resolution digital camera (DP73, 702

Olympus) and image analysis software (SOFT IMAGING SYSTEM, Olympus). 703

704

RNA-Seq Transcriptome Analysis 705

CEZ and ‘low β’ plants were field grown in summer 2012 at Newe Ya’ar Research Center 706

plot. Female flowers were marked at the day of anthesis and three typical fruits were 707

sampled at each of 10, 20, and 30 days after anthesis (DAA) and upon ripening (40-45 708

days but varies between fruits). Each fruit served as a biological replicate and was picked 709

from a different plant. All fruits were picked in the morning to diminish circadian effects. 710

Fruit flesh representative portion was immediately frozen in liquid nitrogen and kept at - 711

80°C until extraction. Total RNA from 24 developing fruit mesocarp tissue samples (2 712

genotypes x 4 developmental stages x 3 biological replicates) was extracted following 713

the protocol described (Portnoy et al., 2008) and used to construct the strand-specific 714

RNA-Seq library as described (Zhong et al., 2011). The barcoded libraries were pooled 715

and sequenced on a single lane of Illumina HiSeq 2000 sequencing system at the Cornell 716

University core facility. 717

718

RNA-Seq Data Analysis 719

RNA-Seq reads were first aligned to the ribosomal RNA database (Zhong et al., 2011) 720

using Bowtie (Langmead et al., 2009) and those that were aligned were discarded. The 721

resulting reads were aligned to the melon genome (Garcia-Mas et al., 2012) using 722

TopHat (Trapnell et al., 2009). Following alignments, raw counts for each melon gene 723

were derived and normalized to reads per kilobase of exon model per million mapped 724

reads (RPKM). The raw counts of melon genes were fed to edgeR (Robinson et al., 2009) 725

to identify differentially expressed genes (DEG) between CEZ and the ‘low β’ mutant at 726

each of the four developmental stages. 727

728

Protein Extraction 729



28

Proteins of CEZ and 'low β' fruit were extracted from the same fruit tissue samples that 730

were used for RNA extraction (field grown plants on summer 2012). Three samples of 20 731

and 30 DAA and of mature fruit developmental stage were bulked. Proteins from 30 732

DAA fruit of CEZ and 'low β' and additional inbred lines were extracted from six bulked 733

fruit grown on six different trellised plants in semi-controlled greenhouse conditions on 734

the summer of 2013. Proteins from developing bulked F3 families were extracted from 735

75 pooled developing or mature fruits, grown on 75 different plants, three from each 736

family originating from a cross between ‘DUL’ and ‘TAD’ inbred lines. All proteins were 737

extracted with phenol according to the protocol as described (Maass et al., 2009). 738

739

Western Blot Analysis 740

Protein concentration was determined with the Bio-Rad protein assay. Proteins were 741

resolved electrophoretically in a 12% SDS-polyacrylamide gel, and then blotted to either 742

nitrocellulose or PVDF membranes (pore size 0.45 µm, manufactured by Carl Roth, 743

Karlsruhe, Germany). Ponceau S staining was used to show equal loading and transfer 744

quality. Membranes were blocked by soaking in 5% milk powder in a Tris-Buffered 745

Saline, 0.1% Tween-20 (TBS-T) for 1 h at 20-25°C, and then incubated with antibodies 746

against BoOr (Lu et al., 2006) or PSY (Maass et al., 2009) for 1–2 h at room temperature. 747

After washing three times for 10 min each with TBS–T, the blot was incubated with the 748

horseradish peroxidase -conjugated antibody solution for 1 h at room temperature. The 749

signal was detected with the Enhanced chemiluminescence (GE Healthcare). Blots were 750

stripped (Sennepin et al., 2009) and re-probed with anti-actin antibodies (Sigma). 751

752

Protein Interaction Analysis 753

The split ubiquitin system was used (Obrdlik et al., 2004). OR dimerization and OR/PSY 754

interaction were analyzed as described previously (Zhou et al., 2015). Basically, the 755

cDNA sequences were cloned to make either Nub or Cub fusions. Overnight cultures 756

from yeast strains that co-expressed two fused proteins were spotted on non-selective 757

and selective medium (-LWAH), supplemented with methionine in a series of 1:10 758



29

dilutions, and grown at 29°C. β-Galactosidase activity was determined by assaying 759

enzyme velocity using the substrate oNPG (ortho-nitrophenyl-β-D-galactopyranoside) as 760

described (Zhou et al., 2015). Amounts of ortho-nitrophenol (oNP) were determined 761

photometrically at 420 nm using the molar extinction coefficient of oNP = 3300 g l-1 Mol- 762 1. β-galactosidase activity was calculated as nmol oNP min-1 OD600-1. All β-galactosidase 763

assays were performed in triplicate. 764

765

In Vivo Measurement of Carotenogenic Metabolic Flux. 766

Trellised plants of CEZ and ‘low β’ were grown in a semi-controlled greenhouse 767

condition. Each plant was self-pollinated once and the flower was marked at the 768

pollination day. Bearing a single fruit per plant eliminated competition between fruits 769

within plants and lowered the variance in fruit maturation pace between plants. 770

Fruitlets were collected at 20 and 30 DAA, each served as independent biological repeat. 771

Discs of 10 mm in diameter and 5 mm in height were cut with a cork borer from fruitlets 772

mesocarp. Each disc was treated with 12 µl of 1 mM norflurazon (NF) or of 0.1 mM 2-(4- 773

chlorophenylthio) triethylamine (CPTA) aqueous solutions. Controls were treated with 774

12 µl of water. One control sample was frozen immediately after water treatment. Six 775

discs from each treatment were sampled at 12 hours (h) and at 24 h. Water treated 776

controls were sampled as well. Carotenoids were quantified by HPLC (Tadmor et al., 777

2005). 778

779

Acknowledgements: 780

The authors acknowledge Prof. Joseph Hirschberg of the Department of Genetics at The 781

Hebrew University of Jerusalem for kindly supplying CPTA inhibitor and advising on the 782

inhibition experiments and on carotenoid quantification; Prof. Alexander Vainstein of 783

the Faculty of Agriculture, Food and Environment at The Hebrew University of Jerusalem 784

for kindly providing the Norflurazon inhibitor; and Shira Gal from the Newe Ya’ar 785

Research Center for microscopy assistance. We thank Harry Paris for critically editing 786



30

the manuscript. The authors have no conflict of interest to declare. Publication No. 787

xxx/2016 of the Agricultural Research Organization, Bet Dagan, Israel. 788

789

-. Capital: Schematic biosynthetic pathway of carotenoids and apocarotenoidsFigure 1 790 letter abbreviations are enzymes. Carotenoid metabolites are in lower-case bold. 791 Dashed arrows represent series of enzymatic reactions. Bar-headed lines represent 792 enzyme inhibitors (norflurazon, NF; 2-(4-chlorophenylthio) triethylamine hydrochloride, 793 CPTA) or mutant name (yofi). DXS, 1-deoxy-D-xylulose-5-phosphate synthase; DXR, 1- 794 deoxy-D-xylulose-5-phosphate reductoisomerase; GGPPS, geranylgeranyl 795 pyrophosphate synthase; PSY, phytoene synthase; PDS, phytoene desaturase; Z-ISO, β 796 carotene isomerase; ZDS, β carotene desaturase; CRTISO, carotenoid isomerase; β-LCY, 797 lycopene beta cyclase; β-LCY, lycopene epsilon cyclase; β-OHase, β-carotene 798 hydroxylase; CCDs, carotenoid cleavage dioxygenase; VDE, violaxanthin de-epoxidase; 799 ZEP, zeaxanthin epoxidase; NCED, 9-cis-epoxycarotenoid dioxygenase. ABA, abscisic 800

acid. 801

β’ and -Transections of ‘low A.β’ mutant and CEZ fruits. -: Phenotype of the ‘lowFigure 2 802 CEZ fruits at four developmental stages, 10, 20 and 30 days after anthesis (DAA) and 803 mature stage. White bar = 5cm; B. Fruit flesh β-carotene levels in the four fruit 804 developmental stages shown in A; data are mean +/- SD of three biological replicates 805 (different fruits from different plants). FW, fresh weight. C. Total fruit chlorophyll a and 806 b levels during fruit development; D. and E. Bright visible light microscopy of mature 807 fruit mesocarp cells of CEZ (D) and ‘low β’ (E). Black bars = 100 μm. F. and G. Bright field 808 light microscopy pictures of mature ‘CEZ’ protoplast (F) and mature ‘low β’ protoplast 809

(G). Black bars = 10 μm. 810

’ and CEZ β. Complementation test of ‘low A: Comparisons of ‘low β’ with CEZ: Figure 3 811 with a panel of Cmor-Arg homozygous lines: NY, NA, ED, TAD, PDS. CmOr-His 812 homozygous lines, INB, DUL and CEZ, served as controls. Pictures of the female parent 813 fruits are in the top row. Male parent was either ‘low β’ or CEZ (fruits shown on the 814 right). F1 hybrid fruits of the crosses with ‘low β’ (a-h) and with CEZ (i-p) are shown. a-e 815 non-orange fruits in hybrids indicated that ‘low β’ is allelic to CmOr. B. Aligned partial 816 protein sequences of CmOR-His (CEZ) and CmOR-Arg (TAD) and the ‘low β’ OR protein 817 with its premature ‘STOP’ codon at position 163. The ‘golden' SNP (His to Arg) at 818 position 108 is highlighted. C. CmOr mRNA digital expression in CEZ and ‘low β’ 819 developing fruit mesocarp. Columns represent average RPKM +/- S.E of three 820 independent biological repeats. D. CmOR protein levels in CEZ and ‘low β’ mutant at 20 821 and 30 DAA and in mature melon fruit. CmOR protein was detected by immunoblotting 822 analysis, a poinceau-stained membrane is shown below. E. Yeast split ubiquitin analysis. 823

‘CEZ’ n levels and enzymatic activity analyses in mRNA expression, protei PSY: Figure 4 824 and ‘low-β’ fruits. A and B. Digital expression of PSY-1 (A) and PSY-2 (B) in ‘CEZ’ and 825



31

‘low-β’ developing fruit. Average RPKM +/- SE of three biological repeats is shown. C. A 826 Western blot showing PSY protein levels at 20 and 30 DAA and in the mature fruit of 827 ‘CEZ’ and ‘low β ’; proteins were extracted from pools of three fruits. D Representative 828 HPLC chromatograms at 290 nm. Carotenoids were extracted from 30 DAA fruit flesh 829 discs of CEZ (a, b) and low- β (c, d) treated with norflurazon (NF; a, c) or with water (b, d) 830 for 12 hours in the dark. E. Phytoene accumulated in 30 DAA fruit discs upon NF- 831 treatment. Phytoene is expressed in µg g-1 fresh weight of treated fruit flesh at 12 and 832

24 hours of treatment. Values are mean +/- SD of three biological repeats. 833

Figure 5: Fruit flesh color and carotenoid levels of various melon genotypes. Transected 834 fruit at 20 DAA (left) and mature (right) are shown. A. Top: transected fruits of ‘low ’ 835 and ‘yofi’ parental lines. Bottom: panels of the four possible allelic combinations 836 transected fruit. CmOr genotypes (CmOr-His, Cmor-lowβ) are indicated on the left and 837 CRTISO genotypes (WT and nonsense mutated crtiso) are indicated on the top of each 838 panel. B. TOP: transected fruits of yofi and ‘NY’ parental lines. Bottom: panels of 839 transected fruit of the four possible allelic combinations. C-D. Average amounts (μg/g 840 FW) of phytoene, lutein, prolycopene and β-carotene accumulated at 20 DAA (C) and in 841 mature fruit (D) of F2 defined segregants derived from yofi X low- β (CmOr-His and Cmor- 842 lowβ) and from yofi X NY (Cmor-Arg) crosses. Exact numbers and standard errors are in 843 Table S2. 844

Western blot showing PSY A. : PSY protein and phytoene levels in melon lines. Figure 6 845 protein levels at 30 DAA in six melon inbred lines and low-β and with actin signals used 846 as loading control; fruit flesh phenotype at 30 DAA is shown below. Each sample is a 847 pool of 6 fruits from 6 different plants B. PSY protein levels at 5, 10, 20 and 30 DAA of 848 green flesh and orange flesh bulked segregants originating from a cross between DUL 849 and TAD and sharing the same fruit flesh color. Each sample is a bulk of 75 fruits 850 originated from 25 different F3 families. C. Phytoene accumulated in 30 DAA fruit discs 851 upon norflurazon (NF) -treatment. Phytoene is expressed in µg g-1 fresh weight of 852 treated fruit flesh at 24 hours of treatment. Values are mean +/- SD of three biological 853 repeats. Although PSY protein and phytoene levels upon NF-treatment are quite similar, 854

β-carotene content in CmOR-His is much higher than in CmOR-Arg melons. 855

Figure 7: A model of carotenogenesis under the effect of three alleles of CmOr and of a 856 dysfunctional CRTISO. In presence of both OR-His and OR-Arg, carotenoid pathway flux 857 occurs at high levels (green arrows), but only OR-His prevents further metabolism 858 downstream of β-carotene (red arrow) resulting in strongly increased β-carotene 859 accumulation in OR-His melon fruits but not in OR-Arg. In contrast, low PSY protein 860 levels, caused by a truncated OR-lowb, results in a weak pathway flux (red arrow) and 861 hence low carotenoid levels in OR-lowb fruit. Dysfunctional CRTISO in yofi melons 862 results in metabolic arrest downstream to prolycopene (red arrow). Accordingly, 863 prolycopene is accumulated in yofi genotypes regardless of the ‘golden SNP’ which 864 operates downstream in the pathway. 865



32

866

867



33

Supplemental Data 868

The raw sequencing data has been deposited in NBCI SRA under the accession number 869

SRP071059. 870

The following supplemental materials are available: 871

Supplemental Figures 872

Figure S1 – HPLC chromatograms. 873

Figure S2 – Protoplasts microscopy. 874

Figure S3 – CmOr coding sequence of CEZ and ‘low β’. 875

Figure S4 – Immunoblotting of CmOR using high density (15%) fractionating gel. 876

Figure S5 - Yeast split ubiquitin analysis. 877

Figure S6 – Different digital gene expression (RPKM) of metabolic genes. 878

Figure S7 - CmOr-like digital expression. 879

Figure S8 - In planta metabolic flux measurements. 880

Figure S9 - Transacted female flowers of ‘low β x yofi’ F2 segregants at the day of 881

anthesis exposing the ovule color. 882

Supplemental Tables 883

Table S1 - Mean of carotenogenesis genes digital expression during CEZ and 'low- 884

β' fruit development. 885

Table S2 - Fruit carotenoid content at 20 DAA and at mature fruit of various 886

inbred lines and F2 segregants. 887

888

889



34

REFERENCES 890

891

Alquezar B, Rodrigo MJ, Lado J, Zacarias L (2013) A comparative 892

physiological and transcriptional study of carotenoid biosynthesis in white 893

and red grapefruit (Citrus paradisi Macf.). Tree Genet Genomes 9: 1257– 894

1269 895

Arango J, Jourdan M, Geoffriau E, Beyer P, Welsch R (2014) Carotene 896

Hydroxylase Activity Determines the Levels of Both α-Carotene and Total 897

Carotenoids in Orange Carrots. Plant Cell 26: 2223–2233 898

Beisel KG, Schurr U, Matsubara S (2011) Altered turnover of β-carotene and 899

Chl a in arabidopsis leaves treated with lincomycin or norflurazon. Plant Cell 900

Physiol 52: 1193–1203 901

Cazzonelli CI, Pogson BJ (2010) Source to sink: regulation of carotenoid 902

biosynthesis in plants. Trends Plant Sci 15: 266–274 903

Chayut N, Yuan H, Ohali S, Meir A, Yeselson Y, Portnoy V, Zheng Y, Fei Z, 904

Lewinsohn E, Katzir N, et al (2015) A bulk segregant transcriptome 905

analysis reveals metabolic and cellular processes associated with Orange 906

allelic variation and fruit β-carotene accumulation in melon fruit. BMC Plant 907

Biol 15: 274 908

Chen Y, Li F, Wurtzel ET (2010) Isolation and characterization of the Z-ISO 909

gene encoding a missing component of carotenoid biosynthesis in plants. 910

Plant Physiol 153: 66–79 911

Egea I, Barsan C, Bian W, Purgatto E, Latché A, Chervin C, Bouzayen M, 912

Pech J-C (2010) Chromoplast differentiation: current status and 913

perspectives. Plant Cell Physiol 51: 1601–11 914

Fraser PD, Bramley PM (2004) The biosynthesis and nutritional uses of 915

carotenoids. Prog Lipid Res 43: 228–65 916

Fraser PD, Enfissi EMA, Halket JM, Truesdale MR, Yu D, Gerrish C, Bramley 917

PM (2007) Manipulation of phytoene levels in tomato fruit: effects on 918

isoprenoids, plastids, and intermediary metabolism. Plant Cell 19: 3194– 919

3211 920



35

Galpaz N, Burger Y, Lavee T, Tzuri G, Sherman A, Melamed T, Eshed R, 921

Meir A, Portnoy V, Bar E, et al (2013) Genetic and chemical 922

characterization of an EMS induced mutation in Cucumis melo CRTISO 923

gene. Arch Biochem Biophys 539: 117–25 924

Garcia-Mas J, Benjak A, Sanseverino W, Bourgeois M, Mir G, González VM, 925

Hénaff E, Câmara F, Cozzuto L, Lowy E, et al (2012) The genome of 926

melon (Cucumis melo L.). Proc Natl Acad Sci U S A 109: 11872–7 927

Giuliano G, Diretto G (2007) Of chromoplasts and chaperones. Trends Plant Sci 928

12: 529–31 929

Graham RD, Welch RM, Bouis HE (2001) Addressing micronutrient malnutrition 930

through enhancing the nutritional quality of staple foods: Principles, 931

perspectives and knowledge gaps. Adv Agron 70: 77–142 932

Howitt CA, Pogson BJ (2006) Carotenoid accumulation and function in seeds 933

and non-green tissues. Plant Cell Environ 29: 435–45 934

Isaacson T, Ronen G, Zamir D, Hirschberg J (2002) Cloning of tangerine from 935

tomato reveals a carotenoid isomerase essential for the production of β- 936

carotene and xanthophylls in plants. Plant Cell 937

Jahns P, Holzwarth AR (2012) The role of the xanthophyll cycle and of lutein in 938

photoprotection of photosystem II. Biochim Biophys Acta - Bioenerg 1817: 939

182–193 940

Kerényi Z, Mérai Z, Hiripi L, Benkovics A, Gyula P, Lacomme C, Barta E, 941

Nagy F, Silhavy D (2008) Inter-kingdom conservation of mechanism of 942

nonsense-mediated mRNA decay. EMBO J 27: 1585–95 943

Lado J, Zacarias L, Gurrea A, Page A, Stead A, Rodrigo MJ (2015) Exploring 944

the diversity in Citrus fruit colouration to decipher the relationship between 945

plastid ultrastructure and carotenoid composition. Planta 242: 645–661 946

Langmead B, Trapnell C, Pop M, Salzberg S (2009) Ultrafast and memory- 947

efficient alignment of short DNA sequences to the human genome. Genome 948

Biol 949

Lätari K, Wüst F, Hübner M, Schaub P, Beisel KG, Matsubara S, Beyer P, 950

Welsch R (2015) Tissue-Specific Apocarotenoid Glycosylation Contributes 951



36

to Carotenoid Homeostasis in Arabidopsis Leaves. Plant Physiol 168: 1550– 952

62 953

Li L, Lu S, Cosman KM, Earle ED, Garvin DF, O’Neill J (2006) β-Carotene 954

accumulation induced by the cauliflower Or gene is not due to an increased 955

capacity of biosynthesis. Phytochemistry 67: 1177–1184 956

Li L, Paolillo DJ, Parthasarathy M V, Dimuzio EM, Garvin DF, Plant US, Road 957

T (2001) A novel gene mutation that confers abnormal patterns of β-carotene 958

accumulation in cauliflower ( Brassica oleracea var. botrytis ). 26: 59–67 959

Li L, Yang Y, Xu Q, Owsiany K, Welsch R, Chitchumroonchokchai C, Lu S, 960

Van Eck J, Deng X-X, Failla M, et al (2012) The Or gene enhances 961

carotenoid accumulation and stability during post-harvest storage of potato 962

tubers. Mol Plant 5: 339–52 963

Li L, Yuan H (2013) Chromoplast biogenesis and carotenoid accumulation. Arch 964

Biochem Biophys 539: 102–9 965

Lopez AB, Van Eck J, Conlin BJ, Paolillo DJ, O’Neill J, Li L (2008) Effect of 966

the cauliflower Or transgene on carotenoid accumulation and chromoplast 967

formation in transgenic potato tubers. J Exp Bot 59: 213–223 968

Lu S, Eck J Van, Zhou XJ, Lopez AB, O’Halloran DM, Cosman KM, Conlin 969

BJ, Paolillo DJ, Garvin DF, Vrebalov J, et al (2006) The cauliflower Or 970

gene encodes a DnaJ cysteine-rich domain-containing protein that mediates 971

high levels of b-carotene accumulation. Plant Cell 18: 3594–3605 972

Maass D, Arango J, Wüst F, Beyer P, Welsch R (2009) Carotenoid crystal 973

formation in Arabidopsis and carrot roots caused by increased phytoene 974

synthase protein levels. PLoS One 4: e6373 975

Maiani G, Castón MJP, Catasta G, Toti E, Cambrodón IG, Bysted A, 976

Granado-Lorencio F, Olmedilla-Alonso B, Knuthsen P, Valoti M, et al 977

(2009) Carotenoids: Actual knowledge on food sources, intakes, stability and 978

bioavailability and their protective role in humans. Mol Nutr Food Res 53: 979

194–218 980

Nisar N, Li L, Lu S, Khin NC, Pogson BJ (2015) Carotenoid Metabolism in 981

Plants. Mol Plant 8: 68–82 982



37

Obrdlik P, El-Bakkoury M, Hamacher T, Cappellaro C, Vilarino C, Fleischer 983

C, Ellerbrok H, Kamuzinzi R, Ledent V, Blaudez D, et al (2004) K+ 984

channel interactions detected by a genetic system optimized for systematic 985

studies of membrane protein interactions. Proc Natl Acad Sci U S A 101: 986

12242–7 987

Park SC, Kim SH, Park S, Lee HU, Lee JS, Park WS, Ahn MJ, Kim YH, Jeong 988

JC, Lee HS, et al (2015) Enhanced accumulation of carotenoids in 989

sweetpotato plants overexpressing IbOr-Ins gene in purple-fleshed 990

sweetpotato cultivar. Plant Physiol Biochem 86: 82–90 991

Pitrat M (2000) Some comments on infraspecific classification of cultivars of 992

melon. In Proceedings of Cucurbitaceae 2000 (eds Katzir N. Paris HS) 993

ISHS, Belgium. Acta Hort 510: 29–36 994

Portnoy V, Benyamini Y, Bar E, Harel-Beja R, Gepstein S, Giovannoni JJ, 995

Schaffer A a, Burger J, Tadmor Y, Lewinsohn E, et al (2008) The 996

molecular and biochemical basis for varietal variation in sesquiterpene 997

content in melon (Cucumis melo L.) rinds. Plant Mol Biol 66: 647–61 998

Qin X, Coku A, Inoue K, Tian L (2011) Expression, subcellular localization, and 999

cis-regulatory structure of duplicated phytoene synthase genes in melon 1000

(Cucumis melo L.). Planta 234: 737–748 1001

Robinson MD, McCarthy DJ, Smyth GK (2009) edgeR: A Bioconductor 1002

package for differential expression analysis of digital gene expression data. 1003

Bioinformatics 26: 139–140 1004

Sennepin AD, Charpentier S, Normand T, Sarré C, Legrand A, Mollet LM 1005

(2009) Multiple reprobing of Western blots after inactivation of peroxidase 1006

activity by its substrate, hydrogen peroxide. Anal Biochem 393: 129–131 1007

Shumskaya M, Bradbury LMT, Monaco RR, Wurtzel ET (2012) Plastid 1008

Localization of the Key Carotenoid Enzyme Phytoene Synthase Is Altered by 1009

Isozyme, Allelic Variation, and Activity. Plant Cell 24: 3725–3741 1010

Tadmor Y, Katzir N, Meir A, Yaniv-Yaakov A, Sa’ar U, Baumkoler F, Lavee T, 1011

Lewinsohn E, Schaffer A, Burger J (2007) Induced mutagenesis to 1012

augment the natural genetic variability of melon (Cucumis melo L.). Isr J 1013



38

Plant Sci 55: 159–169 1014

Tadmor Y, King S, Levi A, Davis A, Meir A, Wasserman B, Hirschberg J, 1015

Lewinsohn E (2005) Comparative fruit colouration in watermelon and 1016

tomato. Food Res Int 38: 837–841 1017

Tadmor Y, Larkov O, Meir A, Minkoff M, Lastochkin E, Edelstein M, Levin S, 1018

Wong J, Rocheford T, Lewinsohn E (2000) Reversed-phase high 1019

performance liquid chromatographic determination of vitamin E components 1020

in maize kernels. Phytochem Anal 11: 370–374 1021

Telfer A (2002) What is beta-carotene doing in the photosystem II reaction 1022

centre? Philos Trans R Soc Lond B Biol Sci 357: 1431–39; discussion 1439– 1023

40, 1469–70 1024

Trapnell C, Pachter L, Salzberg SL (2009) TopHat: discovering splice junctions 1025

with RNA-Seq. Bioinformatics 25: 1105–11 1026

Tzuri G, Zhou X, Chayut N, Yuan H, Portnoy V, Meir A, Sa’ar U, Baumkoler 1027

F, Mazourek M, Lewinsohn E, et al (2015) A “golden” SNP in CmOr 1028

governs the fruit flesh color of melon (Cucumis melo). Plant J 82: 267–79 1029

Walter MH, Strack D (2011) Carotenoids and their cleavage products: 1030

biosynthesis and functions. Nat Prod Rep 28: 663–692 1031

Yuan H, Owsiany K, Sheeja T, Zhou X, Rodriguez C, Li Y, Chayut N, Yang Y, 1032

Welsch R, Thannhauser T, et al (2015a) A Single Amino Acid Substitution 1033

in an ORANGE Protein Promotes Carotenoid Overaccumulation in 1034

Arabidopsis. Plant Physiol 169: pp.00971.2015 1035

Yuan H, Zhang JJJ, Nageswaran D, Li L, Li L, Yuan H, Egea I, Barsan C, 1036

Bian W, Purgatto E, et al (2015b) Carotenoid metabolism and regulation in 1037

horticultural crops. Hortic Res 2: 15036 1038

Zhong S, Joung J-G, Zheng Y, Chen Y, Liu B, Shao Y, Xiang JZ, Fei Z, 1039

Giovannoni JJ (2011) High-throughput illumina strand-specific RNA 1040

sequencing library preparation. Cold Spring Harb Protoc 2011: 940–9 1041

Zhou X, Welsch R, Yang Y, Álvarez D, Riediger M, Yuan H, Fish T, Liu J, 1042

Thannhauser TW, Li L (2015) Arabidopsis OR proteins are the major 1043

posttranscriptional regulators of phytoene synthase in controlling carotenoid 1044



39

biosynthesis. Proc Natl Acad Sci 201420831. 1045



1

Figure 1: Schematic biosynthetic pathway of carotenoids and apocarotenoids. Capital-letter abbreviations are enzymes. Carotenoid metabolites are in lower-case bold. Dashed arrows represent series of enzymatic reactions. Bar-headed lines represent enzyme inhibitors (norflurazon, NF; 2-(4-chlorophenylthio) triethylamine hydrochloride, CPTA) or mutant name (yofi). DXS, 1-deoxy-D-xylulose-5-phosphate synthase; DXR, 1-deoxy-D-xylulose-5-phosphate reductoisomerase; GGPPS, geranylgeranyl pyrophosphate synthase; PSY, phytoene synthase; PDS, phytoene desaturase; Z-ISO, ζ carotene isomerase; ZDS, ζ carotene desaturase; CRTISO, carotenoid isomerase; β-LCY, lycopene beta cyclase; ε-LCY, lycopene epsilon cyclase; β-OHase, β-carotene hydroxylase; CCDs, carotenoid cleavage dioxygenase; VDE, violaxanthin de-epoxidase; ZEP, zeaxanthin epoxidase; NCED, 9-cis-epoxycarotenoid dioxygenase. ABA, abscisic acid.



1

Figure 2: Phenotype of the ‘low-β’ mutant and CEZ fruits. A. Transections of ‘low-β’ and CEZ fruits at four developmental stages, 10, 20 and 30 days after anthesis (DAA) and mature stage. White bar = 5cm; B. Fruit flesh β-carotene levels in the four fruit developmental stages shown in A; data are mean +/- SD of three biological replicates (different fruits from different plants). FW, fresh weight. C. Total fruit chlorophyll a and b levels during fruit development; D. and E. Bright visible light microscopy of mature fruit mesocarp cells of CEZ (D) and ‘low β’ (E). Black bars = 100 μm. F. and G. Bright field light microscopy pictures of mature ‘CEZ’ protoplast (F) and mature ‘low β’ protoplast (G). Black bars = 10 μm.



1

Figure 3: Comparisons of ‘low β’ with CEZ: A. Complementation test of ‘low β’ and CEZ with a panel of Cmor-Arg homozygous lines: NY, NA, ED, TAD, PDS. CmOr-His homozygous lines, INB, DUL and CEZ, served as controls. Pictures of the female parent fruits are in the top row. Male parent was either ‘low β’ or CEZ (fruits shown on the right). F1 hybrid fruits of the crosses with ‘low β’ (a-h) and with CEZ (i-p) are shown. a-e non-orange fruits in hybrids indicated that ‘low β’ is allelic to CmOr. B. Aligned partial protein sequences of CmOR-His (CEZ) and CmOR-Arg (TAD) and the ‘low β’ OR protein with its premature ‘STOP’ codon at position 163. The ‘golden' SNP (His to Arg) at position 108 is highlighted. C. CmOr mRNA digital expression in CEZ and ‘low β’ developing fruit mesocarp. Columns represent average RPKM +/- S.E of three independent biological repeats. D. CmOR protein levels in CEZ and ‘low β’ mutant at 20 and 30 DAA and in mature melon fruit. CmOR protein was detected by immunoblotting analysis, a poinceau-stained membrane is shown below. E. Yeast split ubiquitin analysis.



2

Interactions between CmOR-His-Cub (horizontal), Nub-CmOR-His and Nub-CmoR-lowβ (vertical) were examined by growing yeasts on either nonselective (-LW) or fully selective medium supplemented with 150 µM methionine to reduce weak background autoactiviation of reporter genes and to visualize different interaction strengths (-LWAH+Met) in a series of 10-fold dilutions. Empty vector expressing nub only is included as a control. lacZ reporter gene activity was quantified by oNPG assays (right) and is given in nmol oNP min-1 OD600-1. Results are mean +/- SE of four biological replicates with two technical replicates.



1

Figure 4: PSY mRNA expression, protein levels and enzymatic activity analyses in ‘CEZ’ and ‘low-β’ fruits. A and B. Digital expression of PSY-1 (A) and PSY-2 (B) in ‘CEZ’ and ‘low-β’ developing fruit. Average RPKM +/- SE of three biological repeats is shown. C. A Western blot showing PSY protein levels at 20 and 30 DAA and in the mature fruit of ‘CEZ’ and ‘low β’; proteins were extracted from pools of three fruits. D Representative HPLC chromatograms at 290 nm. Carotenoids were extracted from 30 DAA fruit flesh discs of CEZ (a, b) and low-β (c, d) treated with norflurazon (NF; a, c) or with water (b, d) for 12 hours in the dark. E. Phytoene accumulated in 30 DAA fruit discs upon NF-treatment. Phytoene is expressed in µg g-1 fresh weight of treated fruit flesh at 12 and 24 hours of treatment. Values are mean +/- SD of three biological repeats.



1

Figure 5: Fruit flesh color and carotenoid levels of various melon genotypes. Transected fruit at 20 DAA (left) and mature (right) are shown. A. Top: transected fruits of ‘low β’ and ‘yofi’ parental lines. Bottom: panels of the four possible allelic combinations transected fruit. CmOr genotypes (CmOr-His, Cmor-lowβ) are indicated on the left and CRTISO genotypes (WT and nonsense mutated crtiso) are indicated on the top of each panel. B. TOP: transected fruits of yofi and ‘NY’ parental lines. Bottom: panels of transected fruit of the four possible allelic combinations. C-D. Average amounts (μg/g FW) of phytoene, lutein, prolycopene and β-carotene accumulated at 20 DAA (C) and in mature fruit (D) of F2 defined segregants derived from yofi X low- β (CmOr-His and Cmor-lowβ) and from yofi X NY (Cmor-Arg) crosses. Exact numbers and standard errors are in Table S2.



1

Figure 6: PSY protein and phytoene levels in melon lines. A. Western blot showing PSY protein levels at 30 DAA in six melon inbred lines and low-β and with actin signals used as loading control; fruit flesh phenotype at 30 DAA is shown below. Each sample is a pool of 6 fruits from 6 different plants B. PSY protein levels at 5, 10, 20 and 30 DAA of green flesh and orange flesh bulked segregants originating from a cross between DUL and TAD and sharing the same fruit flesh color. Each sample is a bulk of 75 fruits originated from 25 different F3 families. C. Phytoene accumulated in 30 DAA fruit discs upon norflurazon (NF) -treatment. Phytoene is expressed in µg g-1 fresh weight of treated fruit flesh at 24 hours of treatment. Values are mean +/- SD of three biological repeats. Although PSY protein and phytoene levels upon NF-treatment are quite similar, β-carotene content in CmOR-His is much higher than in CmOR-Arg melons.



1

Figure 7: A model of carotenogenesis under the effect of three alleles of CmOr and of a dysfunctional CRTISO. In presence of both OR-His and OR-Arg, carotenoid pathway flux occurs at high levels (green arrows), but only OR-His prevents further metabolism downstream of β-carotene (red arrow) resulting in strongly increased β-carotene accumulation in OR-His melon fruits but not in OR-Arg. In contrast, low PSY protein levels, caused by a truncated OR-lowb, results in a weak pathway flux (red arrow) and hence low carotenoid levels in OR-lowb fruit. Dysfunctional CRTISO in yofi melons results in metabolic arrest downstream to prolycopene (red arrow). Accordingly, prolycopene is accumulated in yofi genotypes regardless of the ‘golden SNP’ which operates downstream in the pathway.



Parsed CitationsAlquezar B, Rodrigo MJ, Lado J, Zacarias L (2013) A comparative physiological and transcriptional study of carotenoid biosynthesisin white and red grapefruit (Citrus paradisi Macf.). Tree Genet Genomes 9: 1257-1269

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Arango J, Jourdan M, Geoffriau E, Beyer P, Welsch R (2014) Carotene Hydroxylase Activity Determines the Levels of Both a-Carotene and Total Carotenoids in Orange Carrots. Plant Cell 26: 2223-2233


Beisel KG, Schurr U, Matsubara S (2011) Altered turnover of??-carotene and Chl a in arabidopsis leaves treated with lincomycinor norflurazon. Plant Cell Physiol 52: 1193-1203


Cazzonelli CI, Pogson BJ (2010) Source to sink: regulation of carotenoid biosynthesis in plants. Trends Plant Sci 15: 266-274Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Chayut N, Yuan H, Ohali S, Meir A, Yeselson Y, Portnoy V, Zheng Y, Fei Z, Lewinsohn E, Katzir N, et al (2015) A bulk segreganttranscriptome analysis reveals metabolic and cellular processes associated with Orange allelic variation and fruit ß-caroteneaccumulation in melon fruit. BMC Plant Biol 15: 274


Chen Y, Li F, Wurtzel ET (2010) Isolation and characterization of the Z-ISO gene encoding a missing component of carotenoidbiosynthesis in plants. Plant Physiol 153: 66-79


Egea I, Barsan C, Bian W, Purgatto E, Latché A, Chervin C, Bouzayen M, Pech J-C (2010) Chromoplast differentiation: currentstatus and perspectives. Plant Cell Physiol 51: 1601-11


Fraser PD, Bramley PM (2004) The biosynthesis and nutritional uses of carotenoids. Prog Lipid Res 43: 228-65Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Fraser PD, Enfissi EMA, Halket JM, Truesdale MR, Yu D, Gerrish C, Bramley PM (2007) Manipulation of phytoene levels in tomatofruit: effects on isoprenoids, plastids, and intermediary metabolism. Plant Cell 19: 3194-3211


Galpaz N, Burger Y, Lavee T, Tzuri G, Sherman A, Melamed T, Eshed R, Meir A, Portnoy V, Bar E, et al (2013) Genetic and chemicalcharacterization of an EMS induced mutation in Cucumis melo CRTISO gene. Arch Biochem Biophys 539: 117-25


Garcia-Mas J, Benjak A, Sanseverino W, Bourgeois M, Mir G, González VM, Hénaff E, Câmara F, Cozzuto L, Lowy E, et al (2012)The genome of melon (Cucumis melo L.). Proc Natl Acad Sci U S A 109: 11872-7


Giuliano G, Diretto G (2007) Of chromoplasts and chaperones. Trends Plant Sci 12: 529-31Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Graham RD, Welch RM, Bouis HE (2001) Addressing micronutrient malnutrition through enhancing the nutritional quality of staplefoods: Principles, perspectives and knowledge gaps. Adv Agron 70: 77-142


Howitt CA, Pogson BJ (2006) Carotenoid accumulation and function in seeds and non-green tissues. Plant Cell Environ 29: 435-45Pubmed: Author and Title www.plantphysiol.orgon August 11, 2019 - Published by Downloaded from

Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Alquezar B%2C Rodrigo MJ%2C Lado J%2C Zacarias L %282013%29 A comparative physiological and transcriptional study of carotenoid biosynthesis in white and red grapefruit %28Citrus paradisi Macf%2E%29%2E Tree Genet Genomes 9%3A 1257%2D1269&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Alquezar B, Rodrigo MJ, Lado J, Zacarias L (2013) A comparative physiological and transcriptional study of carotenoid biosynthesis in white and red grapefruit (Citrus paradisi Macf.). Tree Genet Genomes 9: 1257-1269

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Alquezar&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A comparative physiological and transcriptional study of carotenoid biosynthesis in white and red grapefruit (Citrus paradisi Macf&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A comparative physiological and transcriptional study of carotenoid biosynthesis in white and red grapefruit (Citrus paradisi Macf&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Alquezar&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Arango J%2C Jourdan M%2C Geoffriau E%2C Beyer P%2C Welsch R %282014%29 Carotene Hydroxylase Activity Determines the Levels of Both a%2DCarotene and Total Carotenoids in Orange Carrots%2E Plant Cell 26%3A 2223%2D2233&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Arango J, Jourdan M, Geoffriau E, Beyer P, Welsch R (2014) Carotene Hydroxylase Activity Determines the Levels of Both a-Carotene and Total Carotenoids in Orange Carrots. Plant Cell 26: 2223-2233

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Arango&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Carotene Hydroxylase Activity Determines the Levels of Both a-Carotene and Total Carotenoids in Orange Carrots&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Carotene Hydroxylase Activity Determines the Levels of Both a-Carotene and Total Carotenoids in Orange Carrots&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Arango&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Beisel KG%2C Schurr U%2C Matsubara S %282011%29 Altered turnover of%3F%3F%2Dcarotene and Chl a in arabidopsis leaves treated with lincomycin or norflurazon%2E Plant Cell Physiol 52%3A 1193%2D1203&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Beisel KG, Schurr U, Matsubara S (2011) Altered turnover of??-carotene and Chl a in arabidopsis leaves treated with lincomycin or norflurazon. Plant Cell Physiol 52: 1193-1203

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Beisel&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Altered turnover of&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Altered turnover of&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Beisel&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Cazzonelli CI%2C Pogson BJ %282010%29 Source to sink%3A regulation of carotenoid biosynthesis in plants%2E Trends Plant Sci 15%3A 266%2D274&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cazzonelli CI, Pogson BJ (2010) Source to sink: regulation of carotenoid biosynthesis in plants. Trends Plant Sci 15: 266-274

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cazzonelli&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Source to sink: regulation of carotenoid biosynthesis in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Source to sink: regulation of carotenoid biosynthesis in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cazzonelli&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Chayut N%2C Yuan H%2C Ohali S%2C Meir A%2C Yeselson Y%2C Portnoy V%2C Zheng Y%2C Fei Z%2C Lewinsohn E%2C Katzir N%2C et al %282015%29 A bulk segregant transcriptome analysis reveals metabolic and cellular processes associated with Orange allelic variation and fruit �%2Dcarotene accumulation in melon fruit%2E BMC Plant Biol 15%3A 274&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chayut N, Yuan H, Ohali S, Meir A, Yeselson Y, Portnoy V, Zheng Y, Fei Z, Lewinsohn E, Katzir N, et al (2015) A bulk segregant transcriptome analysis reveals metabolic and cellular processes associated with Orange allelic variation and fruit �-carotene accumulation in melon fruit. BMC Plant Biol 15: 274

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chayut&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A bulk segregant transcriptome analysis reveals metabolic and cellular processes associated with Orange allelic variation and fruit �-carotene accumulation in melon fruit.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A bulk segregant transcriptome analysis reveals metabolic and cellular processes associated with Orange allelic variation and fruit �-carotene accumulation in melon fruit.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chayut&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Chen Y%2C Li F%2C Wurtzel ET %282010%29 Isolation and characterization of the Z%2DISO gene encoding a missing component of carotenoid biosynthesis in plants%2E Plant Physiol 153%3A 66%2D79&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chen Y, Li F, Wurtzel ET (2010) Isolation and characterization of the Z-ISO gene encoding a missing component of carotenoid biosynthesis in plants. Plant Physiol 153: 66-79

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Isolation and characterization of the Z-ISO gene encoding a missing component of carotenoid biosynthesis in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Isolation and characterization of the Z-ISO gene encoding a missing component of carotenoid biosynthesis in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chen&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Egea I%2C Barsan C%2C Bian W%2C Purgatto E%2C Latch� A%2C Chervin C%2C Bouzayen M%2C Pech J%2DC %282010%29 Chromoplast differentiation%3A current status and perspectives%2E Plant Cell Physiol 51%3A 1601%2D11&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Egea I, Barsan C, Bian W, Purgatto E, Latch� A, Chervin C, Bouzayen M, Pech J-C (2010) Chromoplast differentiation: current status and perspectives. Plant Cell Physiol 51: 1601-11

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Egea&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Chromoplast differentiation: current status and perspectives&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Chromoplast differentiation: current status and perspectives&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Egea&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fraser PD%2C Bramley PM %282004%29 The biosynthesis and nutritional uses of carotenoids%2E Prog Lipid Res 43%3A 228%2D65&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fraser PD, Bramley PM (2004) The biosynthesis and nutritional uses of carotenoids. Prog Lipid Res 43: 228-65

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fraser&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The biosynthesis and nutritional uses of carotenoids&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The biosynthesis and nutritional uses of carotenoids&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fraser&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fraser PD%2C Enfissi EMA%2C Halket JM%2C Truesdale MR%2C Yu D%2C Gerrish C%2C Bramley PM %282007%29 Manipulation of phytoene levels in tomato fruit%3A effects on isoprenoids%2C plastids%2C and intermediary metabolism%2E Plant Cell 19%3A 3194%2D3211&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fraser PD, Enfissi EMA, Halket JM, Truesdale MR, Yu D, Gerrish C, Bramley PM (2007) Manipulation of phytoene levels in tomato fruit: effects on isoprenoids, plastids, and intermediary metabolism. Plant Cell 19: 3194-3211

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fraser&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Manipulation of phytoene levels in tomato fruit: effects on isoprenoids, plastids, and intermediary metabolism&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Manipulation of phytoene levels in tomato fruit: effects on isoprenoids, plastids, and intermediary metabolism&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fraser&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Galpaz N%2C Burger Y%2C Lavee T%2C Tzuri G%2C Sherman A%2C Melamed T%2C Eshed R%2C Meir A%2C Portnoy V%2C Bar E%2C et al %282013%29 Genetic and chemical characterization of an EMS induced mutation in Cucumis melo CRTISO gene%2E Arch Biochem Biophys 539%3A 117%2D25&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Galpaz N, Burger Y, Lavee T, Tzuri G, Sherman A, Melamed T, Eshed R, Meir A, Portnoy V, Bar E, et al (2013) Genetic and chemical characterization of an EMS induced mutation in Cucumis melo CRTISO gene. Arch Biochem Biophys 539: 117-25

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Galpaz&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genetic and chemical characterization of an EMS induced mutation in Cucumis melo CRTISO gene&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genetic and chemical characterization of an EMS induced mutation in Cucumis melo CRTISO gene&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Galpaz&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Garcia%2DMas J%2C Benjak A%2C Sanseverino W%2C Bourgeois M%2C Mir G%2C Gonz�lez VM%2C H�naff E%2C C�mara F%2C Cozzuto L%2C Lowy E%2C et al %282012%29 The genome of melon %28Cucumis melo L%2E%29%2E Proc Natl Acad Sci U S A 109%3A 11872%2D7&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Garcia-Mas J, Benjak A, Sanseverino W, Bourgeois M, Mir G, Gonz�lez VM, H�naff E, C�mara F, Cozzuto L, Lowy E, et al (2012) The genome of melon (Cucumis melo L.). Proc Natl Acad Sci U S A 109: 11872-7

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Garcia-Mas&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The genome of melon (Cucumis melo L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The genome of melon (Cucumis melo L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Garcia-Mas&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Giuliano G%2C Diretto G %282007%29 Of chromoplasts and chaperones%2E Trends Plant Sci 12%3A 529%2D31&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Giuliano G, Diretto G (2007) Of chromoplasts and chaperones. Trends Plant Sci 12: 529-31

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Giuliano&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Of chromoplasts and chaperones&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Of chromoplasts and chaperones&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Giuliano&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Graham RD%2C Welch RM%2C Bouis HE %282001%29 Addressing micronutrient malnutrition through enhancing the nutritional quality of staple foods%3A Principles%2C perspectives and knowledge gaps%2E Adv Agron 70%3A 77%2D142&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Graham RD, Welch RM, Bouis HE (2001) Addressing micronutrient malnutrition through enhancing the nutritional quality of staple foods: Principles, perspectives and knowledge gaps. Adv Agron 70: 77-142

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Graham&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Addressing micronutrient malnutrition through enhancing the nutritional quality of staple foods: Principles, perspectives and knowledge gaps&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Addressing micronutrient malnutrition through enhancing the nutritional quality of staple foods: Principles, perspectives and knowledge gaps&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Graham&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Howitt CA%2C Pogson BJ %282006%29 Carotenoid accumulation and function in seeds and non%2Dgreen tissues%2E Plant Cell Environ 29%3A 435%2D45&dopt=abstract


CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Isaacson T, Ronen G, Zamir D, Hirschberg J (2002) Cloning of tangerine from tomato reveals a carotenoid isomerase essential forthe production of ß-carotene and xanthophylls in plants. Plant Cell


Jahns P, Holzwarth AR (2012) The role of the xanthophyll cycle and of lutein in photoprotection of photosystem II. Biochim BiophysActa - Bioenerg 1817: 182-193


Kerényi Z, Mérai Z, Hiripi L, Benkovics A, Gyula P, Lacomme C, Barta E, Nagy F, Silhavy D (2008) Inter-kingdom conservation ofmechanism of nonsense-mediated mRNA decay. EMBO J 27: 1585-95


Lado J, Zacarias L, Gurrea A, Page A, Stead A, Rodrigo MJ (2015) Exploring the diversity in Citrus fruit colouration to decipher therelationship between plastid ultrastructure and carotenoid composition. Planta 242: 645-661


Langmead B, Trapnell C, Pop M, Salzberg S (2009) Ultrafast and memory-efficient alignment of short DNA sequences to the humangenome. Genome Biol


Lätari K, Wüst F, Hübner M, Schaub P, Beisel KG, Matsubara S, Beyer P, Welsch R (2015) Tissue-Specific ApocarotenoidGlycosylation Contributes to Carotenoid Homeostasis in Arabidopsis Leaves. Plant Physiol 168: 1550-62


Li L, Lu S, Cosman KM, Earle ED, Garvin DF, O'Neill J (2006) ß-Carotene accumulation induced by the cauliflower Or gene is notdue to an increased capacity of biosynthesis. Phytochemistry 67: 1177-1184


Li L, Paolillo DJ, Parthasarathy M V, Dimuzio EM, Garvin DF, Plant US, Road T (2001) A novel gene mutation that confers abnormalpatterns of ?-carotene accumulation in cauliflower ( Brassica oleracea var. botrytis ). 26: 59-67


Li L, Yang Y, Xu Q, Owsiany K, Welsch R, Chitchumroonchokchai C, Lu S, Van Eck J, Deng X-X, Failla M, et al (2012) The Or geneenhances carotenoid accumulation and stability during post-harvest storage of potato tubers. Mol Plant 5: 339-52


Li L, Yuan H (2013) Chromoplast biogenesis and carotenoid accumulation. Arch Biochem Biophys 539: 102-9Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lopez AB, Van Eck J, Conlin BJ, Paolillo DJ, O'Neill J, Li L (2008) Effect of the cauliflower Or transgene on carotenoidaccumulation and chromoplast formation in transgenic potato tubers. J Exp Bot 59: 213-223


Lu S, Eck J Van, Zhou XJ, Lopez AB, O'Halloran DM, Cosman KM, Conlin BJ, Paolillo DJ, Garvin DF, Vrebalov J, et al (2006) Thecauliflower Or gene encodes a DnaJ cysteine-rich domain-containing protein that mediates high levels of b-caroteneaccumulation. Plant Cell 18: 3594-3605


Maass D, Arango J, Wüst F, Beyer P, Welsch R (2009) Carotenoid crystal formation in Arabidopsis and carrot roots caused byincreased phytoene synthase protein levels. PLoS One 4: e6373



http://search.crossref.org/?page=1&rows=2&q=Howitt CA, Pogson BJ (2006) Carotenoid accumulation and function in seeds and non-green tissues. Plant Cell Environ 29: 435-45

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Howitt&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Carotenoid accumulation and function in seeds and non-green tissues&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Carotenoid accumulation and function in seeds and non-green tissues&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Howitt&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Isaacson T%2C Ronen G%2C Zamir D%2C Hirschberg J %282002%29 Cloning of tangerine from tomato reveals a carotenoid isomerase essential for the production of �%2Dcarotene and xanthophylls in plants%2E Plant Cell&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Isaacson T, Ronen G, Zamir D, Hirschberg J (2002) Cloning of tangerine from tomato reveals a carotenoid isomerase essential for the production of �-carotene and xanthophylls in plants. Plant Cell

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Isaacson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cloning of tangerine from tomato reveals a carotenoid isomerase essential for the production of �-carotene and xanthophylls in plants.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cloning of tangerine from tomato reveals a carotenoid isomerase essential for the production of �-carotene and xanthophylls in plants.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Isaacson&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Jahns P%2C Holzwarth AR %282012%29 The role of the xanthophyll cycle and of lutein in photoprotection of photosystem II%2E Biochim Biophys Acta %2D Bioenerg 1817%3A 182%2D193&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Jahns P, Holzwarth AR (2012) The role of the xanthophyll cycle and of lutein in photoprotection of photosystem II. Biochim Biophys Acta - Bioenerg 1817: 182-193

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Jahns&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The role of the xanthophyll cycle and of lutein in photoprotection of photosystem II&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The role of the xanthophyll cycle and of lutein in photoprotection of photosystem II&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Jahns&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ker�nyi Z%2C M�rai Z%2C Hiripi L%2C Benkovics A%2C Gyula P%2C Lacomme C%2C Barta E%2C Nagy F%2C Silhavy D %282008%29 Inter%2Dkingdom conservation of mechanism of nonsense%2Dmediated mRNA decay%2E EMBO J 27%3A 1585%2D95&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ker�nyi Z, M�rai Z, Hiripi L, Benkovics A, Gyula P, Lacomme C, Barta E, Nagy F, Silhavy D (2008) Inter-kingdom conservation of mechanism of nonsense-mediated mRNA decay. EMBO J 27: 1585-95

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ker�nyi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Inter-kingdom conservation of mechanism of nonsense-mediated mRNA decay&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Inter-kingdom conservation of mechanism of nonsense-mediated mRNA decay&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ker�nyi&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lado J%2C Zacarias L%2C Gurrea A%2C Page A%2C Stead A%2C Rodrigo MJ %282015%29 Exploring the diversity in Citrus fruit colouration to decipher the relationship between plastid ultrastructure and carotenoid composition%2E Planta 242%3A 645%2D661&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lado J, Zacarias L, Gurrea A, Page A, Stead A, Rodrigo MJ (2015) Exploring the diversity in Citrus fruit colouration to decipher the relationship between plastid ultrastructure and carotenoid composition. Planta 242: 645-661

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lado&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Exploring the diversity in Citrus fruit colouration to decipher the relationship between plastid ultrastructure and carotenoid composition&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Exploring the diversity in Citrus fruit colouration to decipher the relationship between plastid ultrastructure and carotenoid composition&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lado&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Langmead B%2C Trapnell C%2C Pop M%2C Salzberg S %282009%29 Ultrafast and memory%2Defficient alignment of short DNA sequences to the human genome%2E Genome Biol&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Langmead B, Trapnell C, Pop M, Salzberg S (2009) Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Langmead&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Langmead&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=L�tari K%2C W�st F%2C H�bner M%2C Schaub P%2C Beisel KG%2C Matsubara S%2C Beyer P%2C Welsch R %282015%29 Tissue%2DSpecific Apocarotenoid Glycosylation Contributes to Carotenoid Homeostasis in Arabidopsis Leaves%2E Plant Physiol 168%3A 1550%2D62&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=L�tari K, W�st F, H�bner M, Schaub P, Beisel KG, Matsubara S, Beyer P, Welsch R (2015) Tissue-Specific Apocarotenoid Glycosylation Contributes to Carotenoid Homeostasis in Arabidopsis Leaves. Plant Physiol 168: 1550-62

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=L�tari&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Tissue-Specific Apocarotenoid Glycosylation Contributes to Carotenoid Homeostasis in Arabidopsis Leaves&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Tissue-Specific Apocarotenoid Glycosylation Contributes to Carotenoid Homeostasis in Arabidopsis Leaves&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=L�tari&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Li L%2C Lu S%2C Cosman KM%2C Earle ED%2C Garvin DF%2C O%27Neill J %282006%29 �%2DCarotene accumulation induced by the cauliflower Or gene is not due to an increased capacity of biosynthesis%2E Phytochemistry 67%3A 1177%2D1184&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li L, Lu S, Cosman KM, Earle ED, Garvin DF, O'Neill J (2006) �-Carotene accumulation induced by the cauliflower Or gene is not due to an increased capacity of biosynthesis. Phytochemistry 67: 1177-1184

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=�-Carotene accumulation induced by the cauliflower Or gene is not due to an increased capacity of biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=�-Carotene accumulation induced by the cauliflower Or gene is not due to an increased capacity of biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Li L%2C Paolillo DJ%2C Parthasarathy M V%2C Dimuzio EM%2C Garvin DF%2C Plant US%2C Road T %282001%29 A novel gene mutation that confers abnormal patterns of %3F%2Dcarotene accumulation in cauliflower %28 Brassica oleracea var%2E botrytis %29%2E 26%3A 59%2D67&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li L, Paolillo DJ, Parthasarathy M V, Dimuzio EM, Garvin DF, Plant US, Road T (2001) A novel gene mutation that confers abnormal patterns of ?-carotene accumulation in cauliflower ( Brassica oleracea var. botrytis ). 26: 59-67


http://scholar.google.com/scholar?as_q=A novel gene mutation that confers abnormal patterns of&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A novel gene mutation that confers abnormal patterns of&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Li L%2C Yang Y%2C Xu Q%2C Owsiany K%2C Welsch R%2C Chitchumroonchokchai C%2C Lu S%2C Van Eck J%2C Deng X%2DX%2C Failla M%2C et al %282012%29 The Or gene enhances carotenoid accumulation and stability during post%2Dharvest storage of potato tubers%2E Mol Plant 5%3A 339%2D52&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li L, Yang Y, Xu Q, Owsiany K, Welsch R, Chitchumroonchokchai C, Lu S, Van Eck J, Deng X-X, Failla M, et al (2012) The Or gene enhances carotenoid accumulation and stability during post-harvest storage of potato tubers. Mol Plant 5: 339-52


http://scholar.google.com/scholar?as_q=The Or gene enhances carotenoid accumulation and stability during post-harvest storage of potato tubers&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Or gene enhances carotenoid accumulation and stability during post-harvest storage of potato tubers&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Li L%2C Yuan H %282013%29 Chromoplast biogenesis and carotenoid accumulation%2E Arch Biochem Biophys 539%3A 102%2D9&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li L, Yuan H (2013) Chromoplast biogenesis and carotenoid accumulation. Arch Biochem Biophys 539: 102-9


http://scholar.google.com/scholar?as_q=Chromoplast biogenesis and carotenoid accumulation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Chromoplast biogenesis and carotenoid accumulation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lopez AB%2C Van Eck J%2C Conlin BJ%2C Paolillo DJ%2C O%27Neill J%2C Li L %282008%29 Effect of the cauliflower Or transgene on carotenoid accumulation and chromoplast formation in transgenic potato tubers%2E J Exp Bot 59%3A 213%2D223&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lopez AB, Van Eck J, Conlin BJ, Paolillo DJ, O'Neill J, Li L (2008) Effect of the cauliflower Or transgene on carotenoid accumulation and chromoplast formation in transgenic potato tubers. J Exp Bot 59: 213-223

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lopez&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Effect of the cauliflower Or transgene on carotenoid accumulation and chromoplast formation in transgenic potato tubers&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Effect of the cauliflower Or transgene on carotenoid accumulation and chromoplast formation in transgenic potato tubers&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lopez&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lu S%2C Eck J Van%2C Zhou XJ%2C Lopez AB%2C O%27Halloran DM%2C Cosman KM%2C Conlin BJ%2C Paolillo DJ%2C Garvin DF%2C Vrebalov J%2C et al %282006%29 The cauliflower Or gene encodes a DnaJ cysteine%2Drich domain%2Dcontaining protein that mediates high levels of b%2Dcarotene accumulation%2E Plant Cell 18%3A 3594%2D3605&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lu S, Eck J Van, Zhou XJ, Lopez AB, O'Halloran DM, Cosman KM, Conlin BJ, Paolillo DJ, Garvin DF, Vrebalov J, et al (2006) The cauliflower Or gene encodes a DnaJ cysteine-rich domain-containing protein that mediates high levels of b-carotene accumulation. Plant Cell 18: 3594-3605

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The cauliflower Or gene encodes a DnaJ cysteine-rich domain-containing protein that mediates high levels of b-carotene accumulation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The cauliflower Or gene encodes a DnaJ cysteine-rich domain-containing protein that mediates high levels of b-carotene accumulation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lu&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Maass D%2C Arango J%2C W�st F%2C Beyer P%2C Welsch R %282009%29 Carotenoid crystal formation in Arabidopsis and carrot roots caused by increased phytoene synthase protein levels%2E PLoS One 4%3A e6373&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Maass D, Arango J, W�st F, Beyer P, Welsch R (2009) Carotenoid crystal formation in Arabidopsis and carrot roots caused by increased phytoene synthase protein levels. PLoS One 4: e6373

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Maass&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Carotenoid crystal formation in Arabidopsis and carrot roots caused by increased phytoene synthase protein levels.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Carotenoid crystal formation in Arabidopsis and carrot roots caused by increased phytoene synthase protein levels.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Maass&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1


Maiani G, Castón MJP, Catasta G, Toti E, Cambrodón IG, Bysted A, Granado-Lorencio F, Olmedilla-Alonso B, Knuthsen P, Valoti M,et al (2009) Carotenoids: Actual knowledge on food sources, intakes, stability and bioavailability and their protective role inhumans. Mol Nutr Food Res 53: 194-218


Nisar N, Li L, Lu S, Khin NC, Pogson BJ (2015) Carotenoid Metabolism in Plants. Mol Plant 8: 68-82Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Obrdlik P, El-Bakkoury M, Hamacher T, Cappellaro C, Vilarino C, Fleischer C, Ellerbrok H, Kamuzinzi R, Ledent V, Blaudez D, et al(2004) K+ channel interactions detected by a genetic system optimized for systematic studies of membrane protein interactions.Proc Natl Acad Sci U S A 101: 12242-7


Park SC, Kim SH, Park S, Lee HU, Lee JS, Park WS, Ahn MJ, Kim YH, Jeong JC, Lee HS, et al (2015) Enhanced accumulation ofcarotenoids in sweetpotato plants overexpressing IbOr-Ins gene in purple-fleshed sweetpotato cultivar. Plant Physiol Biochem 86:82-90


Pitrat M (2000) Some comments on infraspecific classification of cultivars of melon. In Proceedings of Cucurbitaceae 2000 (edsKatzir N. Paris HS) ISHS, Belgium. Acta Hort 510: 29-36


Portnoy V, Benyamini Y, Bar E, Harel-Beja R, Gepstein S, Giovannoni JJ, Schaffer A a, Burger J, Tadmor Y, Lewinsohn E, et al(2008) The molecular and biochemical basis for varietal variation in sesquiterpene content in melon (Cucumis melo L.) rinds. PlantMol Biol 66: 647-61


Qin X, Coku A, Inoue K, Tian L (2011) Expression, subcellular localization, and cis-regulatory structure of duplicated phytoenesynthase genes in melon (Cucumis melo L.). Planta 234: 737-748


Robinson MD, McCarthy DJ, Smyth GK (2009) edgeR: A Bioconductor package for differential expression analysis of digital geneexpression data. Bioinformatics 26: 139-140


Sennepin AD, Charpentier S, Normand T, Sarré C, Legrand A, Mollet LM (2009) Multiple reprobing of Western blots afterinactivation of peroxidase activity by its substrate, hydrogen peroxide. Anal Biochem 393: 129-131


Shumskaya M, Bradbury LMT, Monaco RR, Wurtzel ET (2012) Plastid Localization of the Key Carotenoid Enzyme PhytoeneSynthase Is Altered by Isozyme, Allelic Variation, and Activity. Plant Cell 24: 3725-3741


Tadmor Y, Katzir N, Meir A, Yaniv-Yaakov A, Sa'ar U, Baumkoler F, Lavee T, Lewinsohn E, Schaffer A, Burger J (2007) Inducedmutagenesis to augment the natural genetic variability of melon (Cucumis melo L.). Isr J Plant Sci 55: 159-169


Tadmor Y, King S, Levi A, Davis A, Meir A, Wasserman B, Hirschberg J, Lewinsohn E (2005) Comparative fruit colouration inwatermelon and tomato. Food Res Int 38: 837-841


Tadmor Y, Larkov O, Meir A, Minkoff M, Lastochkin E, Edelstein M, Levin S, Wong J, Rocheford T, Lewinsohn E (2000) Reversed-phase high performance liquid chromatographic determination of vitamin E components in maize kernels. Phytochem Anal 11: 370-374

Pubmed: Author and TitleCrossRef: Author and Title www.plantphysiol.orgon August 11, 2019 - Published by Downloaded from

Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Maiani G%2C Cast�n MJP%2C Catasta G%2C Toti E%2C Cambrod�n IG%2C Bysted A%2C Granado%2DLorencio F%2C Olmedilla%2DAlonso B%2C Knuthsen P%2C Valoti M%2C et al %282009%29 Carotenoids%3A Actual knowledge on food sources%2C intakes%2C stability and bioavailability and their protective role in humans%2E Mol Nutr Food Res 53%3A 194%2D218&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Maiani G, Cast�n MJP, Catasta G, Toti E, Cambrod�n IG, Bysted A, Granado-Lorencio F, Olmedilla-Alonso B, Knuthsen P, Valoti M, et al (2009) Carotenoids: Actual knowledge on food sources, intakes, stability and bioavailability and their protective role in humans. Mol Nutr Food Res 53: 194-218

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Maiani&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Carotenoids: Actual knowledge on food sources, intakes, stability and bioavailability and their protective role in humans&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Carotenoids: Actual knowledge on food sources, intakes, stability and bioavailability and their protective role in humans&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Maiani&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Nisar N%2C Li L%2C Lu S%2C Khin NC%2C Pogson BJ %282015%29 Carotenoid Metabolism in Plants%2E Mol Plant 8%3A 68%2D82&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nisar N, Li L, Lu S, Khin NC, Pogson BJ (2015) Carotenoid Metabolism in Plants. Mol Plant 8: 68-82

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nisar&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Carotenoid Metabolism in Plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Carotenoid Metabolism in Plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nisar&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Obrdlik P%2C El%2DBakkoury M%2C Hamacher T%2C Cappellaro C%2C Vilarino C%2C Fleischer C%2C Ellerbrok H%2C Kamuzinzi R%2C Ledent V%2C Blaudez D%2C et al %282004%29 K%2B channel interactions detected by a genetic system optimized for systematic studies of membrane protein interactions%2E Proc Natl Acad Sci U S A 101%3A 12242%2D7&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Obrdlik P, El-Bakkoury M, Hamacher T, Cappellaro C, Vilarino C, Fleischer C, Ellerbrok H, Kamuzinzi R, Ledent V, Blaudez D, et al (2004) K+ channel interactions detected by a genetic system optimized for systematic studies of membrane protein interactions. Proc Natl Acad Sci U S A 101: 12242-7

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Obrdlik&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=K+ channel interactions detected by a genetic system optimized for systematic studies of membrane protein interactions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=K+ channel interactions detected by a genetic system optimized for systematic studies of membrane protein interactions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Obrdlik&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Park SC%2C Kim SH%2C Park S%2C Lee HU%2C Lee JS%2C Park WS%2C Ahn MJ%2C Kim YH%2C Jeong JC%2C Lee HS%2C et al %282015%29 Enhanced accumulation of carotenoids in sweetpotato plants overexpressing IbOr%2DIns gene in purple%2Dfleshed sweetpotato cultivar%2E Plant Physiol Biochem 86%3A 82%2D90&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Park SC, Kim SH, Park S, Lee HU, Lee JS, Park WS, Ahn MJ, Kim YH, Jeong JC, Lee HS, et al (2015) Enhanced accumulation of carotenoids in sweetpotato plants overexpressing IbOr-Ins gene in purple-fleshed sweetpotato cultivar. Plant Physiol Biochem 86: 82-90

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Park&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Enhanced accumulation of carotenoids in sweetpotato plants overexpressing IbOr-Ins gene in purple-fleshed sweetpotato cultivar&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Enhanced accumulation of carotenoids in sweetpotato plants overexpressing IbOr-Ins gene in purple-fleshed sweetpotato cultivar&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Park&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Pitrat M %282000%29 Some comments on infraspecific classification of cultivars of melon%2E In Proceedings of Cucurbitaceae 2000 %28eds Katzir N%2E Paris HS%29 ISHS%2C Belgium%2E Acta Hort 510%3A 29%2D36&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pitrat M (2000) Some comments on infraspecific classification of cultivars of melon. In Proceedings of Cucurbitaceae 2000 (eds Katzir N. Paris HS) ISHS, Belgium. Acta Hort 510: 29-36

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pitrat&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Some comments on infraspecific classification of cultivars of melon&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Some comments on infraspecific classification of cultivars of melon&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pitrat&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Portnoy V%2C Benyamini Y%2C Bar E%2C Harel%2DBeja R%2C Gepstein S%2C Giovannoni JJ%2C Schaffer A a%2C Burger J%2C Tadmor Y%2C Lewinsohn E%2C et al %282008%29 The molecular and biochemical basis for varietal variation in sesquiterpene content in melon %28Cucumis melo L%2E%29 rinds%2E Plant Mol Biol 66%3A 647%2D61&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Portnoy V, Benyamini Y, Bar E, Harel-Beja R, Gepstein S, Giovannoni JJ, Schaffer A a, Burger J, Tadmor Y, Lewinsohn E, et al (2008) The molecular and biochemical basis for varietal variation in sesquiterpene content in melon (Cucumis melo L.) rinds. Plant Mol Biol 66: 647-61

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Portnoy&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The molecular and biochemical basis for varietal variation in sesquiterpene content in melon (Cucumis melo L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The molecular and biochemical basis for varietal variation in sesquiterpene content in melon (Cucumis melo L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Portnoy&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Qin X%2C Coku A%2C Inoue K%2C Tian L %282011%29 Expression%2C subcellular localization%2C and cis%2Dregulatory structure of duplicated phytoene synthase genes in melon %28Cucumis melo L%2E%29%2E Planta 234%3A 737%2D748&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Qin X, Coku A, Inoue K, Tian L (2011) Expression, subcellular localization, and cis-regulatory structure of duplicated phytoene synthase genes in melon (Cucumis melo L.). Planta 234: 737-748

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Qin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Expression, subcellular localization, and cis-regulatory structure of duplicated phytoene synthase genes in melon (Cucumis melo L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Expression, subcellular localization, and cis-regulatory structure of duplicated phytoene synthase genes in melon (Cucumis melo L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Qin&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Robinson MD%2C McCarthy DJ%2C Smyth GK %282009%29 edgeR%3A A Bioconductor package for differential expression analysis of digital gene expression data%2E Bioinformatics 26%3A 139%2D140&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Robinson MD, McCarthy DJ, Smyth GK (2009) edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26: 139-140

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Robinson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=edgeR: A Bioconductor package for differential expression analysis of digital gene expression data&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=edgeR: A Bioconductor package for differential expression analysis of digital gene expression data&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Robinson&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Sennepin AD%2C Charpentier S%2C Normand T%2C Sarr� C%2C Legrand A%2C Mollet LM %282009%29 Multiple reprobing of Western blots after inactivation of peroxidase activity by its substrate%2C hydrogen peroxide%2E Anal Biochem 393%3A 129%2D131&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sennepin AD, Charpentier S, Normand T, Sarr� C, Legrand A, Mollet LM (2009) Multiple reprobing of Western blots after inactivation of peroxidase activity by its substrate, hydrogen peroxide. Anal Biochem 393: 129-131

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sennepin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Multiple reprobing of Western blots after inactivation of peroxidase activity by its substrate, hydrogen peroxide&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Multiple reprobing of Western blots after inactivation of peroxidase activity by its substrate, hydrogen peroxide&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sennepin&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Shumskaya M%2C Bradbury LMT%2C Monaco RR%2C Wurtzel ET %282012%29 Plastid Localization of the Key Carotenoid Enzyme Phytoene Synthase Is Altered by Isozyme%2C Allelic Variation%2C and Activity%2E Plant Cell 24%3A 3725%2D3741&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shumskaya M, Bradbury LMT, Monaco RR, Wurtzel ET (2012) Plastid Localization of the Key Carotenoid Enzyme Phytoene Synthase Is Altered by Isozyme, Allelic Variation, and Activity. Plant Cell 24: 3725-3741

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shumskaya&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Plastid Localization of the Key Carotenoid Enzyme Phytoene Synthase Is Altered by Isozyme, Allelic Variation, and Activity&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Plastid Localization of the Key Carotenoid Enzyme Phytoene Synthase Is Altered by Isozyme, Allelic Variation, and Activity&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shumskaya&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Tadmor Y%2C Katzir N%2C Meir A%2C Yaniv%2DYaakov A%2C Sa%27ar U%2C Baumkoler F%2C Lavee T%2C Lewinsohn E%2C Schaffer A%2C Burger J %282007%29 Induced mutagenesis to augment the natural genetic variability of melon %28Cucumis melo L%2E%29%2E Isr J Plant Sci 55%3A 159%2D169&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tadmor Y, Katzir N, Meir A, Yaniv-Yaakov A, Sa'ar U, Baumkoler F, Lavee T, Lewinsohn E, Schaffer A, Burger J (2007) Induced mutagenesis to augment the natural genetic variability of melon (Cucumis melo L.). Isr J Plant Sci 55: 159-169

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tadmor&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Induced mutagenesis to augment the natural genetic variability of melon (Cucumis melo L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Induced mutagenesis to augment the natural genetic variability of melon (Cucumis melo L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tadmor&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Tadmor Y%2C King S%2C Levi A%2C Davis A%2C Meir A%2C Wasserman B%2C Hirschberg J%2C Lewinsohn E %282005%29 Comparative fruit colouration in watermelon and tomato%2E Food Res Int 38%3A 837%2D841&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tadmor Y, King S, Levi A, Davis A, Meir A, Wasserman B, Hirschberg J, Lewinsohn E (2005) Comparative fruit colouration in watermelon and tomato. Food Res Int 38: 837-841


http://scholar.google.com/scholar?as_q=Comparative fruit colouration in watermelon and tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative fruit colouration in watermelon and tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tadmor&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Tadmor Y%2C Larkov O%2C Meir A%2C Minkoff M%2C Lastochkin E%2C Edelstein M%2C Levin S%2C Wong J%2C Rocheford T%2C Lewinsohn E %282000%29 Reversed%2Dphase high performance liquid chromatographic determination of vitamin E components in maize kernels%2E Phytochem Anal 11%3A 370%2D374&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tadmor Y, Larkov O, Meir A, Minkoff M, Lastochkin E, Edelstein M, Levin S, Wong J, Rocheford T, Lewinsohn E (2000) Reversed-phase high performance liquid chromatographic determination of vitamin E components in maize kernels. Phytochem Anal 11: 370-374


Google Scholar: Author Only Title Only Author and Title

Telfer A (2002) What is beta-carotene doing in the photosystem II reaction centre? Philos Trans R Soc Lond B Biol Sci 357: 1431-39; discussion 1439-40, 1469-70


Trapnell C, Pachter L, Salzberg SL (2009) TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25: 1105-11Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Tzuri G, Zhou X, Chayut N, Yuan H, Portnoy V, Meir A, Sa'ar U, Baumkoler F, Mazourek M, Lewinsohn E, et al (2015) A "golden"SNP in CmOr governs the fruit flesh color of melon (Cucumis melo). Plant J 82: 267-79


Walter MH, Strack D (2011) Carotenoids and their cleavage products: biosynthesis and functions. Nat Prod Rep 28: 663-692Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Yuan H, Owsiany K, Sheeja T, Zhou X, Rodriguez C, Li Y, Chayut N, Yang Y, Welsch R, Thannhauser T, et al (2015a) A Single AminoAcid Substitution in an ORANGE Protein Promotes Carotenoid Overaccumulation in Arabidopsis. Plant Physiol 169: pp.00971.2015


Yuan H, Zhang JJJ, Nageswaran D, Li L, Li L, Yuan H, Egea I, Barsan C, Bian W, Purgatto E, et al (2015b) Carotenoid metabolismand regulation in horticultural crops. Hortic Res 2: 15036


Zhong S, Joung J-G, Zheng Y, Chen Y, Liu B, Shao Y, Xiang JZ, Fei Z, Giovannoni JJ (2011) High-throughput illumina strand-specific RNA sequencing library preparation. Cold Spring Harb Protoc 2011: 940-9


Zhou X, Welsch R, Yang Y, Álvarez D, Riediger M, Yuan H, Fish T, Liu J, Thannhauser TW, Li L (2015) Arabidopsis OR proteins arethe major posttranscriptional regulators of phytoene synthase in controlling carotenoid biosynthesis. Proc Natl Acad Sci201420831.




http://scholar.google.com/scholar?as_q=Reversed-phase high performance liquid chromatographic determination of vitamin E components in maize kernels&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Reversed-phase high performance liquid chromatographic determination of vitamin E components in maize kernels&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tadmor&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Telfer A %282002%29 What is beta%2Dcarotene doing in the photosystem II reaction centre%3F Philos Trans R Soc Lond B Biol Sci 357%3A 1431%2D39%3B discussion 1439%2D40%2C 1469%2D70&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Telfer A (2002) What is beta-carotene doing in the photosystem II reaction centre? Philos Trans R Soc Lond B Biol Sci 357: 1431-39; discussion 1439-40, 1469-70

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Telfer&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=What is beta-carotene doing in the photosystem II reaction centre&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=What is beta-carotene doing in the photosystem II reaction centre&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Telfer&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Trapnell C%2C Pachter L%2C Salzberg SL %282009%29 TopHat%3A discovering splice junctions with RNA%2DSeq%2E Bioinformatics 25%3A 1105%2D11&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Trapnell C, Pachter L, Salzberg SL (2009) TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25: 1105-11

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Trapnell&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=TopHat: discovering splice junctions with RNA-Seq&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=TopHat: discovering splice junctions with RNA-Seq&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Trapnell&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Tzuri G%2C Zhou X%2C Chayut N%2C Yuan H%2C Portnoy V%2C Meir A%2C Sa%27ar U%2C Baumkoler F%2C Mazourek M%2C Lewinsohn E%2C et al %282015%29 A %22golden%22 SNP in CmOr governs the fruit flesh color of melon %28Cucumis melo%29%2E Plant J 82%3A 267%2D79&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tzuri G, Zhou X, Chayut N, Yuan H, Portnoy V, Meir A, Sa'ar U, Baumkoler F, Mazourek M, Lewinsohn E, et al (2015) A "golden" SNP in CmOr governs the fruit flesh color of melon (Cucumis melo). Plant J 82: 267-79

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tzuri&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A

http://scholar.google.com/scholar?as_q=A

http://www.ncbi.nlm.nih.gov/pubmed?term=Walter MH%2C Strack D %282011%29 Carotenoids and their cleavage products%3A biosynthesis and functions%2E Nat Prod Rep 28%3A 663%2D692&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Walter MH, Strack D (2011) Carotenoids and their cleavage products: biosynthesis and functions. Nat Prod Rep 28: 663-692

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Walter&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Carotenoids and their cleavage products: biosynthesis and functions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Carotenoids and their cleavage products: biosynthesis and functions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Walter&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yuan H%2C Owsiany K%2C Sheeja T%2C Zhou X%2C Rodriguez C%2C Li Y%2C Chayut N%2C Yang Y%2C Welsch R%2C Thannhauser T%2C et al %282015a%29 A Single Amino Acid Substitution in an ORANGE Protein Promotes Carotenoid Overaccumulation in Arabidopsis%2E Plant Physiol 169%3A pp%2E00971%2E2015&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yuan H, Owsiany K, Sheeja T, Zhou X, Rodriguez C, Li Y, Chayut N, Yang Y, Welsch R, Thannhauser T, et al (2015a) A Single Amino Acid Substitution in an ORANGE Protein Promotes Carotenoid Overaccumulation in Arabidopsis. Plant Physiol 169: pp.00971.2015

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yuan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A Single Amino Acid Substitution in an ORANGE Protein Promotes Carotenoid Overaccumulation in Arabidopsis.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A Single Amino Acid Substitution in an ORANGE Protein Promotes Carotenoid Overaccumulation in Arabidopsis.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yuan&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yuan H%2C Zhang JJJ%2C Nageswaran D%2C Li L%2C Li L%2C Yuan H%2C Egea I%2C Barsan C%2C Bian W%2C Purgatto E%2C et al %282015b%29 Carotenoid metabolism and regulation in horticultural crops%2E Hortic Res 2%3A 15036&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yuan H, Zhang JJJ, Nageswaran D, Li L, Li L, Yuan H, Egea I, Barsan C, Bian W, Purgatto E, et al (2015b) Carotenoid metabolism and regulation in horticultural crops. Hortic Res 2: 15036

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yuan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Carotenoid metabolism and regulation in horticultural crops.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Carotenoid metabolism and regulation in horticultural crops.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yuan&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhong S%2C Joung J%2DG%2C Zheng Y%2C Chen Y%2C Liu B%2C Shao Y%2C Xiang JZ%2C Fei Z%2C Giovannoni JJ %282011%29 High%2Dthroughput illumina strand%2Dspecific RNA sequencing library preparation%2E Cold Spring Harb Protoc 2011%3A 940%2D9&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhong S, Joung J-G, Zheng Y, Chen Y, Liu B, Shao Y, Xiang JZ, Fei Z, Giovannoni JJ (2011) High-throughput illumina strand-specific RNA sequencing library preparation. Cold Spring Harb Protoc 2011: 940-9

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhong&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=High-throughput illumina strand-specific RNA sequencing library preparation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=High-throughput illumina strand-specific RNA sequencing library preparation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhong&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhou X%2C Welsch R%2C Yang Y%2C �lvarez D%2C Riediger M%2C Yuan H%2C Fish T%2C Liu J%2C Thannhauser TW%2C Li L %282015%29 Arabidopsis OR proteins are the major posttranscriptional regulators of phytoene synthase in controlling carotenoid biosynthesis%2E Proc Natl Acad Sci 201420831%2E&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhou X, Welsch R, Yang Y, �lvarez D, Riediger M, Yuan H, Fish T, Liu J, Thannhauser TW, Li L (2015) Arabidopsis OR proteins are the major posttranscriptional regulators of phytoene synthase in controlling carotenoid biosynthesis. Proc Natl Acad Sci 201420831.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhou&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis OR proteins are the major posttranscriptional regulators of phytoene synthase in controlling carotenoid biosynthesis.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis OR proteins are the major posttranscriptional regulators of phytoene synthase in controlling carotenoid biosynthesis.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhou&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1


Running Title: Or reduces β-carotene turnover · has no effect on the transcript levels of...

Documents

Transcript of Running Title: Or reduces β-carotene turnover · has no effect on the transcript levels of...