Research Collection

Doctoral Thesis

Role of ECF σ factors in stress response of Bradyrhizobiumjaponicum

Author(s): Masloboeva, Nadezda

Publication Date: 2012

Permanent Link: https://doi.org/10.3929/ethz-a-007606640

Rights / License: In Copyright - Non-Commercial Use Permitted

This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.

ETH Library

  

DISS. ETH No. 20849

Role of ECF factors in stress response

of Bradyrhizobium japonicum

A dissertation submitted to the ETH Zurich

for the degree of DOCTOR OF SCIENCES

presented by NADEZDA MASLOBOEVA

Dipl. Biol., Novosibirsk State University born October 23, 1985

citizen of the Russian Federation

Prof. Dr. Hans-Martin Fischer, examiner Prof. Dr. Hauke Hennecke, co-examiner

Prof. Dr. Julia Vorholt, co-examiner Prof. Dr. Justine Collier, co-examiner

2012

 

  

Посвящается моему дедушке

к.э.н., профессору

Маслову Евгению Владимировичу

 

  

Contents

THESIS SUMMARY ............................................................................................................................. 1

RIASSUNTO DELLA TESI ................................................................................................................... 3

CHAPTER I

General introduction:

Gene regulation mediated by ECF factors and reactive oxygen species ............................................ 5

1.1 Use of alternative factors to coordinate gene expression in bacteria ................................... 6

1.1.1 Function and structure of σ factors ....................................................................................... 6

1.1.2 Diversity and common features of ECF σ factors ................................................................. 8

1.1.3 Regulation of ECF σ factors .................................................................................................. 9

1.2 Reactive oxygen species ........................................................................................................ 13

1.2.1 ROS diversity ...................................................................................................................... 13

1.2.2 Sources of ROS ................................................................................................................... 14

1.2.3 ROS-mediated protein and co-factor damage, and repair mechanisms .............................. 15

1.2.4 ROS quenching and scavenging systems ............................................................................ 19

1.3 Bacterial responses to ROS ................................................................................................... 22

1.3.1 One-component transcription factors .................................................................................. 23

1.3.2 ROS-responsive two-component regulatory systems ......................................................... 28

1.3.3 ROS-responsive 70 factors ................................................................................................ 28

1.4 ROS in the Rhizobium-legume symbiosis ............................................................................. 34

1.4.1 ROS detoxification in the Rhizobium-legume symbiosis: scavenging and antioxidant systems and their regulatory systems .................................................................................. 35

1.4.2 factors in rhizobia ............................................................................................................ 36

1.5 Aim of this work .................................................................................................................... 39

CHAPTER II

Reactive oxygen species-inducible ECF factors of Bradyrhizobium japonicum ............................. 41

2.1 Abstract.................................................................................................................................. 42

2.2 Introduction ........................................................................................................................... 43

2.3 Materials and methods ........................................................................................................... 47

2.4 Results ................................................................................................................................... 55

Transcriptional profile of B. japonicum in response to H2O2-mediated oxidative stress ...... 55

Response of ecfQ and ecfF to different ROS......................................................................... 56

 

Phenotypic characterization of deletion mutants ecfQ, (ecfF-osrA), osrA, and

(ecfQ, ecfF-osrA) ................................................................................................................ 56

The regulon of EcfQ .............................................................................................................. 58

The promoter region of ecfQ and of other genes coding for class 33 ECF σ factors is conserved ............................................................................................................................... 58

The regulon of EcfF ............................................................................................................... 61

In vivo interaction of EcfF and OsrA ..................................................................................... 64

Conserved cysteine 129 of OsrA might be required for interaction with EcfF ..................... 64

Cysteine 179 of OsrA is required for the H2O2 response of EcfF in B. japonicum ............... 66

2.5 Discussion.............................................................................................................................. 68

2.6 Supplementary material ......................................................................................................... 73

CHAPTER III

Further investigations with EcfF and OsrA .......................................................................................... 85

3.1 Abstract.................................................................................................................................. 86

3.2 Introduction ........................................................................................................................... 87

3.3 Materials and methods ........................................................................................................... 89

3.4 Results and discussion ........................................................................................................... 96

ecfF and osrA form one transcriptional unit .......................................................................... 96

Prediction of putative operons within the EcfF regulon ........................................................ 97

Microarray analysis of deletion mutants (ecfF-osrA) and osrA grown aerobically .......... 97

Further analysis of EcfF-OsrA interactions using a bacterial two-hybrid system ............... 101

Reannotation of the ecfF start codon ................................................................................... 103

Immunodetection of MetSO within proteins ....................................................................... 104

Expression of His-tagged EcfF in E. coli ............................................................................ 106

Attempts to immunodetect EcfF and OsrA with anti-peptide sera ...................................... 107

3.5 Supplementary material ....................................................................................................... 108

CHAPTER IV

EcfG-NepR-PhyR signalling cascade:

In search for functions of target genes and a sensory kinase .............................................................. 117

4.1 Abstract................................................................................................................................ 118

4.2 Introduction ......................................................................................................................... 119

4.3 Materials and methods ......................................................................................................... 122

4.4 Results ................................................................................................................................. 128

Bioinformatic analysis of the proteins encoded in the bll/r1465-69 cluster ........................ 128

  

Genes of the bll/r1465-59 cluster are not required for symbiosis but are involved in the stress response of B. japonicum ........................................................................................... 129

Biochemical analysis of Blr1461 ......................................................................................... 131

4.5 Discussion............................................................................................................................ 133

4.6 Supplementary material ....................................................................................................... 135

CHAPTER V

Future perspectives ............................................................................................................................. 137

5.1 Oxidative stress response in B. japonicum .......................................................................... 138

5.2 EcfG-NepR-PhyR regulatory cascade ................................................................................. 140

Genes contributing to the phenotype of the ecfG and phyR deletion strains .................. 140

Function of the putative histidine kinase Blr1461 ............................................................... 140

REFERENCES ................................................................................................................................... 141

CURRICULUM VITAE & PUBLICATIONS ................................................................................... 165

ACKNOWLEDGEMENTS ................................................................................................................ 167

 

 

 1 

THESIS SUMMARY

Living organisms including bacteria are constantly challenged by changes in environmental

conditions. Bacteria adapt to these fluctuations by altering gene expression using a wide set

of regulatory mechanisms. One of the possible ways to achieve coordinated expression of

entire sets of genes is the use of alternative factors which determine promoter specificity of

the RNA polymerase (RNAP) holoenzyme. Extracytoplasmic function (ECF) σ factors

belong to this class of regulators. They are required for RNAP to recognize promoters

associated with genes which are involved in many different tasks, including stress responses,

metal homeostasis, virulence-related traits, and maintenance of cell envelope structure. The

genome of Bradyrhizobium japonicum, the nitrogen-fixing soybean endosymbiont, encodes

17 predicted ECF factors. This work aimed at unraveling the functions of ECF factors in

B. japonicum, identifying mechanisms regulating their activity, and their target genes.

The first part of this thesis deals with the oxidative stress response of B. japonicum and the

role played by two ECF factors, EcfQ and EcfF, in this process. Mutant analysis showed

that both factors are required for tolerance to singlet oxygen under free-living conditions

but not for an effective symbiosis. Potential target genes of EcfQ and EcfF were determined

by microarray analyses. These data disclosed that each of the two ECF factors controls a

distinct, rather small set of genes. While functions of the genes within the EcfQ-regulon are

largely unknown, EcfF directs transcription of a group of three methionine sulfoxide

reductase genes. Moreover, the activity of each of these factors is controlled by different

mechanisms. We show that EcfF is auto-regulated via an EcfF-dependent promoter and

negatively regulated via interaction with its cognate anti- factor OsrA whose gene is

cotranscribed with ecfF. In this work, two cysteine residues required for proper function of

OsrA were identified.

Expression of ecfQ and genes coding for paralogous class-33 ECF factors, to which EcfF

belongs, is probably controlled by an as yet unidentified transcription factor because putative

promoter regions of these genes share a remarkable degree of sequence similarity. Since no

cognate anti- factor gene is associated with ecfQ, the mechanism(s) regulating EcfQ activity

remains unclear.

The second part of this work is dedicated to the further characterization of the general stress

response in B. japonicum. As shown in previous studies, and similar to other -

Thesis summary

 2 

proteobacteria, the general stress response in B. japonicum involves ECF factor EcfG

controlled by a partner-switching mechanism involving the anti- factor NepR and the anti-

anti- factor PhyR. Using deletion mutants and phenotypic assays, it was shown that PhyR

and EcfG are required for stress responses and symbiotic interactions with various host

plants. Microarray analysis revealed that PhyR and EcfG control highly congruent regulons

with a large portion of genes of unknown function. In this work, we deleted a cluster of five

functionally undefined genes which are organized in two divergently oriented operons,

bll1467-65 and blr1468-69, and transcribed in an EcfG-dependent manner. The resulting

mutant strain is more sensitive to elevated temperature and UV exposure than the wild type,

yet still symbiotically proficient. Thus the PhyR/EcfG regulon probably can be subdivided in

genes whose products are crucial for free-living stress conditions, symbiosis or both. Finally,

analysis of a putative histidine kinase, Blr1461, which might be involved in PhyR-/NepR-

mediated signalling to EcfG is described. However, repeated attempts to construct a deletion

mutant in the blr1461 gene were unsuccessful, implying that Blr1461 might be an essential

protein. Attempts to document autophosphorylation of purified Blr1461 variants have failed,

rendering its function as a kinase questionable.

 

 3 

RIASSUNTO DELLA TESI

Gli organismi viventi, batteri inclusi, sono costantemente sottoposti a cambiamenti delle

condizioni ambientali. I batteri si adattano a queste variazioni usando una serie di proteine

regolatrici che alterano l’espressione genica. L’uso di fattori alternativi, determinanti la

specificità dell’oloenzima RNAP per un promotore, è uno dei possibili modi per ottenere il

coordinamento nell’espressione di un intero set di geni. I fattori con funzione

extracitoplasmatica (ECF) appartengono a questo tipo di regolatori, e sono necessari per la

trascrizione di geni coinvolti in svariati processi, come risposta allo stress, omeostasi dei

metalli, virulenza e mantenimento del rivestimento cellulare. Nel genoma di Bradyrhizobium

japonicum, l’azoto-fissatore endosimbionte della soia, sono codificati 17 possibili fattori

ECF.

Lo scopo di questo lavoro è la determinazione della funzione di fattori ECF,

l’identificazione dei meccanismi che ne controllano l’attività e l’individuazione dei loro

bersagli genici in B. japonicum.

L’oggetto della prima parte di questa tesi è la risposta allo stress ossidativo da parte di

B. japonicum e il ruolo ricoperto da due fattori ECF: EcfQ e EcfF. L’analisi di ceppi

mutanti per questi geni ha rilevato che entrambi i fattori sono necessari per la resistenza

all’ossigeno singoletto, ma non durante la simbiosi. I bersagli di EcfQ e EcfF sono stati

identificati tramite microarray. Entrambi i fattori controllano un distinto e piuttosto limitato

set di geni, per la maggior parte a funzione ignota per quanto riguarda il regolone di EcfQ. Al

contrario, EcfF controlla la trascrizione di un ipotetico sistema di metionina solfossido

reduttasi. Inoltre la funzione dei due fattori è modulata da meccanismi differenti. EcfF è sia

autoregolato che negativamente regolato dall’interazione con l’anti-fattore OsrA, il cui

gene è co-trascritto con ecfF. La funzionalità di OsrA dipende da due cisteine, identificate in

questo studio. Diversamente, l’espressione di ecfQ e di altri geni codificanti fattori ECF di

classe 33 (alla quale appartiene anche EcfF) è verosimilmente controllata da un fattore di

trascrizione ignoto, dal momento in cui la putativa regione del promotore di questi geni è

marcatamente conservata. Poiché non vi è un anti-fattore geneticamente associato a ecfQ, il

suo meccanismo di regolazione resta ignoto.

La seconda parte di questo lavoro riguarda un’ulteriore caratterizzazione della risposta allo

stress generale da parte di B. japonicum. Come indicato in precedenza, la risposta allo stress

Riassunto della tesi

 4 

generale in quest’organismo, così come in altri -proteobatteri, include il fattore ECF

EcfG, la cui attività è controllata dall’anti-fattore NepR e dall’anti-anti-fattore PhyR.

Tramite lo studio di ceppi mutanti e saggi fenotipici è stato possibile dimostrare che PhyR e

EcfG sono necessari per la risposta allo stress e per lo sviluppo della simbiosi con diverse

piante. I regoloni di PhyR e EcfG, analizzati attraverso microarray, sono sovrapponibili e

includono molti geni a funzione ignota. Un cluster di cinque geni organizzati in due operoni

con orientamento opposto e appartenente al regolone condiviso, bll/r1465-69, è stato

selezionato per una mutagenesi. Il ceppo mutante si è rilevato più sensibile al caldo e ai raggi

UV del wild type, ma comunque simbioticamente attivo. Il regolone PhyR/EcfG può dunque

essere suddiviso in geni coinvolti nella resistenza allo stress in assenza di simbiosi, nella

simbiosi o in entrambi i casi. Per finire, è riportata l’analisi di una putativa istidina chinasi,

Blr1461, probabilmente coinvolta nella modulazione di EcfG mediata da PhyR/NepR.

Diversi tentativi di creare un mutante di delezione per questo gene sono falliti, suggerendone

l’essenzialità. Inoltre esperimenti mirati alla documentazione di una possibile

autofosforilazione di Blr1461 hanno avuto esito negativo, indicando una possibile funzione

alternativa della proteina.

  

CHAPTER I General introduction:

Gene regulation mediated by ECF factors and reactive oxygen species

CHAPTER I

 6 

1.1 Use of alternative factors to coordinate gene expression in bacteria

In order to cope with changing environmental conditions bacteria must adapt their

physiology. Typically, this process involves detection of a signal and its transduction to the

level of gene expression. One of the possible ways to achieve coordinated expression of

entire sets of genes in bacteria is the use of specific promoters recognized by specialized

variants of RNA polymerase (RNAP). factors determine promoter specificity of RNAP

holoenzyme, i.e., genes (operons) associated with the same promoter type can be coordinately

transcribed when the respective σ factor is available in an active form. In the following

sections, the current knowledge about structure, function and regulation of bacterial σ factors

along with their diversity and distribution among bacterial species is summarized.

1.1.1 Function and structure of σ factors

To recognize promoters and initiate specific transcription, bacterial RNAP core enzyme

requires transient association with the σ subunit to form RNAP holoenzyme. DNA melting

around the transcription start site leads to open complex formation by RNAP holoenzyme and

initiation of transcription. According to the traditional view, the σ factor dissociates from the

complex when about 10 nucleotides have been transcribed, and the core RNAP continues to

synthesize RNA. More recently it was proposed that the RNAP-σ complex may persist

through multiple rounds of transcription (Mooney et al., 2005).

Bacterial σ factors can be divided into two structurally and functionally distinct groups, the

σ54 and the σ70 group (Wösten, 1998). Transcription by RNAP containing σ54 is initiated from

promoters that show high conservation around the 24 and 12 positions relative to the

transcription initiation site and always requires an enhancer-binding protein (EBP) and ATP

hydrolysis (for reviews, see Ghosh et al., 2010; Bush and Dixon, 2012). Interaction of the

EBP with σ54-associated RNAP holoenzyme is enabled by binding of the EBP to the

upstream activator DNA sequence (usually situated around 100 bp upstream of the

transcription initiation site) and DNA looping. Transition of closed to open transcription

complex requires ATP hydrolysis by the EBP and results in melting of the DNA strands

surrounding the transcription start site. Many genes involved in nitrogen fixation in rhizobia

and other diazotrophs are preceded by 24/12-type promoters and thus transcribed by

RNAP associated with σ54.

General information

 7 

σ factors of the σ70-type are more widely spread among bacteria and comprise two to four

conserved domains (Gruber and Gross, 2003; Paget and Helmann, 2003). Extensive analysis

of σ70-type factors has revealed the roles of different domains in promoter recognition and

initiation of transcription (Fig. 1.1A). Four interactions between promoter DNA and σ70-

factor domains were described (for review, see Paget and Helmann, 2003; Österberg et al.,

2011). Briefly, the most prominent σ70-promoter recognition elements are the elements

around the 35 and 10 positions relative to the transcription initiation site that are contacted

by the σ4 and σ2 domains of σ70 factors, respectively. Subregion 1.2 within σ1 domain can

provide promoter contacts through a discriminatory DNA sequence downstream of the 10

promoter element (Haugen et al., 2008). Additionally, subregion 3.0 within σ3 domain can

interact with a 10 promoter extension (Barne et al., 1997; Murakami et al., 2002).

Fig. 1.1. 70 factor domains and their functions (A), and classification of 70 factors based on domain architecture (B). Roles of the conserved subregions within the σ1, σ2, σ3, and σ4 domains are highlighted (for details, see text). NCR indicates the location of a nonconserved region. Consensus sequences for the 35 hexamer (35 to 30), the extended 10 element (Ext.; 15 to 13), the 10 hexamer (12 to 7), and discriminator DNA (6 to 1, with an optimal GGG at 6 to 4) are indicated relative to the transcriptional start site (+1). B. See text for the explanations. Modified from Paget and Helmann, 2003; Österberg et al., 2011.

Four distinct subgroups of σ70 factors can be defined based on structural and functional

features (Fig. 1.1B). factors of groups 1 and 2 include the largest σ factor proteins (ca. 70

kDa) that possess all four conserved domains. While group 1 includes essential primary σ

factors, group 2 and the other two groups (3 and 4) include alternative σ factors which may or

may not be essential for certain bacterial processes. RpoD and RpoS σ factors of Escherichia

coli are the classical examples of group-1 and group-2 σ factors, respectively.

factors of group 3 are significantly smaller in size (ca. 20-35 kDa) than those belonging to

groups 1 and 2 because they lack domain σ1 (Fig. 1.1B). Members of this group direct

various cellular functions, such as sporulation, heat shock protection, flagella biosynthesis,

and can be further divided into subgroups according to their functions. Prominent examples

CHAPTER I

 8 

of group 3 are the E. coli heat shock σ factor RpoH, and the E. coli FliA σ factor directing

transcription of flagella and chemotaxis genes (Grossman et al., 1984; Chen and Helmann,

1992).

The largest group among σ70-type factors, group 4, comprises small σ factors (ca. 20-25 kDa)

with conserved domains σ4 and σ2, and therefore providing contacts with 35 and 10

promoter elements only (Fig. 1.1). Group-4 σ factors are highly diverse with regard to

function and amino acid sequence. Many σ factors of this group respond to signals from the

extracytoplasmic compartment and members of group 4 are therefore referred to as

extracytoplasmic function (ECF) σ factors. ECF σ factors transcriptionally control genes

involved in different cellular functions, such as stress responses, metal homeostasis,

virulence-related traits, and cell envelope structure. The number of ECF σ factors varies

widely among bacterial species. For example, bacteria from the Chlamydiae phylum or

Borrelia genus do not possess genes encoding this type of σ factor, Staphylococcus spp.

genome encodes one, E. coli two, B. subtilis seven, Mycobacterium tuberculosis ten,

Caulobacter crescentus thirteen, Pseudomonas aeruginosa eighteen, and Streptomyces

coelicolor fifty ECF σ factors (Helmann, 2002; Staroń et al., 2009). ECF σ factors are the

main topic of this work and will therefore be described in further detail in the following

sections.

1.1.2 Diversity and common features of ECF σ factors

Apart from the common structural organization, most ECF σ factors share four features

(Staroń et al., 2009; Österberg et al., 2011). Firstly, σ factors in complex with RNAP often

transcribe their own gene and thus create a positive feedback loop. Secondly, ECF σ factors

control relatively small regulons (dozens of genes usually). Thirdly, the activity of ECF σ

factors is often controlled negatively via protein-protein interaction with an anti-σ factor.

Usually, in the absence of stimuli, a σ factor is bound to its cognate anti-σ factor, which keeps

the σ factor unable to bind RNAP. Upon appropriate stimuli, the σ factor is released from the

σanti-σ factor complex. Fourthly, genes coding for σ and anti-σ factors often form an operon

and are thus tightly co-regulated.

Considering the diversity of ECF factors, the current knowledge of ECF σ factors is still

poor. A recent bioinformatics analysis of ECF σ factors retrieved from sequenced bacterial

genomes identified more than 40 distinct classes of ECF σ factors based on their sequence

similarity and domain structure of associated anti-σ factors (Staroń et al., 2009). Authors

General information

 9 

demonstrate that ECF σ factors are widely present in bacterial species and have similar

domain architecture, while anti-σ factors show a surprising diversity. Many (but not all) anti-

σ factors consist of a cytoplasmic portion that mediates σ factor inhibition and of an inner

membrane or periplasmic domain that can sense extracytoplasmic signals. Great diversity of

anti-σ factors makes it possible to sense various stimuli and to transfer the signals to the

corresponding σ factors.

1.1.3 Regulation of ECF σ factors

Apart from the transcriptional regulation of their own genes, ECF σ factors are often

negatively controlled by anti-σ factors. Thus, factors are bound to their cognate anti-σ

factors under non-stressed conditions and released in response to appropriate stimuli by one

of several mechanisms (Fig. 1.2). The most common known mechanisms are (i) a degradation

of the anti-σ factor (Fig. 1.2A), (ii) a conformational change in the anti-σ factor (Fig. 1.2B),

or (iii) a partner switching mechanism, whereby interaction of the anti-σ factor with an anti-

anti-σ factor triggers the release of the σ factor. The anti-anti-σ factor becomes available for

anti- factor binding upon phosphorylation by yet poorly defined kinases which may respond

to stress stimuli (Fig. 1.2C) (Ellermeier and Losick, 2006; Francez-Charlot et al., 2009; for

reviews, see Staroń and Mascher, 2010; Ho and Ellermeier, 2011).

Examples of σ factor release via degradation of the anti- factor are the σE-RseA pair of E.

coli and σW-RsiW of B. subtilis. In E. coli, upon perception of a “misfolded-protein” signal

by the periplasm-exposed domain of the DegS protease, RseA-mediated inhibition of σE is

relieved by sequential proteolytic degradation of RseA by DegS, the intramembrane RseP,

and the cytoplasmic ClpXP proteases (for reviews, see Raivio and Silhavy, 2001; Brooks and

Buchanan, 2008). Similarly, the RsiW transmembrane anti-σ factor of B. subtilis is degraded

upon various stimuli such as alkaline shock, salt shock, phage infection and certain

antibiotics that affect cell wall biosynthesis through intramembrane proteolysis by RasP.

After RasP-clipped RsiW is detached from the membrane it becomes a target of the

cytoplasmic ClpXP protease (Schöbel et al., 2004; Heinrich and Wiegert, 2006; Zellmeier et

al., 2006; Heinrich et al., 2009).

Many annotated anti-σ factors contain a zinc-binding anti-σ (ZAS) domain. Their cognate

factors are usually involved in oxidative stress response. Oxidative stress is sensed directly by

the anti-σ factor through amino acid residues coordinating the zinc cofactor. Oxidation of

cysteine residues leads to the formation of a disulfide bond or modification of side chains of

CHAPTER I

 10 

other amino acids. As a consequence, the anti-σ factor changes its conformation, releasing its

cognate σ factor, which then interacts with RNAP (Fig. 1.2B).

Fig. 1.2. Mechanisms of ECF-dependent signal transduction. See text for the explanations. Modified from Staroń and Mascher, 2010.

Best characterized -anti- pairs comprising anti- factors with a ZAS domain are the SigR-

RsrA pair of S. coelicolor (Li et al., 2002; Li et al., 2003; Bae et al., 2004; Jung et al., 2011),

RpoE-ChrR of Rhodobacter sphaeroides (Newman et al., 2001; Anthony et al., 2004;

Greenwell et al., 2011) and SigL-RslA of M. tuberculosis (Thakur et al., 2010). They are

described in more detail in section 1.3.3 together with other ECF σ factors involved in the

oxidative stress response.

General information

 11 

The partner switching mechanism to control ECF σ factors was first proposed for

Methylobacterium extorquens as a mechanism to regulate the general stress response in

-proteobacteria (Fig. 1.2C; Francez-Charlot et al., 2009). Briefly, under non-stressed

conditions ECF σ factor EcfG is bound to its anti-σ factor NepR. The third player in this

cascade is the anti-anti- factor PhyR, a protein harboring a factor-like domain of the ECF

type linked to a receiver domain of a response regulator. Upon stimuli, a histidine kinase,

identified so far only in the homologous system of C. crescentus (PhyK; Lourenço et al.,

2011), presumably phosphorylates the response regulator domain of PhyR, which then binds

NepR and thus releases EcfG to transcribe target genes. Of notice, no phosphorylation of

PhyR by PhyK has been shown to date. Similar regulatory systems were characterized in

Bradyrhizobium japonicum (Gourion et al., 2009), Sinorhizobium meliloti (Bastiat et al.,

2010), C. crescentus (Lourenço et al., 2011) and Sphingomonas sp. (Kaczmarczyk et al.,

2011). Although in all these systems homologs of the ECF σ factor, NepR and PhyR are

present, phosphorylation of PhyR and its orthologs might occur via distinct mechanisms in

these organisms (Anne Francez-Charlot, personal communication). For further details, see

Chapter IV of this thesis.

Yet a different mechanism was found to control the activity of E. coli ECF σ factor FecI in

response to the environmental iron concentration. In the presence of the ferric siderophore

complex iron-citrate, the FecA-TonB-ExbDB system activates FecI via FecR which spans the

inner membrane. In contrast to classical σ-anti-σ pairs described to date, FecR is required for

full activity of FecI and for FecI-RNAP interaction (Fig. 1.2D; for a review, see Brooks and

Buchanan, 2008).

Novel anti-σ factor domains and combinations thereof were identified by bioinformatics

analysis (Staroń et al., 2009). Some yet uncharacterized anti-σ factors harbor various domains

of unknown function (DUF) (Fig. 1.2E), span the cytoplasmic membrane with six helices, are

generally associated with genes encoding proteins with various activities (serine/threonine

kinases, cytochrome c oxidases, metallophosphoesterase, catalases, etc.), or have long C-

terminal extensions. Regulatory mechanisms utilized by these anti-σ factors remain to be

discovered. In this work, an attempt was made to unravel the mechanism of σ factor

regulation by a cognate anti-σ factor which comprises predicted transmembrane domains

(Chapters II and III).

Not every ECF σ factor is associated with and regulated by an anti-σ factor, though the

second statement is difficult to prove (Staroń et al., 2009). For example, no anti-σ factor has

CHAPTER I

 12 

been found for the SigE σ factor of S. coelicolor and it is believed that SigE is regulated at

the transcriptional level by the CseCB system (Fig. 1.2F). CseC is a histidine kinase localized

within the cytoplasmic membrane. After envelope stress is perceived, CseC phosphorylates

CseB, its cognate response regulator, and it, in turn, induces transcription of sigE (Hong et

al., 2002). Thus, features of a two-component regulatory system are combined here with an

ECF σ factor.

General information

 13 

1.2 Reactive oxygen species

Key biological processes such as respiration and defense response are dependent on

molecular oxygen (O2). A consequence of the use of O2 is the formation of reactive oxygen

species (ROS), which almost all bacteria encounter as an environmental or endogenous cue

and against which even anaerobes have evolved defense mechanisms.

1.2.1 ROS diversity

Molecular oxygen contains two unpaired, spin-aligned electrons in its outer p molecular

orbitals (Fig. 1.3). Such orbital occupancy makes O2 able to accept electrons or energy.

Fig. 1.3. Types of reactive oxygen species. Electron or energy transfer events generate the two main types of reactive oxygen species. The figure shows the changes in occupancy of the outer p orbitals of molecular oxygen (O2) during the formation of these reactive oxygen species: H2O2, hydrogen peroxide; 1O2, singlet oxygen; O2

, superoxide anion; OH, hydroxyl radical. Modified from Ziegelhoffer and Donohue, 2009.

Accordingly, there are two classes of ROS, created through either electron (type I) or energy

transfer (type II) reactions (Fig. 1.3; for review, see Cadenas, 1989; Ziegelhoffer and

Donohue, 2009). A one-electron reduction of O2 results in the formation of a superoxide

anion radical (superoxide, O2). Further reduction by the transfer of a second electron

produces a peroxide anion (O22) which exists in biological systems as hydrogen peroxide

CHAPTER I

 14 

(H2O2). In turn, H2O2 reacts with iron ions (Fe2+) in the Fenton reaction (Equation 1) which

results in hydroxyl radical (OH) production.

Fe2+ + H2O2 Fe3+ + OH + OH (1)

Reactions of the second type produce singlet oxygen (1O2) as a result of energy transfer to O2

(Fig. 1.3).

Different ROS have distinct properties such as chemical reactivity, half-life and solubility

(Halliwell and Gutteridge, 1999). For instance, the most and least reactive among ROS are

hydroxyl radicals and superoxide, respectively. Of all ROS, only superoxide does not

penetrate membrane bilayers due to its negative charge. Although in biological systems it is

difficult to discriminate between effects caused by different ROS due to their

interchangeability, some rather specific effects could be assigned to the individual ROS. They

are discussed further below.

1.2.2 Sources of ROS

ROS are mainly formed by accident when electrons or energy is transferred to O2 instead of a

target molecule or a desired protein complex. Alternatively, ROS are produced due to

univalent reduction of O2. Thus, the main source of O2 and H2O2 is the respiratory chain

where primary sources of electron leakage are the flavin dehydrogenases, ubiquinone and

cytochrome c oxidases (Imlay, 2003). Hydroxyl radicals are formed due to the Fenton

reaction catalyzed by the heme iron in cytochromes and cytochrome oxidases.

By contrast, the main source of singlet oxygen is the photosynthetic apparatus where it is

generated in photosystem II as a side product by energy transfer from excited triplet-state

chlorophyll pigments to O2. Alternatively 1O2 can also be produced as a result of energy

transfer from excited photosensitizers, natural (phytoalexins, furanocoumarins, extended

quinones, etc.; Arnason et al., 1983) or synthetic compounds (rose bengal, methylene blue)

that undergo photoexcitation followed by energy transfer to molecular oxygen and other

molecules. Moreover, 1O2 is also produced in natural waters by the exposure of chromophoric

dissolved organic matter to light (Latch and McNeill, 2006).

A mixture of ROS is generated deliberately in numerous biological processes. Among them is

the respiratory burst by stimulated phagocytes which generate ROS via NADH oxidase.

Recently, an analogous process was described during the initial steps of plant-microbial

General information

 15 

interactions (for a review, see Nanda et al., 2010). Apart from biological processes, various

ROS are produced by near UV irradiation.

1.2.3 ROS-mediated protein and co-factor damage, and repair mechanisms

ROS are able to damage all macromolecules in a cell. Protein and co-factor oxidations are of

particular interest because they are the most prominent and immediate damages caused by

ROS exposure. Moreover, mainly through protein oxidation bacterial cells sense oxidative

stress and are able to induce an adequate response.

Oxidation of iron-sulfur clusters

Iron-sulfur (Fe-S) clusters are the most sensitive towards oxidation among protein co-

factors. For a number of proteins such as dihydroxy-acid dehydratase, aconitase B, fumarases

A and B of E. coli it has been shown that univalent oxidation of these enzymes by superoxide

leads to the loss of a catalytic iron atom (Equations 2 and 3; Flint et al., 1993).

4Fe-4S2+ + O2 + 2H+ 4Fe-4S3+ + H2O2 (2)

4Fe-4S3+ 3Fe-4S1+ + Fe2+ (3)

Superoxide is the strongest oxidizer of Fe-S clusters among ROS with an oxidation rate that

is almost only diffusion limited (up to 106 M-1 s-1) due to its high electrostatic attraction to the

catalytic iron atom (Imlay, 2008). Thus, iron-sulfur clusters are the main cellular targets of

O2-mediated toxicity (Imlay, 2003). Hydrogen peroxide is also able to oxidize Fe-S

clusters, but with a lower estimated rate constant of 104 M-1 s-1 (Imlay, 2008). The difference

between O2 and H2O2 reactivity towards Fe-S clusters is used by organisms as a sensing

mechanism to rather specifically detect oxidative stress caused by O2, e.g. via the well-

studied SoxRS system of E. coli as an example (described in section 1.3.1).

No specific mechanisms or enzymes involved in the repair of oxidized iron-sulfur clusters

have been described yet. Studies in E. coli and Salmonella have shown that YtfE and YggX,

respectively, are involved in the repair process (Gralnick and Downs, 2001; Justino et al.,

2007) but the biochemical activities of both proteins remain unclear. In order to cope with

this type of oxidation, cells induce iron-sulfur cluster biogenesis and assembly machinery

which includes Isc- and Suf-type proteins. Additionally, for fumarase and aconitase,

induction of oxidant-resistant isozymes under O2-mediated stress has been shown (Liochev

and Fridovich, 1992; Cunningham et al., 1997).

CHAPTER I

 16 

Oxidation of cysteine residues

Hydrogen peroxide and 1O2 are able to oxidize protein cysteine residues (Cys), though the

overall oxidation rate is difficult to determine as reactivity of Cys depends on their local

environment and ionization state. Thus, solvent-exposed residues are faster oxidized, and

thiolate anions (R-S) are far more reactive than thiol groups (R-SH). Oxidation of a Cys

residue by H2O2 or 1O2 results in formation of sulfenic acid (R-SOH) (Fig. 1.4; Rhee et al.,

2000; Davies, 2003). Sulfenic groups are highly reactive, and often further condense with

another thiol group forming an inter- or intramolecular disulfide bound, or a sulfenamide

when condensed with nitrogen (Salmeen et al., 2003; van Montfort et al., 2003).

Alternatively, sulfenic acid could be further oxidized to sulfinic (R-SO2H) and sulfonic (R-

SO3H) acids (Fig. 1.4).

Fig. 1.4. Cysteine oxidation products. Sulfur-mediated nucleophilic attack of the peroxide OO bond by the Cys thiol group (RSH) leads to H2O release and formation of sulfenic acid (RSOH). RSOH is highly reactive, its stability being influenced by the availability of a proximal R’SH groups with which it can condense to form a disulfide bond, or by availability of a proximal nitrogen (R’NH2) to form a sulfenamide (RSNHR’) or by the presence of H2O2, which further oxidizes it to form sulfinic (RSO2H) or sulfonic (RSO3H) acid. Modified from D'Autréaux and Toledano, 2007.

Oxidized Cys residues forming a disulfide bond can be reduced by the activity of either

thioredoxin (Trx) or glutaredoxin (Grx) which catalyze a fast and reversible thiol-disulfide

exchange between Cys residues of their active sites and Cys residues of a disulfide bond. In

turn, Trx and Grx are re-reduced by NADPH-dependent Trx or glutathione (GSH) reductases.

Similarly, sulfenic acid adducts can be reduced by either of the activities when a sulfenic acid

intermediate has formed a disulfide bond, or by GSH when a S-glutathionylation adduct has

formed, which is then reduced by Grx.

The E. coli genome encodes two Trx and four Grx proteins which in part can substitute for

one another (Aslund and Beckwith, 1999; Fernandes et al., 2005; for reviews, see Arnér and

Holmgren, 2000; Meyer et al., 2009) plus a single Trx reductase and two Grx reductases. In

General information

 17 

contrast to the multitude of enzymes taking care of the redox state of cysteines in E. coli, only

one cytoplasmic Trx (TrxA) and a Trx reductase have been functionally characterized in B.

subtilis to date (Chen et al., 1989; Scharf et al., 1998; Smits et al., 2005). Attempts to

construct a deletion mutant in trxA failed, and a strain with an artificially inducible trxA gene

was demonstrated to stop growth in the absence of inducer. Thus, trxA was considered to be

essential for B. subtilis vital functions (Scharf et al., 1998; Kobayashi et al., 2003) despite the

presence of six genes encoding Trx-like proteins in the B. subtilis genome (Kunst et al.,

1997). Reversible Cys oxidation with disulfide bond formation is broadly implemented

among transcriptional regulators as a rather H2O2-specific oxidative stress-sensing

mechanism. Examples are OxyR of E. coli and OhrR of B. subtilis described in section 1.3.1.

Oxidation of methionine residues

Methionine (Met) residues are oxidized by H2O2 and 1O2 to Met-sulfoxide (MetSO) which

may be oxidized further to Met-sulfone. Due to chirality of the sulfur atom in MetSO, two

enantiomers of MetSO can be formed upon oxidation (Fig. 1.5A).

Fig. 1.5. Mathionine sulfoxides and methionine sulfoxide reductases. A. Oxido-reduction cycle of methionine. Modified from Ezraty et al., 2005. B. Electron flow pathways for the electron supply of methionine sulfoxide reductases in the cytoplasm and periplasm. The periplasmic pathway is based on the MetSO detoxification system of Neisseria gonorrhoeae, and cytoplasmic pathways on E. coli MetSO detoxification system Ezraty et al., 2004; Brot et al., 2006. NT symbolizes a Trx-like domain.

CHAPTER I

 18 

Oxidation to Met-sulfone is irreversible while Met may be restored in most organisms from

MetSO by two methionine sulfoxide reductases (MsrA/B), one for each enantiomer (Fig.

1.5A). Remarkably, MsrA and MsrB share homology neither at the amino acid sequence

level nor at the structural level (Kauffmann et al., 2002; Lowther et al., 2002). Yet, MsrA and

MsrB proteins are well conserved among eubacteria, archea and eukaryotes, suggesting a

very old origin and an important cellular function (Ezraty et al., 2005; Zhang and Weissbach,

2008). The number of paralogs, genetic organization and cellular localization of MsrA/B

varies highly among organisms. For instance, E. coli contains one copy of each of the msrA

and msrB genes which constitute two separate transcription units, and the respective products

are located in the cytoplasm. In B. subtilis, msrA and msrB genes form an operon, and protein

products are localized in cytoplasm. In Neisseria gonorrhoeae and Helicobacter pylori, msrA

and msrB are translationally fused and the resulting polypeptide in N. gonorrhoeae is

membrane anchored with Msr domains facing the periplasm while in H. pylori it is secreted

to the extracellular space. Notably, the human genome and Arabidopsis thaliana contain one

and five msrA orthologs plus three and nine msrB orthologs, respectively (Kryukov et al.,

2002; Rodrigo et al., 2002).

The function of MsrA/B proteins requires electrons usually delivered by Trx (Fig. 1.5B;

Ezraty et al., 2004). When MsrA/B is located in the periplasm, transfer of electrons from Trx

across the membrane is carried out by DsbD-like proteins (Fig. 1.5B; Krupp et al., 2001; Brot

et al., 2006). It has been reported that expression of the MsrA/B system is often not under the

control of transcription factors typically responding to oxidative stress (e.g. OxyR, SoxRS),

but instead is regulated via ECF factors in several bacteria (Ezraty et al., 2005; Gunesekere

et al., 2006; Hopman et al., 2010).

Oxidation of other amino acid residues

Apart from Cys and Met residues, 1O2 (but not other ROS) is able to oxidize histidine (His),

tryptophane (Trp) and tyrosine (Tyr) residues which leads to formation of various oxidized

derivatives (for review, see Wright et al., 2000; Wright et al., 2002; Davies, 2003; Clennan et

al., 2005). Oxidation of these amino acids is irreversible and as a response cells overexpress

peptide degradation and de novo synthesis machineries. It was proposed that oxidation of His

residues coordinating zinc in ChrR anti- factor of R. sphaeroides leads to release of cognate

RpoE -factor (Greenwell et al., 2011). This regulatory system is discussed in section 1.3.3.

General information

 19 

1.2.4 ROS quenching and scavenging systems

Various ROS detoxifying systems were developed by organisms because of the high

reactivity of ROS with biomolecules. Electron excess in O2 and H2O2 is scavenged by a

number of enzymes whereas energy excess in 1O2 is quenched by various chemical

compounds.

Superoxide is scavenged mainly by superoxide dismutases (SOD) commonly found in both

the cytoplasm and periplasm of bacteria, as O2 does not easily penetrate the membrane

bilayer (Lynch and Fridovich, 1978; Korshunov and Imlay, 2002). SODs convert O2 into

H2O2 with the release of molecular oxygen (Equation 4).

2O2 + 2H+ H2O2 + O2 (4)

Based on the identity of the bound metal cofactors, SODs are classified into three distinct

families. Proteins from different families are unrelated in the primary amino acid sequence

and thus represent a striking example of convergent evolution (Raymond, 2009). SODs use

(1) manganese or iron (Mn/Fe-SOD) as the metal cofactor, (2) copper for catalysis and also

bind a structural zinc atom (CuZnSOD), or in rare cases (3) nickel (NiSOD). In two recent

reviews the differences in the catalytic mechanisms along with the advantages and

disadvantages of different metals as SOD cofactors are summarized (Aguirre and Culotta,

2012; Miller, 2012). Presence and subcellular localization of different SODs varies greatly

between bacterial species. For instance, the E. coli genome encodes two cytoplasmic

Mn/Fe-SODs and a periplasmic CuZnSOD, whereas S. coelicolor A3(2) contains three

cytoplasmic SODs, two Mn/Fe-SODs, and one NiSOD (Chung et al., 1999; Miller, 2012).

Alternatively, O2 is scavenged by superoxide reductases in a number of strictly anaerobic

bacteria that lack SOD. In the reactions catalyzed by superoxide reductase, no molecular

oxygen is produced (Equation 5; Jenney et al., 1999; Lombard et al., 2000). This and other

potential benefits of this scavenging mechanism over the SOD-catalyzed reaction have been

proposed for obligate anaerobes (Imlay, 2002).

O2 + e + 2H+ H2O2 (5)

The two first examples of superoxide reductases were isolated from sulfate-reducing bacteria

of the genus Desulfovibrio (Moura et al., 1990; Chen et al., 1994), and later proteins of a

similar function were characterized in other bacterial species such as Treponema pallidum

(Santos-Silva et al., 2006), and in archaea from the Pyrococcus genus (Yeh et al., 2000; Clay

CHAPTER I

 20 

et al., 2002; Grunden et al., 2005; for reviews, see Nivière and Fontecave, 2004; Kurtz, 2006;

Pinto et al., 2010).

Hydrogen peroxide is detoxified by peroxidases and catalases (Equations 6 and 7

respectively).

RH2 + H2O2 R + 2H2O (6)

2H2O2 O2 + 2H2O (7)

Peroxidases are usually the primary scavengers of H2O2, which minimize endogenously

produced H2O2. Catalases are expressed under oxidative stress conditions and therefore

mainly cope with H2O2 entering the cell from the environment (for a review see Imlay, 2008).

Bacterial genomes encode a great variety of peroxidases that have been classified according

to their sequence similarity, cofactor content, and regeneration mechanism (PeroxiBase at

http://peroxibase.toulouse.inra.fr/; Passardi et al., 2007; Koua et al., 2009). For instance, in E.

coli the primary scavenger of endogenously formed H2O2 is the non-haem two-component

NADH peroxidase AphCF. A disulfide bond formed upon oxidation of two Cys residues in

AphC is fast re-reduced due to an exchange reaction with the third Cys residue within the

protein. The newly formed disulfide, in turn, is reduced upon reversible binding of the

flavoprotein AphF which itself is reduced by NADH (for reviews, see Poole et al., 2000;

Poole, 2005; Imlay, 2008). The activity of AphCF becomes limiting when extracellular H2O2

concentration is greater than 20 M. Under these conditions, transcription of katG encoding a

bifunctional catalase-peroxidase is strongly induced due to the activation of transcription

factors OxyR described in section 1.3.1 (Aslund and Beckwith, 1999; Seaver and Imlay,

2001), and it becomes the main H2O2 scavenger. KatG possess a catalase and a broad-

specificity peroxidase activity, and is active as a tetramer of identical subunits each

containing two heme B groups (Claiborne and Fridovich, 1979).

Deactivation of singlet oxygen is accomplished by either physical or chemical quenching.

Physical quenching through tocopherol or plastoquinone leads to the deactivation of 1O2 to its

ground state with no oxygen consumption (Fahrenholtz et al., 1974; Gruszka et al., 2008;

Krieger-Liszkay et al., 2008). In chemical quenching, 1O2 reacts with a quencher to produce

its oxidized form. Examples of chemical 1O2-quenchers are carotenoids (Baroli et al., 2004;

Glaeser and Klug, 2005; Zhu et al., 2010; Osawa et al., 2011; Kirilovsky and Kerfeld, 2012;

Li et al., 2012; Ramel et al., 2012) and anthocyanins (De Rosso et al., 2008). Thus it makes

General information

 21 

sense that carotenoid biosynthesis is induced in response to 1O2 in Myxococcus xanthus

(Galbis-Martínez et al., 2012).

No mechanisms for OH detoxification has been reported, and it is speculated that due to the

very short half-life of this radical as a result of its high reactivity, microorganisms evolved

mechanisms to prevent OH formation via the Fenton reaction by synthesizing Fe-binding

proteins and ferritins (for review, see Arosio et al., 2009; Bellapadrona et al., 2010).

CHAPTER I

 22 

1.3 Bacterial responses to ROS

Bacteria are not necessarily exposed to superoxide, hydrogen peroxide or singlet oxygen

simultaneously. Accordingly, separate regulatory pathways utilizing distinct sensing

mechanisms have evolved (Table 1.1).

Table 1.1. Bacterial regulators involved in ROS response.

Name of the regulator(s) a

Organism b Selected orthologs c

One-component transcription factors

Iron-sulfur cluster-containing transcription factors

SoxRS E. coli SoxRS of Salmonella, SoxR of P. aeruginosa and Agrobacterium tumefaciens

Fnr E. coli DnrS of Pseudomonas stutzeri, FlpA and FlpB of Lactococcus lactis

IscR E. coli IscR of P. aeruginosa, Erwinia chrysanthemi, Shigella flexneri

Thiol-disulfide redox switches

OxyR E. coli OxyR of P. aeruginosa, C. crescentus, Neisseria meningitidis, S. coelicolor

OhrR Xanthomonas campestris

OhrR of B. subtilis and S. meliloti, MgrA of Staphylococcus aureus

Spx B. subtilis Spx of S. aureus, SpxA1 of Staphylococcus sanguinis

Transcriptional factors coordinating metal ions

Fur E. coli PerR of B. subtilis, S. aureus, N. gonorrhoeae

Two-component regulatory systems

ArcAB E. coli ArcAB of Salmonella, Haemophilus influenzae

70 factors

Group 2

RpoS E. coli RpoS of Pseudomonas putida, Vibrio vulnificus, Burkholderia pseudomallei

Group 3

B B. subtilis B of S. aureus and Listeria monocytogenes,

Group 4 (ECF-type) d

(Ecf)-NepR-PhyR e M. extorquens RpoE4-RseF-TcrX of Rhizobium etli and T-NepR-PhyR C. crescentus

SigR-RsrA S. coelicolor RpoE-ChrR of R. sphaeroides, RpoE-ChrR of C. crescentusCarQ-CarR-CarF M. xanthus LitS-LitB S. coelicolor

a, b Names of the paradigm protein and of the corresponding bacteria are listed. c Orthologs were chosen subjectively. The minimum requirement was that either corresponding deletion mutant(s) are more sensitive to oxidative stress or target genes of the regulator include oxidative stress related genes. Orthologs with specific additional properties are mentioned in the text. See text for references. d Names of the factor-anti- factor and anti-anti- factors are indicated. e The cognate factor is yet unidentified in M. extorquens

General information

 23 

Whereas a number of ROS-responding one-component transcriptional regulators has been

characterized in great detail, sensing mechanisms which activate ROS-responsive ECF

actors and two-component regulatory systems are still largely unknown. Current knowledge

of ROS-responsive regulatory pathways is summarized below.

1.3.1 One-component transcription factors

Transcription factors responsive to ROS are cytoplasmic DNA- or/and RNAP-binding

proteins that can be subdivided in three groups, based on the sensing mechanism.

Iron-sulfur cluster-containing transcription factors

This type of ROS-sensing system includes Fe-S clusters as cofactors that directly sense

oxidation, promote protein conformational change, and enable transcription factors (TFs) to

activate/repress transcription. Regulatory systems based on this sensing mechanism primarily

respond to superoxide due to the highest sensitivity of Fe-S clusters toward this ROS. A

number of TFs containing Fe-S clusters have been characterized, such as SoxR (from the

SoxRS regulatory cascade), Fnr and IscR. These TFs were originally discovered in E. coli,

and the presence of homologous TFs was shown in other bacterial species (Table 1.1).

The SoxRS regulatory system was initially described as the principal regulatory system of the

superoxide response in E. coli. SoxR functions as a homodimer with a 2Fe-2S+ cluster per

subunit which, upon oxidation, results in 2Fe-2S2+ formation (Fig. 1.6A). SoxR

homodimers containing either reduced or oxidized Fe-S cluster(s) are able to bind the soxS

promoter. A conformational change caused by oxidation enables SoxR to activate

transcription of soxS, located adjacent to soxR, more than 100-fold (Hidalgo and Demple,

1994; Hidalgo et al., 1995; Watanabe et al., 2008). In turn, the secondary TF SoxS stimulates

transcription of more than 100 genes (Fig. 1.6A) including genes involved in the oxidative

stress response such as sodA, nfo (endonuclease IV involved in DNA repair) and yggX

(cellular iron trafficking and Fe-S cluster reconstruction) (Wu and Weiss, 1991; Li and

Demple, 1994; Pomposiello et al., 2001). Systems homologous to SoxRS have been

described in other -proteobacteria including Salmonella (Fang et al., 1997), P. aeruginosa

(Kobayashi and Tagawa, 2004) and in the -proteobacterium A. tumefaciens

(Eiamphungporn et al., 2006). Comparative analysis of SoxRS-regulated genes in various

CHAPTER I

 24 

bacterial species indicates that the function of this regulatory system is moderately conserved

and involved in the oxidative stress response (Chiang and Schellhorn, 2012).

Fig. 1.6. Schematic representation of the major oxidative stress and iron-uptake regulators of E. coli, SoxRS, OxyR and Fur. A. and B. SoxR and OxyR switch upon oxidation (modified from Chiang and Schellhorn, 2012). C. Model of Fur-mediated iron regulation (based on Carpenter et al., 2009; Nandal et al., 2010). See text for further details.

Fnr controls the switch from aerobic to anaerobic respiration in E. coli. Under O2-limitation,

Fnr is an active TF. Under these conditions, Fnr forms a homodimer containing a 4Fe-4S2+

cluster per subunit. Upon exposure to various ROS, especially superoxide (Sutton et al.,

2004), the Fe-S cluster is oxidized to 2Fe-2S2+ leading to dissociation of Fnr into inactive

monomers (Lazazzera et al., 1993; Crack et al., 2008). More than 100 genes regulated by Fnr

were identified using a microarray approach (Salmon et al., 2003; Kang et al., 2005;

Constantinidou et al., 2006), ChIP-chip analysis (Grainger et al., 2007), and bioinformatic

approaches (Constantinidou et al., 2006). It was shown that Fnr regulates transcription of the

genes encoding ROS-detoxifying enzymes including katG, sodA, unfEFGHI (paralogs of

MetSO reductase) (Constantinidou et al., 2006) in addition to genes specifying

denitrification. Homologs of Fnr which, similar to Fnr of E. coli, control oxidative stress

response, were characterized in P. stutzeri (Vollack et al., 1999) and L. lactis (Scott et al.,

2000; Akyol and Shearman, 2008). It should be noted, however, that the presence of Fe-S

cluster has not been verified in a number of Fnr homologs.

Another TF containing a Fe-S cluster is IscR. In E. coli, iscR is the first gene of the operon

encoding the Isc Fe-S cluster assembly machinery (iscRSUA-hscBA-fdx) (Tokumoto and

Takahashi, 2001). In contrast to the TFs mentioned above, IscR functions as a repressor

General information

 25 

(Schwartz et al., 2001) and its activity is not dependent on association with the Fe-S cluster.

Both apo-IscR and [2Fe-2S]-IscR form dimers and in vitro bind to an IscR target sequence

with similar strength and repress transcription (Nesbit et al., 2009). The mechanism

regulating the activity of IscR remains unclear but it is likely that Cys residues coordinating

the Fe-S cluster play an important role (Fleischhacker et al., 2012). IscR controls

transcription of operons encoding Fe-S cluster-containing anaerobic respiratory enzymes

(hyaABCDEF, hybOABCDEFG and napFDAGHBC) and genes involved in Fe-S cluster

biogenesis (sufABCDSE, yadR and yhgI) (Giel et al., 2006). Amino acid residues of the IscR

homolog from Acidithiobacillus ferrooxidans required for [Fe–S] cluster coordination were

identified but genes regulated by this protein remain unknown (Zeng et al., 2008). Homologs

of IscR involved in oxidative stress response were characterized in P. aeruginosa (Kim et al.,

2009b), E. chrysanthemi (Rincon-Enriquez et al., 2008), and S. flexneri (Daugherty et al.,

2012), and other bacteria.

Thiol-disulfide redox switches

Another widespread mechanism of ROS sensing involves oxidation of a specific Cys

residue(s) within TFs that often lead to disulfide bond formation and thus to a switch of the

TF state (for reviews, see Antelmann and Helmann, 2011; Wouters et al., 2011; Vázquez-

Torres, 2012). TFs of this type primarily respond to H2O2 due to the high susceptibility of

Cys residues to this ROS (for a review, see Dubbs and Mongkolsuk, 2012). Examples of this

sensing principle are OxyR present mainly in Gram-negative bacteria, OhrR found in both

Gram-positive and Gram-negative bacteria, and the Spx regulator which is highly conserved

in Gram-positive bacteria.

OxyR is a transcriptional activator of the LysR-family first characterized in Salmonella and

later on in E. coli and other species. Like other TFs of the LysR-family, OxyR contains a

conserved N-terminal helix-loop-helix DNA binding domain, a central response domain

which senses oxidation, and a C-terminal multimerisation domain. In a reducing

environment, OxyR forms an inactive tetramer, but upon exposure to ROS, disulfide-bonds

form in each OxyR monomer, which leads to a conformational change and formation of an

active OxyR tetramer (Fig. 1.6B; Zheng et al., 1998; Choi et al., 2001; Lee et al., 2004).

OxyR TFs typically control large regulons (about 100 genes) including katG, trxC, grx, gorA

(Grx reductase), and fur (ferric homeostasis regulator) mentioned below (Christman et al.,

1985; Tao et al., 1991; Zheng et al., 2001). OxyR generally occurs in Gram-negative bacteria,

CHAPTER I

 26 

including P. aeruginosa (Bae and Cho, 2012), C. crescentus (Italiani et al., 2011),

N. meningitidis (Ieva et al., 2008; Sainsbury et al., 2010), but homologs have also been found

in Gram-positive bacteria for example in S. coelicolor (Morikawa et al., 2006; Oh et al.,

2007).

OhrR-like TFs belong to the MarR-family and contain a winged-helix DNA binding motif.

OhrR of X. campestris is the first characterized TF of this type. In the reduced form, OhrR

dimers are bound to two adjacent inverted repeat sequences within a target gene promoter and

repress transcription of associated genes (Mongkolsuk et al., 2002; Hong et al., 2005). Upon

exposure to ROS or organic peroxides, the Cys residue(s) of OhrR is oxidized to a sulfenic

acid (Fuangthong and Helmann, 2002), which in some cases leads to formation of a disulfide-

bond (intra- or intersubunit) within OhrR dimers (Newberry et al., 2007; Soonsanga et al.,

2008b) resulting in inactivation of the OhrR repressor. OhrR controls transcription of genes

involved in detoxification of organic-peroxides including ohrA (peroxide-specific

peroxiredoxin) (Fuangthong et al., 2001; Mongkolsuk et al., 2002; Chuchue et al., 2006),

other processes like virulence and antibiotic resistance of S. aureus (Luong et al., 2006; Chen

et al., 2009), and quorum sensing and tyrosine metabolism of P. aeruginosa (Lan et al.,

2010). Characterized homologs include OhrR of B. subtilis (Soonsanga et al., 2008a), OhrR

of S. meliloti (Fontenelle et al., 2011) and MgrA of S. aureus (Chen et al., 2006).

Another thiol-based sensor is Spx of B. subtilis, a member of the ArsC protein family that is

characterized by a CXXC motif which controls activity of such proteins (Nakano et al.,

2005). Spx is inactive under reducing conditions, but upon oxidation an intermolecular

disulfide-bond is formed between the cysteines of the CXXC motif turning Spx into a

transcriptional activator. In this conformation Spx directly interacts with the RNAP -subunit

and activates transcription of target genes. Function of Spx is controlled at the transcriptional

and posttranslational levels by various mechanisms (for a review, see Zuber, 2004). The Spx

regulon is composed of genes encoding proteins functioning in thiol homeostasis (trxA, trxB

msrA) and Cys biosynthesis (yrrT, cysK) (Nakano et al., 2003; Choi et al., 2006). Homologs

of Spx were found in Gram-positive bacteria (Zuber, 2004), and later characterized in several

species including S. aureus (Pamp et al., 2006) and S. sanguinis (Chen et al., 2012).

Transcription factors coordinating metal ions

Oxidative stress is closely linked to iron metabolism in a cell due to the Fenton reaction.

Thus, the higher the concentration of free iron is in a cell the greater the risk for oxidative

General information

 27 

stress becomes. Accordingly, in bacteria iron homeostasis and the oxidative stress response

are connected through regulatory systems (Cornelis et al., 2011). TFs involved in the

regulation of both processes belong to the Fur-family and utilize sensing mechanisms based

on metal ion coordination (for a review, see Spiro and D'Autreaux, 2012). To be in an active

(repressing) state, protein monomers of this family require binding of Fe2+ to the specialized

docking site, which leads to dimerization and DNA binding at the Fur box (Fig. 1.6C; Mills

and Marletta, 2005; Lee and Helmann, 2006a, b; Jabour and Hamed, 2009). A Fur box is

located close to the 35 and 10 promoter elements, thus Fur binding interferes with RNAP

and causes repression of transcription. In some bacteria such as H. pylori, N. meningitides, P.

aeruginosa transcriptional activation mediated by Fur was also shown. Fur acts as a

transcriptional activator when it binds to extended sites located in a region between 240 and

60 positions upstream of the transcription start site and stimulates transcription by either

recruitment of RNAP or release of repression caused by the histone-like nucleoid-associated

protein (Delany et al., 2006; Nandal et al., 2010; for a review, see Carpenter et al., 2009).

Fur-family proteins regulate transcription of the genes involved in iron acquisition and

oxidative stress response (Chen et al., 2007). Under iron-poor conditions no Fe2+ is bound to

the Fur, which makes it inactive with respect to both its repressor and activator functions.

To the TFs of this type belong such well characterized repressors as Fur of E. coli (Hussein et

al., 1981) and H2O2 responsive PerR, one of the Fur family proteins of B. subtilis (Bsat et al.,

1998). Fur controls more than 20 genes in E. coli K-12 including sodA and sodB (Mn- and

Fe-containing SODs, respectively) (Carpenter et al., 2009). Notably, soxA is also a member

of SoxRS regulon described above (Niederhoffer et al., 1990). In E. coli, both OxyR and

SoxRS induce fur expression and thus reduce iron uptake under oxidative stress (Zheng et al.,

1999).

It is believed that PerR substitutes OxyR in many Gram-positive bacteria (Mongkolsuk and

Helmann, 2002). However PerR is not restricted to Gram-positive bacteria (van Vliet et al.,

1999; Friedman and O'Brian, 2004; Rea et al., 2005; Morikawa et al., 2006), and was found

along with OxyR in S. coelicolor (Hahn et al., 2000; Hahn et al., 2002) and N. gonorrhoeae

(Tseng et al., 2003; Wu et al., 2006; Wu et al., 2010). Similar to Fur of E.coli, PerR in

B. subtilis controls genes involved in oxidative stress response: katA (catalase) and mrgA (a

homolog of the E. coli peroxide-inducible DNA-binding protein), apart from the heme

biosynthesis operon hemAXCDBL (Chen et al., 1995).

CHAPTER I

 28 

1.3.2 ROS-responsive two-component regulatory systems

In E. coli, the ArcAB two-component regulatory system which is involved in the regulation

of aerobic to anaerobic transition contributes to H2O2 resistance. Generally, in

two-component regulatory systems, a sensor kinase detects an environmental or intracellular

signal, autophosphorylates and subsequently transphosphorylates a response-regulator

protein, usually a DNA-binding transcriptional factor (for a review, see Mitrophanov and

Groisman, 2008). In the ArcAB system, ArcB is the membrane-bound sensing protein which

possesses a kinase domain with the canonical His residue required for autophosphorylation at

the N-terminus and, rather unusually, a domain homologous to the receiver domain of a

response-regulator protein at the C-terminus. This additional domain allows ArcB to amplify

the signal from ArcB to ArcA, a classical response regulator that has an N-terminal receiver

domain with a conserved aspartate residue and a C-terminal helix-loop-helix domain for

DNA binding (Iuchi and Lin, 1992; Iuchi and Weiner, 1996; Nuñez Oreza et al., 2012).

Under anaerobic conditions ArcB autophosphorylates and by transphosphorylation activates

ArcA which then activates transcription of genes involved in respiratory and fermentative

metabolism. During a switch from anaerobic to aerobic growth, oxidized forms of quinones

inhibit ArcB autophosphorylation and thus activation of target genes (Georgellis et al., 2001).

Although the sensing mechanism is yet unknown, it was reported that the ArcAB system

plays a role in the resistance of E. coli to ROS under aerobic conditions, since deletion

mutants of either arcA or arcB are more sensitive to H2O2 than the wild-type strain (Loui et

al., 2009). A similar function of ArcAB homologs was shown in Salmonella enterica (Lu et

al., 2002) and H. influenzae (Wong et al., 2007).

1.3.3 ROS-responsive 70 factors

Apart from the house-keeping 70 factor(s), many bacterial species possess a general stress

response factor and a number of factors whose function is focused on one or the other

specific stress. Oxidative stress often activates directly or indirectly the general stress

response factor and one or more specialized factors.

ROS-responsive 70 factors of group 2

To the group 2 of 70 factors belongs the general stress response factor RpoS of E. coli. It

is widely accepted that in -, - and -proteobacteria the function of general stress response

General information

 29 

factors is fulfilled by factors homologous to RpoS as RpoS-like factors are conserved

within these taxonomy classes (Chiang and Schellhorn, 2010).

Expression of RpoS is regulated at the transcriptional and translational levels, its stability is

proteolytically controlled and its activity can be inhibited by different molecules (for a

review, see Battesti et al., 2011). It was recently shown that oxidative stress caused by H2O2

regulates the function of RpoS through the DNA-binding protein MsqA of the toxin-antitoxin

system MqsR-MqsA. Under non-stressed conditions MsqA is bound to a palindromic

sequence in the rpoS promoter and prevents its transcription (Wang et al., 2011). Upon

oxidative stress, the Lon protease is induced leading to MsqA degradation thus allowing rpoS

transcription (Kim et al., 2010; Wang et al., 2011). Conversely, OxyR is activated upon

oxidative stress and induces the regulatory RNA OxyS which then inhibits translation of rpoS

and thus serves as a negative feed-back loop (Altuvia et al., 1997).

Under RpoS control are important genes for oxidative stress response such as sodC (Gort et

al., 1999), katE (stationary-phase catalase), dps, and xthA (exonuclease III) (Barth et al.,

2009). While the composition of the RpoS regulon varies significantly within -, - and

-proteobacteria, the role of RpoS in the oxidative stress response is moderately conserved

among studied bacteria and was at least shown in P. putida (Miller et al., 2001), V. vulnificus

(Park et al., 2004), and B. pseudomallei (Subsin et al., 2003).

ROS-responsive 70 factors of group 3

The general stress response factor B in B. subtilis belongs to the group 3 of 70 factors. Its

homologs direct general stress response in diverse Gram-positive bacteria (Hecker et al.,

2007).

The activity of B is controlled by the partner-switching mechanism which includes RsbW,

an anti- factor harboring in addition a kinase activity, and an anti-anti- factor RsbV. In

unstressed cells B is bound to RsbW, and RsbV is phosphorylated by RsbW and thereby

inactive. Under stress conditions two phosphatases, RsbU and RsbP, specifically

dephosphorylate RsbV, and the accumulating non-phosphorylated RsbV binds RsbW thus

releasing B to transcribe target genes (for a review, see Hecker et al., 2007). Two distinct

pathways activating either RsbU or RsbP were described and it was reported that oxygen

leads to the activation of RsbP. In addition to its catalytic phosphatase domain, RsbP harbors

an N-terminal PAS domain essential for its activity (Vijay et al., 2000). PAS domains are

widespread and control protein-protein interaction by sensing oxygen concentration, redox

CHAPTER I

 30 

potential or light intensities and it seems likely that this domain is involved in oxygen sensing

(Taylor and Zhulin, 1999).

Similar to E. coli RpoS, B is essential for oxidative stress tolerance of B. subtilis, S. aureus

and L. monocytogenes (Engelmann and Hecker, 1996; Kullik et al., 1998; Ferreira et al.,

2001). The B-regulon includes sodA, katE and dps (Engelmann and Hecker, 1996;

Antelmann et al., 1997; Petersohn et al., 2001). The overlap between characterized B-

regulons in different Gram-positive bacteria is rather small with only about 10% common

genes in B. subtilis and S. aureus (Hecker et al., 2009).

ROS-responsive 70 factors of group 4 (ECF-type)

To the ECF-type factors involved in oxidative stress response belong the recently

discovered general stress response factors of -proteobacteria and a few rather specific

oxidation stress factors.

General stress response factors of -proteobacteria

The function of the general stress response factors in -proteobacteria is controlled by a

partner switching mechanism through the anti- factor protein NepR and its anti-anti- factor

PhyR described in more detail in Chapter IV (Francez-Charlot et al., 2009; Staroń and

Mascher, 2010). Mutants of M. extorquens, R. etli and C. crescentus lacking the respective

factor or PhyR were more sensitive towards oxidative stress (Alvarez-Martinez et al., 2007;

Gourion et al., 2008; Martínez-Salazar et al., 2009), but this was not the case in S. meliloti

(Sauviac et al., 2007) and Sphingomonas sp. (Kaczmarczyk et al., 2011). Similarly to the

RpoS and B, the regulons of those general stress response factors in -proteobacteria are

rather diverse, even though they often contain genes involved in the oxidative stress response.

Examples include in M. extorquens katE, dps and osmC (encodes an envelope protein of

unknown function involved in oxidative stress response; Conter et al., 2001) (Gourion et al.,

2008), in R. etli CH00462 (encoding a putative Mn-catalase) and xthA1 (exonuclease III)

(Martínez-Salazar et al., 2009), and in S. meliloti msrA1 (a putative methionine reductase)

and katC (catalase C) (Sauviac et al., 2007).

SigR-RsrA system in S. coelicolor and its homologs

The best characterized ECF-type factors involved in oxidative stress response are regulated

by zinc-containing anti-σ factors (ZAS) which are present in a number of bacterial species.

General information

 31 

Examples include S. coelicolor SigR-RsrA, R. sphaeroides RpoE-ChrR, M. tuberculosis

SigL-RslA, C. crescentus RpoE-ChrR, and Azospirillum brasilense RpoE-ChrR (Li et al.,

2002; Li et al., 2003; Lourenço and Gomes, 2009; Thakur et al., 2010; Greenwell et al., 2011;

Mishra et al., 2011). In these systems, zinc is required to maintain the anti-σ factors in an

active (i.e. inhibitory) conformation under reduced conditions (Bae et al., 2004). Zinc

coordinating Cys or/and His residues of the anti-σ factor directly sense oxidation which either

repositions or releases the zinc cofactor. In turn, the anti-σ factor changes its conformation

and loses its ability to bind its cognate σ factor leading to transcription of target genes.

Zinc-containing anti- factors and cognate factors can be subdivided into two groups based

on whether Cys residues are involved in metal coordination or not (Fig. 1.7).

Fig. 1.7. Regulation of antioxidant defenses by zinc-containing anti- factors. A. SigR-RsrA pair of S. coelicolor, modified from Vázquez-Torres, 2012. B. RpoE-ChrR pair of R. sphaeroides represented based on Greenwell et al., 2011. Amino acid residues coordinating zinc in the anti- factors are shown. Formation of a disulfide bond (S-S) and His oxidation (His’) is indicated. See text for further details.

In the first group, exemplified by SigR-RsrA of S. coelicolor or SigL-RslA of

M. tuberculosis, zinc coordination involves Cys residues (Fig. 1.7A). Specifically, three Cys

and a His residues coordinate zinc in RsrA (Bae et al., 2004), while two Cys and two His

residues bind zinc in RslA (Thakur et al., 2010). Oxidation of these cysteines leads to

formation of a disulfide bond (Bae et al., 2004). The SigR-RsrA system of S. coelicolor

responds to thiol-specific oxidation caused by diamide and to the redox-cycling compounds

menadione and plumbagin (Paget et al., 1998). SigL-RslA in M. tuberculosis is required for

lethal host infection and the response to plumbagin (Hahn et al., 2005; Dainese et al., 2006).

CHAPTER I

 32 

In the anti-RpoE anti- factors ChrR of R. sphaeroides and C. crescentus a zinc atom is

coordinated by three His and one glutamic acid residues (Fig. 1.7B; Greenwell et al., 2011).

As both systems respond to 1O2 which is known to modify imidazole rings (Wright et al.,

2002), it was proposed that oxidation of the zinc coordinating residues initiates a

conformational change in ChrR to release RpoE (Greenwell et al., 2011).

Structures of the -anti- complexes and analysis of single amino acid substitutions revealed

that both RsrA of S. coelicolor and ChrR of R. sphaeroides bind to the 2 region of their

cognate -factors (RpoE and SigR, respectively) and thus prevent -factor from binding to

RNAP (Li et al., 2002; Anthony et al., 2004).

Activity of factors in these systems is regulated not only by anti- factors at the protein

level, but also by proteases acting on the corresponding anti- factors and at the

transcriptional level (Kim et al., 2009a; Mishra et al., 2011). Although genes controlled by

these -anti- factor systems are often different, genes involved in the following processes

are often represented: (i) thiol and mycothiol metabolism (Trx and Trx reductase; Paget et al.,

1998; Manganelli et al., 2002; Newton and Fahey, 2008); (ii) reduction of methionine

sulfoxide (msrA and msrB; Alvarez-Martinez et al., 2006; Gunesekere et al., 2006; Kallifidas

et al., 2010); (iii) DNA repair (uvrA, uvrD and its paralog uvrD2 (nucleotide excision repair),

phrA photolyase (repair of pyrimidine dimers caused by 1O2); Anthony et al., 2005;

Hendrischk et al., 2007; Kim et al., 2012); (iv) fatty acid metabolism (cfaS (cyclopropane

fatty acyl-phospholipid synthase) and isc1 (isocitrate lyase) (Manganelli et al., 2001;

Anthony et al., 2005; Lourenço and Gomes, 2009). In C. crescentus, sodA is under the

control of the RpoE-ChrR system (Alvarez-Martinez et al., 2006). Notably, carotenoid

biosynthesis in A. brasilense is controlled by the RpoE-ChrR system (Thirunavukkarasu et

al., 2008), but the homologous system is not involved in this process in R. sphaeroides

(Dufour et al., 2008).

Control of carotenoid biosynthesis in M. xanthus and Streptomyces sp.

Carotenoids are natural yellow or orange pigments that serve as a protectant against photo-

oxidative damage and are synthesized by a wide variety of organisms, from nonphototrophic

prokaryotes to higher plants (for a review, see Vachali et al., 2012). Bacteria produce a broad

spectrum of carotenoids in a constitutive or light-inducible manner (Takano et al., 2006).

Light-dependent production of carotenoids was studied in great details in the Gram-negative

bacterium M. xanthus, and involves the ECF factor CarQ that is activated by 1O2 (Galbis-

General information

 33 

Martínez et al., 2012). Similarly, regulation of carotenoid biosynthesis in the Gram-positive

bacterium S. coelicolor also comprises an ECF factor LitR, but the molecular mechanism

of induction is still unknown (Takano et al., 2005).

In M. xanthus, light-induced carotenogenesis is under control of a MerR family transcription

regulator CarA which represses expression of carotenoid biosynthesis genes in the dark.

Repressor activity of CarA is negatively regulated by CarS, encoded in the carQRS operon

together with ECF factor CarQ and the cognate anti- factor CarR (Fig. 1.8). As recently

shown by Galbis-Martinez and coworkers (Galbis-Martínez et al., 2012), singlet oxygen,

generated when solar energy captured by the heme precursor protoporphyrin IX is transferred

to molecular oxygen, inactivates CarR via CarF (the anti-anti- factor) and thus releases

CarQ to transcribe the carQRS operon and the carotenogenic gene crtIB. In turn, CarS

neutralizes CarA-mediated repression to allow transcription of carotenoid biosynthesis genes

(carA and carB operons). As a result, synthesized carotenoids will quench 1O2 and thus create

a negative feedback loop.

Fig. 1.8. Model summarizing regulation of light-induced carotenoid biosynthesis in M. xanthus. Generation of 1O2 as the result of energy transfer from photoexcited protoporphyrin IX (PPIX) to O2 is shown. -factor CarQ, anti- factor CarR, anti-anti- factor CarF, RNAP core-enzyme, TF CarA and its repressor CarS involved in the cascade are depicted by ovals. The operon encoding regulatory elements is represented by white arrow, carotenoid biosynthetic gene and operons are symbolized by grey arrows. Solid arrows and blunt-ended lines indicate positive and negative regulation, respectively, and dotted arrows point to the products generated. Modified from Galbis-Martínez et al., 2012. See text for further details.

In S. coelicolor, genes required for carotenoid biosynthesis are present in a gene cluster that,

apart from two operons of biosynthetic genes, also includes regulatory genes encoding LitR,

a MerR-type transcriptional repressor, the ECF factor LitS, and a putative anti- factor

LitB. Despite similarities among regulatory players in M. xanthus and S. coelicolor, in the

latter bacterium the ECF factor LitS directly transcribes carotenoid biosynthesis genes upon

light exposure (Takano et al., 2005). Because in S. coelicolor, similarly to M. xanthus,

carotenoid biosynthesis is induced upon exposure to blue light it seems probable that 1O2 is

the molecular trigger of the LitS-LitB pathway.

CHAPTER I

 34 

1.4 ROS in the Rhizobium-legume symbiosis

Rhizobia are nitrogen-fixing Gram-negative -proteobacteria from the soil which, in addition

to the free-living state, are able to undergo a symbiotic interaction with specific leguminous

plants. During the initial stages of the interaction between rhizobia and a host plant, a

chemical dialog involving several signal molecules takes place in the rhizosphere. In

response to flavonoids present in plant root exudates, rhizobia induce the synthesis of

nodulation factors (NFs), which in turn are sensed by the host plant. These early interaction

steps result in formation of an infection thread and eventually a new plant organ, the root

nodule (for a review, see Oldroyd and Downie, 2008). By infection of host plant cells,

bacteria colonize nodules, multiply there and adapt their physiology to the endosymbiotic

life-style. Thereafter, bacteria reduce atmospheric nitrogen due to the activity of the complex

metalloenzyme nitrogenase for the benefit of the host, and, in return, are supplied with host-

derived nutrients such as dicarboxylic acids (for a review, see Batut et al., 2004; Gage, 2004;

Jones et al., 2007).

There is increasing evidence that ROS play an important role during Rhizobium-legume

symbiosis (for reviews, see Pauly et al., 2006; Chang et al., 2009; Nanda et al., 2010; Saeki,

2011). Initial contact of a rhizobial cell with the epidermis of host induces host defense

reactions including ROS and NO production similar to those induced in response to a

pathogen infection. However, unlike the response to a pathogen, the response to symbiotic

bacteria is transient (Santos et al., 2001; El Yahyaoui et al., 2004; Kouchi et al., 2004). ROS

(H2O2 and superoxide) at this stage are a part of the legume-rhizobia dialog, where NFs

trigger an accumulation of ROS in the root as deduced from experiments with Medicago

truncatula plants inoculated with wild-type S. meliloti or a mutant strain impaired in NFs

production (Ramu et al., 2002). Transient induction of ROS accumulation induces root hair

deformation and thus facilitates formation of the infection tread (D'Haeze et al., 2003; Lohar

et al., 2007). At this step antioxidant defense mechanisms of bacteria are required to

overcome the host defense reactions (Santos et al., 2000; Bueno et al., 2001).

During an already established symbiotic interaction the ROS threat derives from the need of

rhizobia to integrate their aerobic respiratory energy metabolism with the highly oxygen-

labile nitrogenase system. Plant-derived leghemoglobin is present at a high concentration in

nodules and functions as an oxygen buffering system to keep the concentration of free

oxygen in the cytoplasm of infected host cells very low. Auto-oxidation of leghemoglobin is

probably a main source of superoxide in nodules (Puppo et al., 1991; Gunther et al., 2007).

General information

 35 

Moreover, transition metals are also present at high levels in nodules, in combination with

already preformed H2O2 might generate hydroxyl radicals, ferryl haem proteins and protein

radicals (Becana and Klucas, 1992; Davies and Puppo, 1992; Moreau et al., 1996).

During natural and stress-induced nodule senescence elevated concentrations of peroxides

was reported (Escuredo et al., 1996; Gogorcena et al., 1997; Evans et al., 1999). Additionally,

the concentration of free iron which serves as a catalyst for ROS formation also increases in

aging nodules (Becana and Klucas, 1992; Mathieu et al., 1998). ROS production at various

stages of the Rhizobium-legume interaction suggests that rhizobia possess an efficient

antioxidant defense system (Santos et al., 2001; Rubio et al., 2004).

1.4.1 ROS detoxification in the Rhizobium-legume symbiosis: scavenging and

antioxidant systems and their regulatory systems

Rhizobia have multiple enzymatic antioxidant defense systems with some enzymes required

for the development and/or proper functioning of symbiosis (for a review, see Becana et al.,

2010). For instance, S. meliloti possesses two SODs (sodA and sodC) (Santos et al., 1999;

Santos et al., 2000; Flechard et al., 2009) and three catalases, i.e., two monofunctional

hydroperoxidases (KatA, KatC) and a bifunctional catalase-peroxidase (KatB) (Hérouart et

al., 1996; Ardissone et al., 2004). In this bacterium, deletion of a single catalase gene does

not lead to a symbiotic defect but double deletion mutants (katA/katC and katB/katC) in

S. meliloti are impaired in nodule formation and the ability to fix nitrogen (Jamet et al.,

2003). Reduced nitrogen fixation was also shown in the R. etli – Phaseolus vulgaris

symbiosis when a katG/prxS (prxS encoding peroxiredoxin) deletion mutant of R. etli was

tested (Dombrecht et al., 2005).

Apart from these ubiquitous ROS detoxifying systems, rhizobial genomes encode other

enzymes that might play a role in ROS elimination. For example, the S. meliloti genome

encodes three alkyl hydroperoxide reductases which also might use H2O2 as a substrate

(Seaver and Imlay, 2001). In addition, upon exposure to various hydroperoxides S. meliloti

secretes a putative chloroperoxidase Smc01944, and expression of prxS encoding

peroxiredoxin is induced during symbiosis in this bacterium (Barloy-Hubler et al., 2004;

Dombrecht et al., 2005).

Not much information is available on the mechanisms regulating oxidative stress response in

rhizobia. It was shown, that in S. meliloti OxyR controls expression of katA and katB (Jamet

et al., 2005; Luo et al., 2005), and ECF factor RpoE controls transcription of sodC and katC

CHAPTER I

 36 

(Flechard et al., 2009). Furthermore, in this bacterium OhrR controls expression of ohr

required for resistance to organic peroxides and likely the expression of smco1944 mentioned

above (Barloy-Hubler et al., 2004; Fontenelle et al., 2011). In R. etli, katG is probably

controlled by an OxyR-like TF, since the katG promoter region contains sequence motifs

characteristic of OxyR binding sites, and an OxyR-like protein is encoded next to katG

(Vargas Mdel et al., 2003). Finally, in B. japonicum, the katG level sufficient for

detoxification of H2O2 does not require OxyR (Panek and O'Brian, 2004). Since factors are

often involved in (oxidative) stress response of bacteria, and ECF factors are the main topic

of this work, the diversity of rhizobial factors is described in the following section.

1.4.2 factors in rhizobia

Transcription of many genes involved in nitrogen fixation is under control of a redox-

responsive EBP-family protein NifA, together with RNAP 54 factor(s). Therefore, attention

to the rhizobial factors was largely focused on 54 in the pre-genomic era (Ronson et al.,

1987; Kullik et al., 1991; Stigter et al., 1993; Michiels et al., 1998a, b; Clark et al., 2001).

Notably, a number of rhizobial species, including B. japonicum, M. loti and R. etli, possess

two highly similar variants of 54 (Table 1.2).

Apart from the 54 factors, rhizobia possess various numbers of 70 factors (Table 1.2).

Similar to E. coli sequenced rhizobial genomes encode one primary factor. The primary

factors of B. japonicum, R. etli, S. meliloti and Sinorhizobium fredi are very similar to that of

E. coli, exept for an extended 1 region which makes rhizobial proteins larger than the E. coli

ortholog (about 80 kDa instead of 70 kDa) (Rushing and Long, 1995; Luka et al., 1996; Beck

et al., 1997).

General information

 37 

Table 1.2. Classes and numbers of factors in rhizobial species and in E. coli.

Organism Strain a Numbers of (predicted) factors in individual families and groups54 family 70 family total no. total

no. group 1

(SigA, RpoD)group 2

group 3 (RpoHs)

group 4 (ECFs)

B. japonicum USDA 6 2 21 1 - 3 17 USDA 110 2 21 1 - 3 17

Bradyrhizobium sp.

BTAi1 1 18 1 - 1 16 ORS 278 1 17 1 - 1 15 S23321 1 17 1 - 2 14 WSM471 1 19 1 - 1 17

M. loti MAFF303099 2 23 1 - 1 21 Mesorhizobium ciceri WSM1271 2 16 1 - 1 14 S. meliloti 1021 1 17 1 - 2 14 Sinorhizobium medicae

WSM419 1 1 - 1 10

S. fredi NGR234 1 14 1 - 2 11 Rhizobium leguminosarum

3841 1 25 1 - 2 22

R. etli CFN 42 2 22 1 - 2 19 A. caulinodans ORS 571 2 11 1 - 1 9

E. coli b 1

(RpoN) 6

1 (RpoD)

1 (RpoS)

2 (RpoH, FliA)

2 (RpoE, FecI)

a All available genomes of the Bradyrhizobium genus were analysed. One genome was analysed for other rhizobial species. b The name of the respective E. coli factors is indicated in parentheses below the number of factors.

Analysis of sequenced rhizobial genomes has shown that these species do not encode group-2

70 factors (Table 1.2). By contrast, rhizobia often possess multiple paralogues of the group-3

type. These factors were studied with regard to nitrogen fixation (Ogawa and Long, 1995;

Narberhaus et al., 1996; Narberhaus et al., 1997; Oke et al., 2001; Ono et al., 2001; Kaufusi

et al., 2004; Bittner and Oke, 2006; Gould et al., 2007) due to the finding that establishment

and/or maintenance of efficient symbiosis requires chaperonines (Govezensky et al., 1991;

Ogawa and Long, 1995; Bittner et al., 2007) whose expression in E. coli is under RpoH

control (for reviews, see Arsène et al., 2000; Lund, 2001). Rhizobial group-3 70 factors

display distinct functions and mechanisms of regulation. Of the three rpoH genes in

B. japonicum, only rpoH2 is essential for growth, but the remaining two rpoH genes are

dispensable for free-living growth and symbiosis (Narberhaus et al., 1997). In S. meliloti,

RpoH1 is required for efficient symbiosis while deletion of the other rpoH paralogue does not

lead to any phenotype (Mitsui et al., 2004; Barnett et al., 2012).

The ECF group of factors comprises by far the largest number of putative factors in all

seven rhizobial species (Table 1.2). Yet rather little information is available about the roles

and mechanisms of their function(s). Two ECF factors of B. japonicum (EcfS and EcfG)

were shown to be required for efficient symbiotic interaction with host plant and nitrogen

CHAPTER I

 38 

fixation (Gourion et al., 2009; Stockwell et al., 2012). Whereas EcfG is the general stress

response factor and regulated by its anti- factor NepR and its anti-anti- factor PhyR (see

Chapter IV; Gourion et al., 2009), the mechanism of EcfS regulation remains speculative.

Likely, EcfS is negatively controlled by the putative TmrS anti- factor which is

cotranscribed with ecfS (Stockwell et al., 2012). The general stress response factor RpoE2

was also studied in S. meliloti. Deletion of rpoE2 had no effect on symbiosis and on tolerance

of free-living cells to various stress conditions (Sauviac et al., 2007; Bastiat et al., 2010). The

network regulating activity of RpoE2 includes typical NepR and PhyR homologs but in this

bacterium two paralogs of each are present (Bastiat et al., 2010). In R. leguminosarum, the

product of the rpoI gene is required for synthesis of the vibractin siderophore and iron uptake.

It is similar to ECF-type factors PvdS, PfrI and PdrA of Pseudomonas spp. and, to a weaker

extent, also to E. coli FecI (Yeoman et al., 1999; Carter et al., 2002). The mechanism of RpoI

regulation is unknown.

General information

 39 

1.5 Aim of this work

The aim of this work was to gain insights into the function of ECF-type factors in stress

response of B. japonicum. Chapter II describes factors EcfF and EcfQ of B. japonicum

involved in oxidative stress under free-living conditions. In this chapter, identification of the

target genes and mechanisms regulating activity of EcfF and EcfQ is presented. Chapter III

contains additional data regarding these regulatory elements. To gain further insight into the

mechanism of the general stress response of B. japonicum mediated by EcfG-NepR-PhyR,

the EcfG-dependent gene cluster bll/r1465-69 and a histidine kinase Blr1461 possibly

involved in PhyR-phosphorylation, were characterized (Chapter IV).

 

  

 

  

CHAPTER II

Reactive oxygen species-inducible ECF factors of Bradyrhizobium japonicum  

 

 

 

 

 

Modified version of a paper published in:

PLoS ONE 7(8): e43421 (2012); doi:10.1371/journal.pone.0043421

CHAPTER II

 42 

2.1 Abstract

Extracytoplasmic function (ECF) factors control the transcription of genes involved in

different cellular functions, such as stress responses, metal homeostasis, virulence-related

traits, and cell envelope structure. The genome of Bradyrhizobium japonicum, the nitrogen-

fixing soybean endosymbiont, encodes 17 putative ECF σ factors belonging to nine different

ECF factor families. The genes for two of them, ecfQ (bll1028) and ecfF (blr3038), are

highly induced in response to the reactive oxygen species hydrogen peroxide (H2O2) and

singlet oxygen (1O2). The ecfF gene is followed by the predicted anti- factor gene osrA

(blr3039). Mutants lacking EcfQ, EcfF plus OsrA, OsrA alone, or both factors plus OsrA

were phenotypically characterized. While the symbiotic properties of all mutants were

indistinguishable from the wild type, they showed increased sensitivity to singlet oxygen

under free-living conditions. Possible target genes of EcfQ and EcfF were determined by

microarray analyses, and candidate genes were compared with the H2O2-responsive regulon.

These experiments disclosed that the two σ factors control rather small, for the most part

distinct sets of genes, with about half of the genes representing 13% of the members of H2O2-

responsive regulon. To get more insight into transcriptional regulation of both factors, the

5’ ends of ecfQ and ecfF mRNA were determined. The presence of conserved sequence

motifs in the promoter region of ecfQ and genes encoding EcfQ-like factors in related

α-proteobacteria suggests regulation via a yet unknown transcription factor. By contrast, we

have evidence that ecfF is autoregulated by transcription from an EcfF-dependent consensus

promoter, and its product is negatively regulated via protein-protein interaction with OsrA.

Conserved cysteine residues 129 and 179 of OsrA are required for normal function of OsrA.

Cysteine 179 is essential for release of EcfF from an EcfF-OsrA complex upon H2O2 stress

while cysteine 129 is possibly needed for EcfF-OsrA interaction.

Reactive oxygen species-inducible ECF factors of B. japonicum

 43 

2.2 Introduction

Extracytoplasmic function (ECF) σ factors are alternative bacterial RNA polymerase σ

factors that play key roles in the response and adaptation of bacteria to different stresses and

environments (for reviews and a comprehensive classification, see Helmann, 2002; Staroń et

al., 2009). ECF σ factors are members of the σ70 family, which is divided into four groups.

Primary σ factors of group 1, to which the housekeeping σ factors belong, contain four

conserved domains 1 to 4 and some of them also comprise an additional non-conserved

region. They usually recognize promoters with the sequence TTGaca (−35) and TAtaaT

(−10) (Mitchell et al., 2003). In contrast, ECF σ factors belong to group 4 of the σ70 family

and contain only the conserved domains 2 and 4. Many of them are thought to respond to

environmental signals, they are often associated with an anti-σ factor, and usually auto-

regulate their own expression (Helmann, 2002; Gruber and Gross, 2003; Staroń et al., 2009).

Among the environmental cues are reactive oxygen species (ROS) which almost all bacteria

encounter and against which even anaerobes have evolved defense mechanisms (Kawasaki et

al., 2005; Dolla et al., 2006; Imlay, 2008). In aerobic organisms, ROS are generated also

endogenously, e.g. by incomplete reduction of oxygen during respiration. The term ROS is

generic, embracing not only free radicals such as superoxide anion (O2‾) and hydroxyl

radicals (OH•) but also hydrogen peroxide (H2O2) and singlet oxygen (1O2) (for reviews, see

Cadenas, 1989; Winterbourn, 2008).

Generation of ROS occurs via different routes (for reviews, see Mittler, 2002; Mittler et al.,

2004; Becana et al., 2010). Briefly, the best studied enzymatic generation of superoxide, and

consequently hydrogen peroxide, originates from NADPH oxidases that catalyze the

production of superoxide by the one-electron reduction of molecular oxygen using NADPH

as an electron donor (Mittler, 2002; Apel and Hirt, 2004). The main source of singlet oxygen

is the photosynthetic apparatus where it is generated in photosystem II as a side product by

energy transfer from excited triplet-state chlorophyll pigments to O2 (Krieger-Liszkay et al.,

2008). Energy can also be transferred to molecular oxygen by excited photosensitizers such

as phytoalexins which are produced by plants in response to pathogens (Triantaphylidès and

Havaux, 2009). Apart from plant-derived sources, singlet oxygen is also produced in natural

waters by the exposure of chromophoric dissolved organic matter to light (Latch and

McNeill, 2006).

Several ECF σ factors have been described to play a role in the response of bacteria to

oxidative stress. Examples are Streptomyces coelicolor SigR which responds to disulfide

CHAPTER II

 44 

stress produced by superoxide and diamide (Paget et al., 1998), Caulobacter crescentus SigT

which is necessary for survival under osmotic and oxidative stress (Alvarez-Martinez et al.,

2007), and SigF of the same organism mediating the response to oxidative stress in stationary

phase (Alvarez-Martinez et al., 2006). In the photosynthetic bacterium Rhodobacter

sphaeroides, transcription of rpoE is increased upon singlet oxygen stress (Anthony et al.,

2005; for review, see Glaeser et al., 2011) while RpoE activity is controlled by the anti-σ

factor ChrR (Campbell et al., 2007). Orthologs of the RpoE-ChrR system are present in

various bacterial species (Dufour et al., 2008) including C. crescentus (Lourenço and Gomes,

2009) and Myxococcus xanthus (Gorham et al., 1996).

Rhizobia, soil bacteria that fix nitrogen in symbiosis with leguminous plants, are exposed to a

wide range of environmental stimuli, including ROS, both in their free-living state in the soil

and in the interaction with host plants, i.e., during infection and establishment of symbiosis,

during nitrogen fixation in root nodules, and during senescence of these nodules (Evans et al.,

1999; Santos et al., 2001; for reviews, see Pauly et al., 2006; Chang et al., 2009).

Accordingly, rhizobia use a set of transcription regulators to reprogram gene expression in

order to cope with these stresses. Notably, during symbiosis ROS act as signalling molecules

and are needed for an efficient Rhizobium-legume interaction (Pauly et al., 2006).

The soybean endosymbiont Bradyrhizobium japonicum encodes a total of 23 predicted σ

factor-coding genes in its genome (Kaneko et al., 2002; Gourion et al., 2009). Whereas two

of them are σ54-type factors, 21 belong to the σ70 family. The latter category includes the

housekeeping σ factor SigA (group 1), three RpoH σ factors (group 3), and 17 ECF σ factors

(group 4) whose relationship is depicted in the phylogenetic tree shown in Fig. 2.1. With

SigA as an outgroup, the tree subdivides the ECF σ factors into two groups of 12 and 5

members documenting substantial diversity among them. In the larger group, three pairs of

similar σ factors are found: EcfS (Blr4928) and Blr3038, Bll1028 and Blr3042, and Bll6484

and Bll2628, which show 35%, 55%, and 45% amino acid sequence identity, respectively. Up

to now, only two members of the B. japonicum ECF σ family have been functionally studied

in more detail. Most recently, it was described that EcfS (Blr4928) plays a critical role in the

establishment of a functional symbiosis with soybean (Stockwell et al., 2012). Previously, it

was shown that EcfG (Blr7797) is involved in tolerance to heat and desiccation as well as in

the symbiotic interaction with soybean and mungbean (Gourion et al., 2009). Other

functionally studied EcfG orthologs in rhizobia include RpoE2 of Sinorhizobium meliloti

(Bastiat et al., 2010) and RpoE4 of Rhizobium etli (Martínez-Salazar et al., 2009) which

Reactive oxygen species-inducible ECF factors of B. japonicum

 45 

control regulons typical of general stress response as does T of C. crescentus (Lourenço et

al., 2011). Similarly, ECF σ factor RpoE of the plant-associated bacterium Azospirillum

brasilense is involved in tolerance to singlet oxygen and other abiotic stresses (Mishra et al.,

2011). Yet another rhizobial ECF σ factor, RpoI of Rhizobium leguminosarum, is required for

synthesis of the siderophore vicibactin and iron uptake (Yeoman et al., 1999; Yeoman et al.,

2003).

Fig. 2.1. Phylogenetic relationship of 17 predicted ECF -factors in B. japonicum. The tree (generated by the UPGMA method; Sneath and Sokal, 1973) is drawn to scale with respect to evolutionary distances. Bootstrap values were obtained after 1,000 repeats, and nodes with a confidence of greater than 90% () or 50% (o) are indicated. The primary factor (SigA) sequence of B. japonicum is included as an outgroup (dashed branch).

The transcriptome analysis of H2O2-stressed B. japonicum cells, which is presented here,

revealed that the expression of two predicted ECF σ factors is induced by H2O2 and also in

response to treatment with other ROS: Bll1028 (hereafter named EcfQ in accordance with its

ECF factor function and annotation as CarQ in Rhizobase (http://genome-

legacy.kazusa.or.jp/rhizobase/Bradyrhizobium) and Blr3038 (hereafter termed EcfF

according to the SigF prototype ECF factor of this class; Staroń et al., 2009). We have

determined the regulons of both σ factors, and demonstrated that mutant strains lacking either

one or both ECF σ factor(s) show increased sensitivity to singlet oxygen. Furthermore, we

have analyzed the distinct regulatory mechanisms controlling synthesis and activity of EcfQ

and EcfF. While expression of both genes is controlled at the transcriptional level, activity of

EcfF is additionally regulated by protein-protein interaction with its cognate anti- factor

CHAPTER II

 46 

Blr3039 (hereafter termed OsrA for oxidative stress-response anti- factor). Conserved

cysteine residues of OsrA are involved in H2O2 responsiveness and inhibition of EcfF activity

under non-stressed conditions.

Reactive oxygen species-inducible ECF factors of B. japonicum

 47 

2.3 Materials and methods

Bacterial strains and growth conditions

Bacterial strains used in this work are listed in Table 2.1. Escherichia coli strains were grown

in Luria-Bertani medium at 37 °C (Miller, 1972) containing these concentrations of

antibiotics for plasmid selection (g·ml-1): ampicillin, 200; kanamycin, 30; tetracycline, 10.

B. japonicum strains were cultivated at 30C aerobically (21% O2 in the gas phase) or

micro-oxically (0.5% O2) in peptone-salts-yeast extract (PSY) medium supplemented with

0.1% arabinose (Mesa et al., 2008), or anaerobically (100% N2) in yeast extract-mannitol

(YEM) medium containing 10 mM KNO3 (Hauser et al., 2006; Hauser et al., 2007). Where

appropriate, antibiotics were used at these concentrations (μg·ml-1): spectinomycin, 100;

kanamycin, 100; streptomycin, 100 (solid media) and 50 (liquid media); tetracycline, 50

(solid media) and 25 (liquid media). Aerobic cultures were grown in vigorously shaken (160

rpm) Erlenmeyer flasks containing one-fifth of their total volume of PSY medium. In

oxidative stress experiments, cells were exposed to 2 mM H2O2 for 10 min, conditions that do

not inhibit growth as shown previously (Mesa et al., 2009).

Table 2.1. Bacterial strains and plasmids used in this work.

Strain or plasmid Relevant genotype or phenotype Source / Reference

E. coli strains

DH5 supE44 lacU169 (80 lacZM15) hsdR17 recA1 gyrA96 thi-1 relA2

BRL, Gaithersburg, USA

S17-1 Smr Spr hsdR (RP4-2 kan::Tn7 tet::Mu; integrated into the chromosome)

(Simon et al., 1983)

BTH101 F- cya-99 araD139 galE15 galK16 rpsL1 (Strr) hsdR2 mcrA1 mcrB1

Euromedex, Souffelweyersheim, France

B. japonicum strains 110spc4 Spr wild type (Regensburger and

Hennecke, 1983) 0202 Spr Kmr ecfQ::aphII (opposite orientation) This work

0203 Spr blr3042 This work

9688 Spr Kmr (ecfF-osrA)::aphII (same orientation) This work

9715 Spr Strr (ecfF-osrA):: (same orientation) This work

9692 Spr Kmr osrA::aphII (same orientation) This work

15-02 Spr Strr Kmr (ecfF-osrA):: (same orientation), ecfQ::aphII (opposite orientation)

This work

92-29 Spr Kmr Tetr wild-type osrA chromosomally integrated into 9692 This work

92-30 Spr Kmr Tetr pSUP202pol4 chromosomally integrated into 9692 This work

92-36 Spr Kmr Tetr osrA coding for OsrA C129S+C179S chromosomally This work

CHAPTER II

 48 

integrated into strain 9692

92-37 Spr Kmr Tetr osrA coding for OsrA C179S chromosomally integrated into strain 9692

This work

92-38 Spr Kmr Tetr osrA coding for OsrA C129S chromosomally integrated into strain 9692

This work

Plasmids pGEM-T Easy Apr cloning vector Promega, Madison,

WI, USA pBluescript SK(+)

Apr cloning vector Stratagene, La Jolla, CA, USA

pBSL86 Apr Kmr (Alexeyev, 1995)

pBSL15 Apr Spr Strr (Lindemann et al., 2010)

pSUP202pol4 Tcr (pSUP202) part of the polylinker from pBluescript II KS(+) between EcoRI and PstI

(Fischer et al., 1993)

pK18mobsacB Kmr mobilizable pUC18 derivative, mob, sacB (Schäfer et al., 1994)

pKT25 Kmr expression vector, used to create translational fusion of the T25 fragment (the first 224 amino acids of CyaA) at the N-terminus of a protein

Euromedex, Souffelweyersheim, France

pUT18C Apr expression vector, used to create translational fusion of the T18 fragment (amino acids 225 to 399 of CyaA) at the N-terminus of a protein

Euromedex, Souffelweyersheim, France

pRJ0202 Tcr Kmr (pSUP202pol4) upstream region of ecfQ (EcoRI, PstI) plus PstI fragment of pBSL86 containing Kmr cassette (aphII) plus downstream region of ecfQ (PstI, BamHI)

This work

pRJ0203 Kmr (pK18mobsacB) carrying upstream region (HindIII, PstI) plus downstream region of blr3042 (PstI, XbaI)

This work

pRJ0211 Apr (pBluescript SK(+)) containing promoter region of ecfQ (EcoRV)

This work

pRJ9685 Tcr (pSUP202pol4) upstream region (EcoRI, PstI) plus downstream region of osrA (PstI, XbaI)

This work

pRJ9688 Tcr Kmr (pRJ9685) with PstI fragment of pBSL86 containing Kmr cassette (aphII)

This work

pRJ9692 Tcr Kmr ( pSUP202pol4) upstream region of osrA (EcoRI, PstI) plus PstI fragment of pBSL86 containing Kmr cassette (aphII) plus downstream region of osrA (PstI, XbaI)

This work

pRJ9715 Tcr Strr (pRJ9685) with PstI fragment of pBSL15- containing cassette (Spr/Strr)

This work

pRJ9724 Apr (pGEM-T Easy) containing ecfF-osrA including promoter region

This work

pRJ9729 Tcr (pSUP202pol4) 3`-end of ecfF plus wild-type version of osrA (PstI, XbaI)

This work

pRJ9730 Tcr (pSUP202pol4) 3`-end of bll3040 (PstI, XbaI) This work

pRJ9736 Tcr (pSUP202pol4) 3`-end of ecfF plus osrA with codons 129 and 179 mutated to TCC (resulting in OsrA C129S+ C179S) (PstI, XbaI)

This work

pRJ9737 Tcr (pSUP202pol4) 3`- end of ecfF and osrA with codon 179 mutated to TCC (resulting in OsrA C179S) (PstI, XbaI)

This work

pRJ9738 Tcr (pSUP202pol4) 3`- end of ecfF and osrA with codon 129 mutated to TCC (resulting in OsrA C129S) (PstI, XbaI)

This work

pRJ9744 Kmr (pKT25) encodes fusion of T25 at the N-terminus of wild-type OsrA (EcoRI, PstI)

This work

pRJ9746 Apr (pUT18C) encodes fusion of T18 at the N-terminus of wild-type EcfF (XbaI, PstI)

This work

pRJ9752 Kmr (pKT25) encodes fusion of T25 at the N-terminus of OsrA C129S+C179S (EcoRI, PstI)

This work

pRJ9753 Kmr (pKT25) encodes fusion of T25 at the N-terminus of OsrA This work

Reactive oxygen species-inducible ECF factors of B. japonicum

 49 

C179S (EcoRI, PstI)

pRJ9754 Kmr (pKT25) encodes fusion of T25 at the N-terminus of OsrA C129S (EcoRI, PstI)

This work

Mutant construction

Mutant strains 0202 (ecfQ), 9688 ([ecfF-osrA]) and 9692 (osrA) were constructed by

marker-exchange mutagenesis. Briefly, the 5’- and 3’-flanking regions of the genes to be

deleted were amplified by PCR using primer pairs listed in Table S2.1, cloned in the

pGEM-T Easy vector (Promega Corp., Madison, WI, USA), verified by sequencing, and

finally cloned in tandem in vector pSUP202pol4. A 1.2-kb kanamycin resistance cassette

(aphII) derived from pBSL86 (Alexeyev, 1995) was inserted between the up- and

downstream regions to generate plasmids pRJ0202 (for deletion of ecfQ), pRJ9688 (for

deletion of ecfF plus osrA), and pRJ9692 (for deletion of osrA). The resulting plasmids were

transformed into E. coli S17-1 and then mobilized by conjugation into B. japonicum wild-

type strain 110spc4 as previously described (Hahn et al., 1984). The correct genomic

structure of the resulting deletion mutants 0202 (ecfQ), 9688 ([ecfF-osrA]), and 9692

(osrA) was verified by PCR. In strains 9688 and 9692, the cassette was inserted in the same

orientation as the deleted gene(s) while in strain 0202 the cassette was oriented opposite to

the deleted ecfQ gene (Fig. 2.2A). The deletion in strains 0202, 9688 and 9692 spans the

genomic regions from position 1’134’763 to 1’135’446, 3’355’445 to 3’356’598 and

3’356’040 to 3’356’598, respectively.

Strain 15-02 (ecfQ, ecfF-osrA) was constructed as follows: first, the kanamycin resistance

cassette in strain 9688 was replaced by a spectinomycin/streptomycin resistance cassette ()

resulting in strain 9715. The cassette exchange was performed by conjugation into strain

9688 plasmid pRJ9715 whose insert corresponds to that of pRJ9688 with the kanamycin

resistance cassette replaced by the cassette inserted between the up- and downstream

regions of the ecfF-osrA genes. Mutant strain 15-02 which is deleted for ecfQ and ecfF-osrA

was obtained by using plasmid pRJ0202 to introduce the ecfQ deletion into strain 9715 via

marker-exchange mutagenesis (Fig. 2.2A). The resulting deletions in strain 15-02 span the

same genomic regions as in the individual mutants described above.

The blr3042 strain 0203 was constructed by a markerless in-frame deletion mutagenesis.

This approach was chosen because tiling analysis of microarray data indicated that blr3042 is

CHAPTER II

 50 

the promoter-proximal gene of a tricistronic operon consisting of blr3042, blr3043 and

blr3044. Flanking regions of blr3042 were cloned into the suicide plasmid pK18mobsacB to

Fig. 2.2. Genetic map of the ecfQ and ecfF loci in B. japonicum wild type and mutant strains. A. Genotype of deletion mutant strains. Indicated are genes coding for ECF factors EcfQ and EcfF (black), the putative membrane-associated anti- factor OsrA (grey), a predicted cytochrome c biogenesis protein Bll1027, a response regulator Bll1029, and for hypothetical proteins Bll3037 and Bll3040. Below the wild-type region, the genotype of mutants ecfQ (strain 0202), (ecfF-osrA) (9688), osrA (9692) and (ecfQ, ecfF-osrA) (15-02) is shown. In all mutants, almost the entire coding region of the deleted genes was replaced by a kanamycin (aphII) or spectinomycin/streptomycin (spc/str) resistance gene present on respective cassettes (light grey bars; for more details, see Materials and Methods). Genome coordinates refer to start and end points of deletions. B. Genotype of complemented derivatives of osrA mutant. Vertical black arrowheads indicate locations where the indicated plasmids comprising a tetracycline resistance gene (tet) and osrA variants used for complementation experiments were inserted. Note that the chromosomally inserted plasmids are not drawn to scale relative to the rest of the figure.

yield plasmid pRJ0203. Plasmid pRJ0203 was transferred by conjugation from E. coli S17-1

to B. japonicum 110spc4. Kanamycin resistant exconjugants were selected and grown in the

presence of 5% sucrose to force loss of the vector-encoded sacB gene. Resulting colonies

were checked for kanamycin sensitivity, and the desired deletion was confirmed by PCR. In

the resulting strain 0203 the genomic region from position 3’359’337 to 3’359’926 is deleted.

For complementation of strain 9692 (osrA) with wild-type OsrA (resulting strain: 92-29) or

mutant variants of OsrA (OsrA C129S, C179S: strain 92-36; OsrA C179S: strain 92-37;

OsrA C129S: strain 92-38) respective plasmids were chromosomally integrated (see

Table 2.1 and Fig. 2.2B). Briefly, a 1’116-bp fragment containing the 3’ end of ecfF plus

Reactive oxygen species-inducible ECF factors of B. japonicum

 51 

osrA (genome coordinates 3’355’542 to 3’356’646) was amplified by PCR using primer pairs

listed in Table S2.1, cloned in the pGEM-T Easy vector, verified by sequencing and re-

cloned into vector pSUP202pol4 to yield plasmid pRJ9729. To generate mutant versions of

osrA, we used natural restriction sites within osrA (NcoI, AscI) and a PstI site at the 3` end of

osrA, which was incorporated via PCR. A 569-bp NcoI-PstI DNA fragment corresponding to

the 3’ portion of osrA yet with osrA cysteine codons 129 and 179 mutated to TCC serine

codons was synthesized (Eurofins MWG Operon, Ebersberg, Gemany). NcoI-PstI, AscI-PstI,

or NcoI-AscI restriction fragments of the synthetic sequence were used to replace

corresponding fragments in pRJ9729 resulting in plasmids pRJ9736 (OsrA C129S, C179S),

pRJ9737 (OsrA C179S) and pRJ9738 (OsrA C129S).

Strain 92-30 served as a control and contains vector pSUP202pol4 chromosomally inserted

between osrA and bll3040. For its construction, a 451-bp fragment containing the 3’ end of

bll3040 (genome coordinates 3’356’640 to 3’357’075) was PCR amplified using the primer

pair listed in Table S2.1, cloned in the pGEM-T Easy vector, verified by sequencing and re-

cloned in pSUP202pol4 resulting in plasmid pRJ9730. Plasmids pRJ9729, pRJ9736,

pRJ9737, pRJ9738 and pRJ9730 were transformed into E. coli S17-1 and then mobilized by

conjugation into B. japonicum strain 9692 as previously described (Hahn et al., 1984)

resulting in mutant strains 92-29, 92-36, 92-37, 92-38 and 92-30, respectively. The correct

genomic structure (Fig. 2.2B) of the resulting strains was verified by PCR.

DNA work

Recombinant DNA work was performed according to standard protocols (Sambrook and

Russell, 2001). B. japonicum chromosomal DNA was isolated as described (Hahn et al.,

1984).

Analyses of stress sensitivity

Zone inhibition assays were performed as described in (Mesa et al., 2009). The following

compounds were tested at the indicated concentrations: H2O2 (10 mM, 100 mM, 1 M),

diamide (10 mM, 100 mM, 1 M), FeSO4 (1 mM, 10 mM, 100 mM), S-nitroso-N-

acetylpenicillamine (100 mM), S-nitrosoglutathione (100 mM), methylglyoxal (10 mM,

50 mM). Sensitivity to rose bengal was tested by spotting serial dilutions of bacteria from late

exponential-phase cultures onto 1% PSY agar containing rose bengal (0.1 M, 0.2 M, 0.5

M). Plates were illuminated with a tungsten light bulb (100 W, distance 95 cm, 2,000 lux)

CHAPTER II

 52 

for 1 or 2 h and incubated four days in the dark at 30°C. Control plates were not exposed to

light.

Plant growth conditions and inoculation

Soybean (Glycine max [L.] Merr. cv. Williams and cv. „Green Butterbean“), mungbean

(Vigna radiata) and cowpea (Vigna unguiculata [L.] Walp. cv. Red Caloona) seedlings were

surface-sterilized as described (Hahn et al., 1984; Göttfert et al., 1990; Lewin et al., 1990;

Gourion et al., 2009). Determination of nitrogenase activity in bacteroids were performed as

described previously (Göttfert et al., 1990).

RNA extraction and cDNA synthesis

Harvest and storage of cells, RNA extraction and cDNA synthesis were done as previously

described (Hauser et al., 2007).

Quantitative real-time PCR

Expression of genes ecfQ and ecfF was analyzed by reverse transcription-based quantitative

real-time PCR as previously described (Lindemann et al., 2007). RNA was isolated from

micro-oxically grown mid-log phase wild-type cells that were either untreated or exposed

prior harvesting to one of the following agents: 2 mM H2O2 for 10 min; 0.2 mM paraquat for

5 or 10 min; 0.5 M rose bengal plus light exposure (20,000 lux) for 10 or 180 min; exposure

to light for 60 min (control). Expression of the ecfF gene was analyzed in strains 92-29,

92-36, 92-37, 92-28 and 92-30 grown micro-oxically to mid-log phase, either untreated or

exposed to 2 mM H2O2 for 10 min prior harvesting. cDNA (0.2 to 20 ng) in combination with

2.5 µM of primers pairs 1028-RT-F and 1028-RT-R or 3038-RT-F/3038-RT-R (Table S2.1)

were used for monitoring expression of ecfQ and ecfF, respectively. The primary σ factor

gene sigA was used as a reference for normalization (primers SigA-1155R and SigA-1069F;

Lindemann et al., 2007). Data were evaluated by the method of Pfaffl (Pfaffl, 2001).

Primer extension

The transcription start site of ecfQ and ecfF were determined as previously described (Beck et

al., 1997; Mesa et al., 2005). RNA was extracted from micro-oxically grown wild-type cells

either non-stressed or treated with 2 mM H2O2 for 10 min. To determine transcription start

Reactive oxygen species-inducible ECF factors of B. japonicum

 53 

site of ecfQ cDNAs were synthesized with primers pe-1028-1 or pe-1028-2 (Table S2.1). The

same primers were used to obtain sequencing ladders from plasmid pRJ0211 (Table 2.1),

containing the promoter and part of the ecfQ coding region. Likewise, primers pe-3038-1 and

3038-RT-R and plasmid pRJ9724 were used for determination of the transcription start site of

ecfF-osrA.

Microarrays

Global transcription levels were determined as described previously using a custom-designed

Affymetrix chip (Hauser et al., 2007; Mesa et al., 2009). RNA template for cDNA synthesis

was isolated from micro-oxically grown cells of the wild type and mutant strains 0202, 9688

and 9692, and also of H2O2-treated cells (2 mM, 10 min) for the wild type and two mutant

strains (0202, 9688). For each strain and condition, a minimum of three biological replicates

was prepared. RNA extraction, cDNA synthesis, fragmentation and labeling were done as

described previously (Hauser et al., 2007; Pessi et al., 2007). GeneChip data analysis was

performed using GeneSpring GX 7.3.1 software (Agilent). After filtering for probe sets

which were called present or marginal in at least two out of three replicas, a statistical student

t-test with a P-value threshold of 0.01 was applied. Genes were considered as differentially

expressed if the fold-change value was <3 or >+3 when comparing two strains or

conditions. Data sets generated in this work are deposited in the GEO database under record

number GSE39165.

Bioinformatic analyses

Phylogenetic analysis of B. japonicum ECF factors was conducted using MEGA version 4

(Tamura et al., 2007). For alignment of nucleotide and amino acid sequences, the T-COFFEE

program was used (http://www.ebi.ac.uk/Tools/msa/tcoffee/; Notredame et al., 2000; Poirot

et al., 2003). Results were visualized with GeneDoc (Nicholas et al., 1997) and BioEdit (Hall,

1999). Database searches for regulators that might bind to the up-stream region of ecfQ were

done with the virtual footprint tool Prodoric (http://www.prodoric.de; Grote et al., 2009).

Search for consensus motifs in EcfQ- and EcfF-target promoters was performed using the

BioProspector suite (http://ai.stanford.edu/~xsliu/BioProspector/; Liu et al., 2001). DNA

sequences corresponding to 200 bp located upstream of the promoter-proximal genes listed in

Table 2.4 were used as input for the analysis. Parameters were set to search for a two-block

motif with 5 nucleotides per block and a gap of 13 to 16 nucleotides between the blocks.

CHAPTER II

 54 

Identified sequence motifs were aligned and visualized using the WebLogo tool

(http://weblogo.berkeley.edu/; Crooks et al., 2004). Genome-wide searches for putative EcfF

target promoters focused on 200 bp regions upstream of genes or operons and were

performed with the genome-scale DNA pattern search program from the RSAT collection of

sequence analysis tools (http://rsat.ulb.ac.be/; Thomas-Chollier et al., 2011). Searches for

amino acid sequence similarities were performed with BlastP

(http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins). Topology prediction for OsrA was

done with TOPCONS (http://topcons.cbr.su.se/; Bernsel et al., 2009). Protein localization

prediction via a signal peptide search was performed using SignalP 4.0

(http://www.cbs.dtu.dk/services/SignalP/; Petersen et al., 2011).

Bacterial two-hybrid system

For analysis of EcfF-OsrA interactions the BATCH system was used (Euromedex,

Souffelweyersheim, France). Translational fusions of wild-type and mutant versions of OsrA

to the C-terminal end of the T25 fragment of Bordetella pertussis adenylate cyclase (Cya)

were generated by cloning of PCR-generated PstI-EcoRI fragments into vector pKT25

(resulting in plasmids pRJ9744, pRJ9752, pRJ9753, and pRJ9754; Table 2.1). Primers are

listed in Table S2.1. For amplification of wild-type osrA, genomic DNA of B. japonicum

110spc4 was used, while mutated osrA versions were amplified with plasmids pRJ9736,

pRJ9737, or pRJ9738 as templates. In parallel, a translational fusion of EcfF to the C-

terminal end of the Cya T18 fragment was generated. To do so, a PstI-XbaI fragment

containing the wild-type ecfF gene was amplified (primer pair listed in Table S2.1, genomic

B. japonicum DNA as template) and cloned into vector pUT18C yielding plasmid pRJ9746.

All constructed plasmids were verified by sequencing. To study interaction of EcfF with

different versions of OsrA, E. coli strain BTH101 was co-transformed with pRJ9746 and one

of the plasmids expressing a T25-OsrA fusion. For -galactosidase activity assays, co-

transformed clones were inoculated into 6 ml LB medium containing appropriate antibiotics

and 0.5 mM IPTG (isopropyl -D-1-thiogalactopyranonoside). Cultures were grown for 18 h

at 30C, and aliquot(s) from 50 l to 200 l were used to determine -galactosidase activity

as described elsewhere (Karimova et al., 2000).

Reactive oxygen species-inducible ECF factors of B. japonicum

 55 

2.4 Results

Transcriptional profile of B. japonicum in response to H2O2-mediated oxidative stress

In order to identify B. japonicum genes involved in oxidative stress response, global

transcriptome analyses were performed with wild-type cells that had been treated with 2 mM

H2O2 for 10 min and with untreated wild-type cells (control). To mimic the symbiotic

environment we used micro-oxic conditions as standard condition for all microarray analysis

throughout this study. A total of 225 genes were differentially expressed in response to H2O2

(144 upregulated, 81 downregulated; see Table S2.2), with 56% of them encoding proteins of

unknown functions. Several genes known to be involved in the oxidative stress response were

upregulated, such as catalase (blr0778), hydroperoxide resistance proteins (bll4012, bll0735)

and methionine sulfoxide (MetSO) reductases (bll5855, blr7043). Notably, almost one third

(29 genes) of the H2O2-regulated genes that encode proteins of known or predicted function

are transcriptional regulators including five MarR-, four TetR-, and three LysR-type proteins.

Furthermore, transcription of genes for three σ factors was affected by H2O2 exposure. While

blr1883 encoding one of two σ54-type σ factors of B. japonicum was slightly down-regulated,

the genes for two ECF σ factors ecfQ and ecfF were strongly induced (34.8 and 14.4 fold,

respectively). The latter σ factors are the primary focus of this study, and some of their

characteristic features are summarized in Table 2.2.

Table 2.2. ECF and anti- factors studied in this work.

EcfQ EcfF OsrA

Locus name a bll1028 blr3038 blr3039

Gene symbol a carQ sigD –

Annotation a RNA polymerase factor ECF family factor hypothetical protein

No. of amino acids a 203 186 (170 b) 212

ECF group c 33 16 n.a.d

Distribution c -Proteobacteria Proteobacteria Proteobacteria

Paradigm of ECF group – C. crescentus SigF n.a.d Functional domains 70 region 2

70 region 470 region 2 70 region 4

DUF1109 (six transmembrane domains)

Genetically linked anti- factor a

– OsrA n.a.d

a According to Kaneko et al., 2002. b Based on the transcription start site mapped in this study, translation of ecfF is likely to start at a distal start codon, which leads to a shorter gene product of 170 amino acids (for details see text and Fig. 2.6A,C). c According to Staroń et al., 2009. d Not applicable.

CHAPTER II

 56 

Response of ecfQ and ecfF to different ROS

To validate microarray data obtained for ecfQ and ecfF, and to gain insight into the

expression of ecfQ and ecfF upon treatment with other sources of ROS, quantitative, cDNA-

based real-time PCR (qRT-PCR) analyses were performed. Besides treatment with H2O2, the

following two reagents were used: paraquat (methylviologen) generating superoxide, and

rose bengal in combination with light, generating singlet oxygen (1O2). The results shown in

Table 2.3 document induction of ecfQ and ecfF not only in response to H2O2 but also to

singlet oxygen. Expression of ecfQ, but not ecfF, is also elevated under treatment with

paraquat.

Table 2.3. Fold-change values of ecfQ and ecfF expression in response to different sources of ROS determined by qRT-PCR.

Experiment a Treatment Fold-change values ecfQ ecfF

1 2 mM H2O2, 10 min 104.9 30.4 18.4 4.5

2 0.2 mM paraquat, 5 min 5.9 1.1 1.5 0.2

3 0.2 mM paraquat, 10 min 8.0 1.5 0.56 0.04

4 0.5 M rose bengal, 20,000 lux, 10 min 5.1 0.5 1.1 0.1

5 0.5 M rose bengal, 20,000 lux, 180 min 15.4 0.7 8.0 0.6

6 Light only 20,000 lux, 60 min 1.1 0.5 1.5 0.4

a Micro-oxically grown wild-type cells exposed to H2O2 (experiment 1) or to paraquat (2, 3) for the indicated time were compared to untreated cells. Similarly, cells exposed to rose bengal plus light were compared to cells exposed to rose-bengal in the dark (4, 5). In the control experiment (6), light-exposed cells were compared to cells grown in the dark. For details, see Materials and Methods.

Phenotypic characterization of deletion mutants ecfQ, (ecfF-osrA), osrA, and

(ecfQ, ecfF-osrA)

To further elucidate the role of ECF σ factors EcfQ and EcfF in oxidative stress response,

mutant strains ecfQ, (ecfF-osrA) and (ecfQ, ecfF-osrA) were constructed (Fig. 2.2A). In

addition, strain osrA was generated to study the predicted function of OsrA as an anti-

factor of EcfF. Finally, a deletion strain lacking Blr3042 was constructed to elucidate the

function of this EcfQ paralog (Fig. 2.1). As the latter strain was indistinguishable from the

wild type in all phenotypic tests, it will not be further discussed in this work.

Growth kinetics of ecfQ, (ecfF-osrA), osrA and (ecfQ, ecfF-osrA) strains were

determined under oxic, micro-oxic and anoxic conditions. Growth of the mutant strains

followed a similar trend as seen with the wild type under micro-oxic conditions (data not

shown). In oxic and anoxic conditions, growth of strains (ecfF-osrA), osrA and

Reactive oxygen species-inducible ECF factors of B. japonicum

 57 

(ecfQ, ecfF-osrA) but not of ecfQ was retarded compared to the wild type (Fig. 2.3). In

anoxic conditions doubling time of strain osrA was approximately twice that of the wild

type, and the final optical density reached by this mutant was lower (Fig. 2.3B).

Fig. 2.3. Growth characteristics of B. japonicum wild type and mutant strains. Bacterial cultures of B. japonicum wild type () and mutant strains (ecfF-osrA) (○), osrA (▲), ecfQ (), and (ecfQ, ecfF-osrA) (□) were grown aerobically (A.; PSY medium) or anaerobically (B.; YEM medium). Data points are means of three cultures grown in parallel with bars representing standard errors of the means.

All mutant strains were symbiotically proficient and indistinguishable from the wild type

when tested on two different soybean varieties (Glycine max cv. Williams 82 and cv.

„Green Butterbean“), on mungbean (Vigna radiata) and on cowpea (Vigna unguiculata) (data

not shown).

Further, the sensitivity of the mutants towards different ROS was tested in filter disk assays,

on gradient plates and in spot tests. All four mutant strains showed increased sensitivity

towards oxidative stress caused by singlet oxygen both on gradient plates (data not shown)

and when spotted on PSY plates containing rose bengal (Fig. 2.4). In filter disk assays, the

mutants showed a wild-type phenotype with respect to their sensitivity to the following

compounds: (i) H2O2; (ii) diamide, a reactive electrophilic species which affects the thiol

redox balance; (iii) FeSO4 that can generate oxidative stress via the Fenton reaction; (iv)

NO-generating agents such as S-nitroso-N-acetylpenicillamine and S-nitrosoglutathione;

(v) methylglyoxal, a toxic, electrophilic compound; (vi) paraquat (methylviologen) which

causes the formation of superoxide (data not shown).

CHAPTER II

 58 

Fig. 2.4. Singlet oxygen sensitivity test. Cultures of B. japonicum wild type and mutant strains ecfQ, (ecfF-osrA), osrA and (ecfQ, ecfF-osrA) were pre-grown to early stationary phase, and aliquots of serial dilutions were spotted on plates containing 0.1 M rose bengal (two independent dilution series per strain). The control plate shown in the upper panel was incubated in the dark while the plate shown in the lower panel was light exposed (2,000 lux) for 1 h to allow generation of singlet oxygen (for more details, see Materials and Methods).

The regulon of EcfQ

Microarray analysis was used to identify potential target genes of EcfQ. To this end RNA

was isolated from the wild type and the ecfQ strain, both grown unstressed or stressed by

exposure to H2O2. Expression of nine genes differed between the wild type and the ecfQ

mutant under non-stressed conditions (four up-regulated, five down-regulated; Table S2.3A).

In H2O2-stressed cells, the number of differentially expressed genes increased to 34 with

seven genes up-regulated and 27 genes down-regulated (Table S2.3B). The latter category

might include direct targets of EcfQ given the positive regulation mode exerted by σ factors.

However, inspection of the DNA regions (200 bp) upstream of these genes did not reveal

common motifs that might function as recognition site of EcfQ. Notably, two thirds of the

differentially regulated genes encode hypothetical or functionally unknown proteins. Among

genes with predicted functions are blr0337 and blr3534 which code for a subunit of putative

carbon monoxide dehydrogenases and are both down-regulated in the mutant.

The promoter region of ecfQ and of other genes coding for class 33 ECF σ factors is

conserved

When we had a closer look at the 13 -proteobacterial genes representing the class 33 of ECF

σ factors to which EcfQ belongs (Staroń et al., 2009) we made several observations: (i) in

almost every organism of this group, except Mesorhizobium loti, there are two genes coding

for this type of ECF σ factor; (ii) consistently, one of them has a predicted anti-σ factor gene

Reactive oxygen species-inducible ECF factors of B. japonicum

 59 

in its proximity, but for the other, a predicted anti-σ factor gene is absent (EcfQ together with

five other class 33 factors belongs to the latter category); (iii) by aligning the upstream

regions of the six genes of this second group, a striking pattern of sequence conservation was

observed (Fig. 2.5A).

To obtain information on the relative position of these elements in the promoter, the 5’ end of

ecfQ mRNA was determined by primer extension, using RNA isolated from the B. japonicum

wild type grown under different conditions (Fig. 2.5B). The results of reverse transcription

revealed the ecfQ transcription start point at a C located 44 nucleotides upstream of the

annotated ecfQ start codon (Fig. 2.5B). In agreement with the microarray and qRT-PCR

analyses, the amount of cDNA derived from RNA in H2O2-treated cells (lane 2) was higher

than the amount derived from untreated cells (lane 1). Putative −35 and −10 promoter boxes

were identified, forming the consensus GCAGAC and TAACAAT, respectively, however,

the spacing between the motifs is unusually long (20 nt).

Several additional stretches of nucleotides are also conserved in the upstream region of ecfQ

and the other five σ factor-coding genes which belong to the same group. A stretch reading

GAAAC is repeated several times in the upstream region (boxes labeled −26, −59, and −80 in

Fig. 2.5A). At box −80, the GAAAC sequence is part of the inverted repeat TGTTTC-N17-

GAAACA (Fig. 2.5A). Database searches with the virtual footprint tool Prodoric to find

regulators that might bind to this region revealed no obvious candidates. Also, the identified

region does not resemble any described binding sites for several B. japonicum regulators such

as Irr, Fur, FixK2, and RegR (Rudolph et al., 2006; Lindemann et al., 2007; Mesa et al.,

2008).

CHAPTER II

 60 

Fig. 2.5. Analysis of the ecfQ promoter region. A. Alignment of the upstream regions of six -proteobacterial genes coding for class 33 ECF σ factors, which lack associated anti-σ factor genes. Numbers on the right of each line refer to the position of the last nucleotide in the line within the corresponding upstream region to the annotated translational start sites. The transcription start site of ecfQ is labeled “+1”. Shaded in black, dark grey, and light grey are nucleotides which are identical in all, 80%, and 60% of the sequences, respectively. Marked are the putative core promoter regions (–35, –10) and several conserved motifs (boxes –26, –59, and –80; for details, see text). GI numbers of the proteins encoded by the adjacent genes are as follows: Nitrobacter hamburgensis X14 (NH), 92119140; Nitrobacter winogradskyi Nb-255 (NW), 75677236; Bradyrhizobium japonicum USDA 110 (BJ), 27376139; Bradyrhizobium sp. BTAi1 (B), 148252297; Rhodopseudomonas palustris CGA009 (RP), 39937850; and Nitrobacter sp. Nb-311A (N), 85713893. B. 5’ end mapping of ecfQ. For primer extension total RNA of the wild-type strain grown under the following conditions was used: micro-oxic (lane 1), and micro-oxic, treated with 2 mM H2O2 for 10 min (lane 2). Extension products obtained with the [32P]-labeled primers pe-1028-1 and pe-1028-2 were separated on a 6 % denaturing polyacrylamide gel (only results obtained with primer pe-1028-1 are shown). The sequencing ladder was generated with plasmid

Reactive oxygen species-inducible ECF factors of B. japonicum

 61 

pRJ0211 and primer pe-1028-1 (for more details, see Materials and Methods and Table S2.1). Part of the predicted promoter region is shown on the right, with the experimentally assigned transcription start site indicated with an arrowhead. The sequence of the ecfQ promoter region is shown below the picture. The determined 5’ end of the transcript is indicated by an arrowhead, and the annotated translation start site is underlined and printed in bold face. Putative −10 and −35 regions are shaded in grey. The N-terminus of the EcfQ protein sequence is indicated in one-letter code.

The regulon of EcfF

To identify genes possibly controlled by factor EcfF, microarray analyses were performed

with the (ecfF-osrA) mutant strain. In micro-oxically grown, unstressed mutant cells,

expression of only three genes was slightly up-regulated apart from the obvious decrease of

expression of the two deleted genes (Table S2.4A). This indicated that in the wild type, EcfF

is mainly inactive under these growth conditions. Upon H2O2 treatment, expression of 22

genes (including ecfF and osrA) differed between mutant and wild-type cells confirming that

EcfF-dependent transcription is activated by H2O2 exposure (Table S2.4B). Notably, all

regulated genes had negative fold-change values, which is in line with the role of EcfF as a

positive regulator and suggests that there are direct target genes in this group. Other than ecfF

and osrA no genes were common to the lists of differentially expressed genes in unstressed

and stressed cells.

To examine the predicted function of OsrA as an anti- factor, we also performed microarray

experiments with the osrA mutant strain. We used unstressed, micro-oxically grown cells in

these experiments because we assumed that even in unstressed cells the absence of the anti-σ

factor OsrA should result in up-regulation of EcfF-dependent genes if the function of OsrA in

the wild type were to inhibit the activity of EcfF under these conditions. Expression of 39

B. japonicum genes (including ecfF and osrA) was altered in the osrA strain, with 24 genes

(more than 60%) encoding hypothetical or unknown proteins (Table S2.5). Only 3 genes had

negative fold-change values (one of them being the deleted osrA gene) while the large

majority of 36 genes was up-regulated, likely due to hyperactivity of EcfF caused by the

absence of its anti-σ factor. Elevated expression of ecfF (18.8 fold) in the osrA background

suggested that the ecfF-osrA operon is autoregulated. Interestingly, not only ecfF but also its

paralog ecfS (blr4928) was more highly expressed (3.8 fold) in the mutant pointing to

potential cross-talk between the two σ factor−anti-σ factor systems.

When the expression data generated with stressed cells of the (ecfF-osrA) mutant was

compared with that of unstressed osrA cells, nine genes (apart from the mutated genes)

showed a regulatory pattern that is expected for EcfF-OsrA being a cognate σ factor−anti-σ

CHAPTER II

 62 

factor pair, i.e., down-regulation in the (ecfF-osrA) mutant and up-regulation in the osrA

mutant (Table 2.4). Except for blr7044, all genes of this group belong to the H2O2-inducible

genes (Table S2.2). Notably, genes bll5855, blr7043, blr7044 all encode predicted peptide

MetSO reductases.

Table 2.4. B. japonicum genes whose expression differed in the (ecfF-osrA) and the osrA relative to the wild type a.

Gene no.b Fold change Known or predicted gene product c

wt (ecfF-osrA) osrA

bll1027 7.8 −15.4 89.5 putative cytochrome c biogenesis protein

bll1026 11.4 −20.1 92.4 hypothetical protein

bsr4431 10.7 −15.9 20.0 hypothetical protein

bll5855 7.5 −6.2 20.6 peptide methionine sulfoxide reductase

bll6527 4.7 −4.7 78.3 hypothetical protein

blr7043 8.5 −7.0 13.5 peptide methionine sulfoxide reductase

blr7044 − −2.9 5.4 peptide methionine sulfoxide reductase

bsr7045 3.2 −2.9 4.1 hypothetical protein

blr7741 19.3 −28.3 54.2 hypothetical protein

ecfF 14.4 −60.6 18.8 ECF factor EcfF

osrA 8.1 −210.1 −19.9 anti- factor OsrA

a Cells were grown micro-oxically and those of strain (ecfF-osrA) were exposed to 2 mM H2O2 for 10 min prior to harvest. Wild-type cells grown under the respective conditions served as reference in both experiments. Listed are genes with an absolute fold-change value of >3 in at least one of the mutants and >2 in the other mutant. b Nomenclature according to Kaneko et al., 2002. Putative operons are shown in italics with co-transcribed promoter-distal genes indented to the right. c Gene description according to Kaneko et al., 2002 with modifications.

Taking into account the predicted operon structure for bll1027-26, ecfF-osrA and blr7043-45,

the genes listed in Table 2.4 comprise a total of seven transcription units with promoters that

are primary candidates for being direct EcfF targets. When we searched in a 200-bp window

upstream of the respective start codons for common putative promoter elements we could

indeed identify a conserved GTAAC(g,a)–N14-15–(c,t)CG(t,a) motif (Fig. 2.6A,B). This

element is remarkably similar to the tGTAACc–N16–CGAA promoter sequence that was

proposed for group 16 of ECF factors (Staroń et al., 2009) to which EcfF belongs. The

predicted EcfF target promoter preceding ecfF-osrA was confirmed by primer extension

experiments (Fig. 2.6C). Indeed, a transcript starting at a C located 6 bp downstream of the

predicted –10 box of ecfF was detected in cells exposed to H2O2 but not in untreated cells.

The experimentally detected transcription start site overlaps the ecfF ATG start codon

annotated in Rhizobase (Kaneko et al., 2002) which argues for the more distal translational

Reactive oxygen species-inducible ECF factors of B. japonicum

 63 

start codon as indicated in Fig. 2.6C. Likewise, the annotated GTG start codon of bll5855

might be incorrect because the predicted –10 box of the respective promoter is located only

8 bp upstream of this start codon (Fig. 2.6A). When the EcfF consensus motif (GTAAC(g,a)–

N14-15–(t,c)CG(t,a); Fig. 2.6B) was used as a query for a genome-wide in silico search (for

details, see Materials and Methods) a total of 18 hits were identified of which 7 are associated

with the genes or operons listed in Table 2.4. The remaining 11 motifs precede genes that did

not fulfill the selection criteria applied to the genes included in Table 2.4. Those 11 hits either

represent false positives, or EcfF-mediated regulation of the associated genes is masked by

other unknown regulatory effects.

Fig. 2.6. B. japonicum EcfF-target promoter motif located in the upstream regions of EcfF/OsrA-regulated transcription units. A. Alignment of nucleotide sequences located upstream of seven EcfF-regulated transcription units. Names of promoter-proximal genes are indicated on the left. Shaded in black are the identical nucleotides, enlightened are nucleotides which are identical in more than 80%, and more than 60% of the sequences. Consensus is shown in bold under the alignment. Annotated start codons are shown in lower-case with that of ecfF (boxed) being reannotated based on the result of the transcript mapping data shown in Fig. 1.6C (for details see text). B. WebLogo of the EcfF-target promoter base on the alignment from panel A. C. 5’ end mapping of ecfF. For primer extension, total RNA of the wild-type strain grown under the following conditions was used: micro-oxic (lane 1), and micro-oxic, treated with 2 mM H2O2 for 10 min (lane 2). Extension products obtained with the [32P]-labeled primers pe-3038-1 and 3038-RT-R were separated on a 6 % denaturing polyacrylamide gel (only results obtained with primer pe-3038-1 are shown). The sequencing ladder was generated with plasmid pRJ9724 and primer pe-3038-1 (for details, see Materials and Methods and Table S2.1). Part of the predicted promoter region is shown on the left, with the experimentally assigned transcription start site +1 indicated with an arrowhead. Because the ATG translation start codon of ecfF as annotated in Rhizobase (Kaneko et al., 2002; dashed-line rectangle) overlaps the transcription start, the more distal, alternative start codon seems more likely (solid-line rectangle).

CHAPTER II

 64 

In vivo interaction of EcfF and OsrA

If EcfF and OsrA functioned as a typical cognate factor−anti- factor pair they ought to

interact directly at the protein level. We have used a bacterial two-hybrid system (BACTH

system; Karimova et al., 1998; Karimova et al., 2000) to further evaluate this model.

Plasmids pRJ9746 and pRJ9744 encoding protein fusions of EcfF and OsrA to adenylate

cyclase Cya subdomains T18 and T25, respectively, were constructed (Fig. 2.7A).

Cotransformation of E. coli BTH101 cells with these plasmids resulted in strain 1 which

showed significant -galactosidase activity (Fig. 2.7B). By contrast, no -galactosidase

activity above background was detected in E. coli BTH101 cells that contained either of the

fusion plasmid in combination with the empty vector of the other hybrid plasmid (data not

shown). This indicated that interaction of EcfF with OsrA enabled functional

complementation of the T18 and T25 adenylate cyclase domains.

Fig. 2.7. Interaction between EcfF and OsrA monitored in a bacterial two-hybrid system. A. Schematic representation of analyzed hybrid proteins. B. pertussis adenylate cyclase fragments T18 and T25 (oval shaped) were translationally fused to factor EcfF (black rectangle) and anti- factor OsrA (grey rectangle; wild-type (wt) or mutant variants), respectively. Plasmids encoding respective proteins were transformed into E. coli BTH101 in the indicated combinations to yield strains 1 to 4. B. E. coli cultures were grown for 18 h at 30 C and assayed for -galactosidase activity. Control strain 5 containing vectors pKT25 and pUT18C was used to determine background activity. Shown are mean values and standard deviations derived from a representative experiment with four independent cultures per strain.

Conserved cysteine 129 of OsrA might be required for interaction with EcfF

Amino acid sequence alignment of OsrA with orthologous putative anti- factors associated

with group-16 factors in other proteobacteria revealed two highly conserved cysteine

residues. These residues are located at positions 129 and 179 of OsrA, and they are the only

cysteines present in this protein (Fig. 2.8 and 2.9).

Reactive oxygen species-inducible ECF factors of B. japonicum

 65 

Fig. 2.8. Topology model of OsrA. The figure shows the predicted topology of anti- factor OsrA and localization of cysteine residues 129 and 179 which are highly conserved among anti- factors associated with class 16 ECF factors. Numbers refer to amino acid positions at the beginning and the end of six transmembrane-spanning domains. The OsrA portion from amino acid 10 to 212 is annotated as DUF1109 (domain of unknown function). Results presented in this work suggest that

Cys-129 (open circle) is needed for OsrA to interact with EcfF while Cys-179 (solid circle) is required for the response to hydrogen peroxide. Black bars mark 12 methionine residues of which 8 are predicted to map to periplasmic loops.

Fig. 2.9. Alignment of proteobacterial OsrA homologs. Numbers on the right refer to the position of the last amino acid in the line within the corresponding protein sequence. Shaded in black, dark grey, and light grey are

CHAPTER II

 66 

nucleotides which are identical in all, 80%, and 60% of the sequences, respectively. Arrowheads indicate conserved cysteines. GI numbers of the proteins are as follows: Bradyrhizobium japonicum USDA 110 (BJ) OsrA – 81738347 and TmrS – 81736761, Mesorhizobium loti MAFF303099 (ML) 81779508, Agrobacterium tumefaciens str. C58 (AT) 15889542, Rhizobium etli CFN 42 (RE) 123508957, Sinorhizobium meliloti 1021 (SM) 81813033, Burkholderia pseudomallei (BP) 81379776, Pseudomonas putida KT2440 (PP) 81442010, Dechloromonas aromatica RCB (DA) Daro_1521 – 71907153 and Daro_2589 – 71908203.

To probe the function(s) of the conserved cysteines, mutant variants of OsrA (C129S, C179S,

C129S+C179S) were fused to T25 (Fig. 2.7A) and tested for two-hybrid interaction in

combination with the T18-EcfF fusion protein. In strain 3 harboring the T25-OsrA C179S

fusion, -galactosidase activity reached about 70% of the reference strain 1 (T25-OsrA)

whereas in strains 2 (T25-OsrA C129S, C179S) and 4 (T25-OsrA C129S) only background

activity was detected (Fig. 2.7B). Assuming that the point mutations did not drastically alter

protein expression levels or stability, these results imply that cysteine 129 of OsrA, but not

cysteine 179, is required for interaction with EcfF.

Cysteine 179 of OsrA is required for the H2O2 response of EcfF in B. japonicum

To validate the data obtained with the E. coli-based two-hybrid system in B. japonicum and

for further functional analysis of the conserved cysteines of OsrA, expression of the

autoregulated ecfF gene was monitored in derivatives of the osrA strain complemented with

wild-type or mutant variants of OsrA. To this end, single copies of wild-type osrA and mutant

variants (present on pSUP202pol4-based plasmids) were chromosomally integrated into the

osrA strain. The resulting strains (osrA complemented with wild-type OsrA, OsrA

C129S+C179S, OsrA C179S, or OsrA C129S) and the control strain osrA containing the

pSUP202pol4 vector integrated in the chromosome (Fig. 2.2B), were grown under micro-oxic

conditions without or with stress exposure (2 mM H2O2 10 min) prior to cell harvest. RNA

was isolated and reverse-transcribed into cDNA which was used for quantitative real-time

PCR. From the results shown in Table 2.5 we conclude that (i) the complementation strategy

is effective because wild-type OsrA restores the normal ecfF expression pattern (cf. Table

2.3); (ii) OsrA C129S and OsrA C129S+C179S are not functional because the respective

strains showed a very similar ecfF expression pattern as the control strain which lacks OsrA;

(iii) C179 of OsrA is crucial for H2O2 responsiveness because ecfF expression in the strains

complemented with OsrA C179S or wild-type OsrA was very similar under non-stressed

conditions; yet in the former strain, no induction occurred after H2O2 exposure.

Reactive oxygen species-inducible ECF factors of B. japonicum

 67 

Table 2.5. Regulation of ecfF in a B. japonicum osrA background complemented with wild-type or mutant versions of osrA.

Strain OsrA variant tested for complementation of osrA

Fold-change values a No stress H2O2-stress

92-30 b – 16.3 3.4 11.6 2.0 92-29 wild-type 1 15.3 3.0 92-38 C129S 19.8 6.4 20.5 6.1 92-37 C179S 1.2 0.3 1.1 0.3 92-36 C129S, C179S 14.8 5.6 22.1 6.7

a Cells were grown micro-oxically without stress or were exposed to 2 mM H2O2 for 10 min prior to harvest. Expression levels of ecfF in different backgrounds were determined by qRT-PCR and expressed as fold-change values ± standard errors relative to the expression detected in the pseudo wild-type strain 92-29 under non-stress conditions. Data are based on three technical replicates of a representative experiment which was repeated in three biological replicates. For details, see Materials and Methods. b Control strain containing vector pSUP202pol4 chromosomally integrated downstream of the osrA::aphII locus (see Fig. 2.2B).

CHAPTER II

 68 

2.5 Discussion

Rhizobia are exposed to oxidative stress originating from ROS that are generated either

intrinsically in aerobic metabolism or by legume host plants during rhizobial infection (Pauly

et al., 2006). Here we have analyzed the transcriptional response of B. japonicum cells to

oxidative stress. Special emphasis was given to the two ECF factors EcfQ and EcfF

because (i) their transcription was strongly induced upon exposure to ROS, and (ii) ECF

factors are typical regulators in the bacterial stress response. Hydrogen peroxide exposure of

free-living cells which were grown micro-oxically to mimic symbiotic conditions resulted in

altered transcription of more than 200 genes. Many of them are functionally uncharacterized,

others are related to oxidative stress or encode transcriptional regulators. Among the latter

category are five MarR-type and three LysR-type regulators which are involved in the

oxidative stress response in various other bacteria (Christman et al., 1985; VanBogelen et al.,

1987; Buchmeier et al., 1997; Bussmann et al., 2010; Hoopman et al., 2011).

In recent studies, effects of H2O2 and paraquat exposure on transcription in aerobically grown

B. japonicum cells were described (Donati et al., 2011; Jeon et al., 2011). A comparison of

that study with our own results revealed that genes induced by H2O2 in both oxic and

micro-oxic cells comprise those encoding hydroperoxide resistance proteins (bll4012,

bll0735), putative epoxide hydrolase 1 (bll3418), a putative glutathione S-transferase

(bll7849), and the ECF factors mentioned above (ecfQ, ecfF). Fold-change values differed

substantially between the two studies which is likely due to different growth conditions and

different microarray platforms. Remarkably, the gene for catalase KatG (blr0778), whose role

in protection from oxidative stress in B. japonicum is well documented (Panek and O'Brian,

2004), appeared to be induced by hydrogen peroxide treatment only in micro-oxically but not

in aerobically grown cells. We speculate that blr0778 is induced even in untreated aerobic

cells due to endogenous ROS production that might be higher in oxic cells than in micro-oxic

cells.

ECF factors EcfQ and EcfF were functionally characterized by phenotypic analysis of

respective mutants and microarray analyses. Deletion mutants ecfQ, (ecfF-osrA), osrA

and (ecfQ, ecfF-osrA) were more sensitive to singlet oxygen, and thus confirmed that both

factors are indeed involved in oxidative-stress tolerance. Singlet oxygen sensitivity of the

mutants was moderately increased and restricted to this type of ROS. This might be due to an

intrinsic tolerance of B. japonicum and/or the existence of functionally redundant,

Reactive oxygen species-inducible ECF factors of B. japonicum

 69 

EcfQ-/EcfF-independent ROS-protective systems. This hypothesis is in line with the finding

that the regulons of EcfQ and EcfF showed only limited overlap with the large group of

H2O2-responsive genes (Fig. 2.10), and it also could explain the symbiotic proficiency of the

mutants.

Fig. 2.10. Venn diagram of H2O2-responsive genes in the B. japonicum wild-type strain and the regulons of ECF factors EcfQ and EcfF. Hydrogen peroxide-responsive genes were identified by transcriptome analyses of untreated wild-type cells with cells exposed to 2 mM H2O2 for 10 min. Similarly, regulons of EcfQ and EcfF were determined by comparing the transcriptome of ecfQ and (ecfF-osrA) mutant strains 0202 and 9688, respectively, both treated with 2 mM H2O2 for 10 min, with identically stressed wild-type cells. All strains we grown micro-oxically. Size and overlap of the regulons are drawn to scale with numbers of differentially expressed genes (3-fold change cut-off) indicated in the respective segments. Total number and numbers of down- (↓) and up-regulated genes (↑) are shown next to individual regulons.

In the absence of stress, both factors are probably inactive because under these conditions

regulation of only few genes was altered in the deletion mutants, possibly by indirect means

as none of them was differentially expressed in stressed cells (Tables S2.3 and S2.4).

Nevertheless, growth of the mutant lacking OsrA was impaired even without externally

applied oxidative stress, particularly under anoxic conditions, which indicates that

hyperactivity of EcfF might be deleterious.

Transcriptional control of ecfQ and ecfF is likely to occur via different mechanisms. The

presence of conserved motifs within the ecfQ promoter region points to the involvement of a

yet unidentified transcriptional regulator, a model that is compatible with the absence of an

anti- factor gene associated with ecfQ. By contrast, the ecfF-osrA operon appears to be

autoregulated, which is typical for cognate and anti- factors genes organized in an operon.

The difference in the regulatory mode may also be responsible for the differential response of

these factor genes to treatment with paraquat.

EcfQ and EcfF control rather small and largely distinct groups of genes. Common to both

regulons are only four clustered genes (bll0331–0333; blr0337) of which bll0333 encodes a

precursor of a putative alcohol dehydrogenase and blr0337 a subunit of a predicted carbon

CHAPTER II

 70 

monoxide dehydrogenase. Notably, genes blr0335 and blr0336 encoding two additional

subunits of the latter enzyme are also controlled by EcfF. The regulon of EcfQ is functionally

rather undefined because almost 70% of its members are hypothetical or unknown proteins.

By contrast, more than 70% of the proteins encoded by the genes belonging to the EcfF

regulon have a (predicted) functional annotation. Strikingly, half of them are oxidoreductases

including MetSO reductases Bll5855 and Blr7043 whose genes were induced by H2O2

treatment. A third MetSO reductase, Blr7044, that is induced 2.9-fold by H2O2 exposure, is

yet another member of the EcfF regulon as its expression was inversely affected in the

(ecfF-osrA) and osrA strains (Table 2.4). Thus, at least three of five MetSO reductases

encoded in the B. japonicum genome are H2O2 responsive and controlled by EcfF/OsrA

(Blr0834 and Bll6260 being the remaining two). Neisseria gonorrhoeae (Gunesekere et al.,

2006) and Neisseria meningitidis (Hopman et al., 2010) represent two other bacterial species

where genes encoding MetSO reductases are controlled by an ECF −anti- factor pair.

For many bacterial species the function of MetSO reductases as antioxidant repair enzyme is

well documented (Moskovitz et al., 1995; Singh and Moskovitz, 2003; Alamuri and Maier,

2004; Vattanaviboon et al., 2005; Atack and Kelly, 2008; Zhao et al., 2010; Jeon et al., 2011;

for a review, see Moskovitz, 2005). Repair of oxidized methionines by MetSO reductases

depends on protein electron donors such a thioredoxin (for a review, see Ezraty et al., 2005).

Based on its putative signal sequence Blr7043 is predicted to localize to the periplasm. Thus,

for Blr7043 to function additional components are required which transfer electrons across

the cytoplasmic membrane and deliver them to this enzyme. DsbDC of E. coli is a well

characterized example which is needed for reduction or isomerization of disulfide bonds in

the periplasm (Kadokura and Beckwith, 2010). Based on the predicted topology and domain

structure of Bll1026 (membrane-anchored periplasmic thioredoxin) and Bll1027 (membrane

protein with a DsbD core domain), we speculate that Blr7043 in B. japonicum may receive

electrons via these proteins whose genes are co-regulated with blr7043 by EcfF/OsrA.

In vivo interaction of EcfF with OsrA was demonstrated with a bacterial two-hybrid system in

E. coli. These experiments revealed that a conserved cysteine at position 129 of the anti-

factor OsrA is crucial for interaction with EcfF, and this result was further substantiated by

the finding that replacement of this residue led to constitutive EcfF activity in B. japonicum.

The predicted localization of C129 in the cytoplasmic membrane argues against this amino

acid making direct contact with EcfF. However, it is possible that C129 is crucial for keeping

Reactive oxygen species-inducible ECF factors of B. japonicum

 71 

OsrA in an interaction-competent conformation and that its replacement with serine

interfered with this function.

The second conserved cysteine of OsrA, C179, is probably involved in sensing and/or

transducing the stress signal because inhibition of EcfF by the OsrA C179S variant was not

released when B. japonicum cells were stressed with hydrogen peroxide. Taking into account

our data and the predicted OsrA topology (Fig. 2.8) we propose that oxidative stress detected

via periplasm-exposed C179 is signaled to the cytoplasmic portion of OsrA where it leads to

the release of bound EcfF. Although cysteines are redox-active amino acids and thus well

suited to monitor oxidative stress, C179 of OsrA is not necessarily the primary signal input

site. Inspection of the OsrA amino acid sequence revealed a striking accumulation of eight

methionine residues in two predicted periplasmic loops (Fig. 2.8), with only two of them

being conserved in the closest B. japonicum paralog TmrS (Blr4929), the anti- factor of

EcfS (Blr4928) (Fig. 2.1, Fig. 2.9; Stockwell et al., 2012). Given that three MetSO reductases

are controlled by EcfF/OsrA it is tempting to speculate that the presence of multiple

methionines in OsrA makes this regulator intrinsically responsive to molecules that elicit

methionine oxidation.

Amino acids that are critical for oxidative stress signalling were identified previously in other

anti- factors which, however, are not homologs of OsrA. Specifically, conserved histidine or

cysteine residues in the ChrR anti- factor proteins of C. crescentus, R. sphaeroides, and N.

meningitidis are required for proper regulation of the respective E proteins in response to

organic hydroperoxide (Lourenço and Gomes, 2009; Hopman et al., 2010; Greenwell et al.,

2011). Likewise, in M. xanthus blue-light responsiveness of the membrane-bound CarQ

anti- factor is controlled by another membrane-associated protein, CarF, whose anti-anti

factor activity depends on several histidine residues (Fontes et al., 2003; Galbis-Martínez et

al., 2008).

Our study contributes to the characterization of an ECF factor family found in

B. japonicum. With EcfQ and EcfF studied here and the previously described factors EcfG

(Gourion et al., 2009) and EcfS (Stockwell et al., 2012), functional information is now

available for a total of four ECF factors of this bacterium. While the general stress response

regulator EcfG contributes to both free-living and symbiotic traits, functions of EcfS are

largely confined to symbiosis and those of EcfQ and EcfF to the free-living state. The

function of the EcfQ paralog Blr3042 remains enigmatic as it turned out to be dispensable

CHAPTER II

 72 

under all tested conditions. Challenging goals for future studies include the characterization

of signals, mechanisms of their transduction, and functions of target genes of EcfQ and EcfF.

Reactive oxygen species-inducible ECF factors of B. japonicum

 73 

2.6 Supplementary material

Table S2.1. Primers used in this study.

Primer pairs Sequencea Size and properties of resulting PCR products

Used for

up-1028-F up-1028-R

GCGCGAATTCCGAACTGGCCAATGC GCGCGGATCCTTCCTTGGACCAAAGTG

593 bp upstream region of ecfQ

pRJ0202

down-1028-F down-1028-R

GCAAGGATCCAGCGGCCCTATTCCC GAAGCGGCCGCACGTTCGGATCGAAGTC

684 bp downstream region of ecfQ

pRJ0202

up-3042-F up-3042-R

CCTTAAGCTTGATCGTGCCGTCATAG CCAACTGCAGAACTTACCGCAGTCATAC

588 bp upstream region of blr3042

pRJ0203

down-3042-F down-3042-R

CCAACTGCAGCTGGCCGAACTGCTGAAG CCAATCTAGACGCGCTGGTCGAAAG

514 bp downstream region of blr3042

pRJ0203

up-3038-F up-3038-R

GAATTCGTCGAGATCGTTGAGCTGGTCG CTGCAGCATGCAATTCGGCCGCTCTTTC

778 bp upstream region of ecfF

pRJ9688, pRJ9715

up-3039-F up-3039-R

GAATTCGACGCCGTGGCGTGACGATA CTGCAGGCCGCAAGCGAGCGAATGAG

842 bp upstream region of osrA

pRJ9692

down-3039-F down-3039-R

CTGCAGTAGCCGCGATCGGAGCGCTG TCTAGAGGTGATCGAGGTCGCAGGAC

875 bp downstream region of osrA

pRJ9688, pRJ9692, pRJ9715

3039-2G-F1 3039-2G-R1

ATACTGCAGGGATGGATACCGATCA ATAGAATTCTCTAATACCGCAACAC

660 bp coding region of osrA

pRJ9744, pRJ9752-54

3038-2G-F1 3038-2G-R1

AATCTGCAGGATGATGAGGGCGCGGGT ATATCTAGACTAGTGGTCCCGCAGTTTG

580 bp coding region of ecfF

pRJ9746

3039Compl-F4 3039Compl-R4

CATCTAGAGCAGTCACGCCGGTGCT GACTGCAGGCCTAATACCGCAACACC

1116 bp 3`end of ecfF and osrA

pRJ9729, pRJ9736-38

ComplC-F4 ComplC-R4

CATCTAGAATTAGGCCGCGGGCGT GACTGCAGTCGAGCGTGGTCCAGGAAG

451 bp 3`end of bll3040

pRJ9730

1028-RT-F 1028-RT-R

GAGATCATCACCCTCGTCTACTAC CATAGAACATCCGCGTCTTCAC

100 bp internal region of ecfQ

qRT-PCR

3038-RT-F 3038-RT-R

CGTATCATCGCCTGTTGAAG GCCAACAGAATCTCCTGCAC

121 bp internal region of ecfF

qRT-PCR

1028-seq-F 1028-seq-R

GAATGAATTCGATCCGGGACCCATAGC ATATGGATCCCGCAGGATGAAGCGGTA

584 bp upstream region of ecfQ and 5’ end of ecfQ

pRJ0211

3089Compl-F3 3089Compl-R3

CATCTAGAAGAGTGACGCCGGTGCT GACTGCAGCCTAATACCGCAACACCC

1657 bp upstream region of ecfF, ecfF and osrA

pRJ9724

pe-1028-1 pe-1028-2

CCAGAAGCATATCGTCCGAAGTG ACGTCCGGTTGCCGTCGGCAATGC

located in ecfQ primer extension

pe-3038-1 GCGTGACTGCCTTCAACA located in ecfF

a Engineered restriction enzyme sites are underlined.

CHAPTER II

 74 

Table S2.2. List of 225 B. japonicum genes which are differentially expressed after treatment with 2 mM H2O2 for 10 min in wild-type cells grown micro-oxically in PSY medium as compared to untreated wild-type cells.a

Gene no.b Fold change Known or predicted function of gene productc

Transcriptional regulators

bll1028 34.8 factor EcfQ

blr3420 30.9 transcriptional regulatory protein PadR-like family

blr2577 20 transcriptional regulatory protein TetR family

bll2775 19.6 transcriptional regulatory protein LysR family

bll4010 15.9 transcriptional regulatory protein PadR-like family

ecfF 14.4 ECF factor EcfF

osrA 8.1 anti- factor OsrA

blr0736 14.4 transcriptional regulatory protein MarR family

bll2319 13.8 transcriptional regulatory protein GntR family

blr4013 10.6 transcriptional regulatory protein MarR family

blr3963 10.3 transcriptional regulatory protein LysR family

blr3814 8.1 transcriptional regulatory protein Crp family

bll1150 6.3 transcriptional regulatory protein LysR family

blr5345 6.1 transcriptional regulatory protein ArsR family

bll2604 5.2 transcriptional regulatory protein MarR family

bll5689 5.2 transcriptional regulatory protein TetR family

blr5122 4.7 transcriptional regulatory protein TetR family

blr4826 4.4 LexA repressor

blr0347 4.2 transcriptional regulatory protein MarR family

blr6277 4.1 transcriptional regulatory protein GntR family

blr8125 3.4 transcriptional regulatory protein AsnC family

blr3952 3.3 transcriptional regulatory protein TetR family

bll3916 3 transcriptional regulatory protein LacI family

blr1883 -3 RNA polymerase sigma-54 subunit

blr1880 -3.1 transcriptional regulatory protein LuxR family

blr7666 -3.2 transcriptional regulatory protein AraC family

bll4976 -3.4 transcriptional regulatory protein MarR family

bll5886 -3.4 two-component hybrid sensor and regulator

bll2094 -3.9 transcriptional regulatory protein GntR family

blr1216 -7.2 transcriptional regulatory protein Ferric uptake regulator family

Other categories

bll3418 205 putative epoxide hydrolase 1 (EC 3.3.2.3)

bll4012 53.8 organic hydroperoxide resistance protein

bll0735 43.6 organic hydroperoxide resistance protein

blr6636 30.3 ATP synthase subunit

blr2776 29.4 putative patatin-like phospholipase

bll7849 16.4 putative glutathione S-transferase

bll7983 15.7 glutathione transferase

bll3948 13.7 monocarboxylate MFS permease

blr2578 9.6 MFS permease

Reactive oxygen species-inducible ECF factors of B. japonicum

 75 

blr0778 9.6 catalase

bll4280 9.1 probable ThiJ-PfpI family protein

blr7043 8.5 peptide methionine sulfoxide reductase

bll1027 7.8 putative cytochrome c biogenesis protein

bll5865 7.6 putative multidrug resistance protein

bll5855d 7.5 peptide methionine sulfoxide reductase

bll7034 6.7 MDO-like protein

bll5121 5.7 major facilitator superfamily transporter

bll0339 5.5 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)

bll7217 5.4 probable site-specific integrase-recombinase

bll3903 5 putative multidrug resistance protein

bll3902 3.6 AcrB-AcrD-AcrF family protein

blr2826 5 dihydroxy-acid dehydratase

blr5698 4.4 similar to protein-export membrane protein SecD

blr7431 4.2 excinuclease ABC subunit B

blr2489 3.9 anthranilate synthase component I and II

blr2490 3.3 adenine phosphoribosyltransferase

bll0346 3.8 putative oxidoreductase

blr3130 3.8 serine protease DO-like precursor

blr7466 3.8 ribonuclease

bll7427 3.7 probable ligninase

bll5755 3.5 RecA protein

bll4731 3.4 probable threonine dehydratase (EC 4.2.1.16)

blr8158 3.3 murein endopeptidase

blr6637 3.3 putative cytochrome c

bll0414 3.2 3-isopropylmalate dehydrogenase

blr1535 3.2 probable holliday junction nuclease

bll1418 3.1 methionine synthase

blr2322 3.1 citrate utilization protein B

blr2696 3 cytochrome c peroxidase

bll7906 3 putative ferredoxin

blr1727 -3 HupH protein homolog

blr5827 -3.1 flagellar basal-body rod protein

blr1964 -3.1 putative sugar hydrolase

blr1756 -3.3 nitrogenase metalloclusters biosynthesis protein

blr4211 -3.3 putative cell division inhibitor protein

bsl5256 -3.3 probable polar flagellar motor switch protein

bsl5811 -3.3 flagellar biosynthetic protein

bll0718 -3.3 putative transporter

blr4932 -3.3 putative cation efflux system protein

blr1755 -3.4 R. etli iscN homolog

blr7922 -3.5 ABC transporter substrate-binding protein

blr1759 -3.6 FeMo cofactor biosynthesis protein

blr7759 -3.6 ornithine decarboxylase

blr2143 -3.6 similar to cytochrome P450-family protein

CHAPTER II

 76 

blr6579 -3.6 ABC transporter ATP-binding protein

blr0162 -3.6 50S ribosomal protein L28

bll1906 -3.8 N-acetyltransferase NrgA homolog

bll6680 -3.9 bacterioferritin

bll6950 -4 putative pyrophosphorylase (EC 2.4.2.-)

blr2036 -4 oxidoreductase

bll2388 -4 cytochrome c2

blr1719 -4.2 molybdenum transport system permease protein

bll2007 -4.9 coproporphyrinogen III dehydrogenase

blr2131 -5 probable oxygenase

blr2106 -5.8 L-ectoine synthase

bll5814 -6.4 probable flagellar basal-body rod protein

bll5813 -7.1 flagellar basal-body rod protein

bll5812 -3.7 flagellar hook-basal body complex protein

Hypothetical proteins and proteins of unknown function

bll3417 193.6 hypothetical protein

bll7429 131.5 unknown protein

bsl7428 173.2 hypothetical protein

bll2772 129.8 unknown protein

bll3419 98.3 hypothetical protein

bll3416 74.7 unknown protein

bll4011 71.1 hypothetical protein

bll5457 49.3 hypothetical protein

blr7542 47.2 unknown protein

bsr4694 38.4 unknown protein

bll2771 36.4 hypothetical protein

blr0349 20.5 unknown protein

blr4067 19.7 hypothetical protein

blr2773 19.5 unknown protein

blr7741 19.3 hypothetical protein

bll1068 19.1 hypothetical protein

bsl0348 16.4 unknown protein

bll5344 16.4 hypothetical protein

bll5343 5.2 hypothetical protein

blr2774 15.8 hypothetical protein

bsl5107 15.7 unknown protein

bll0506 14 hypothetical protein

bll0505 15.5 hypothetical protein

blr2500 13.6 hypothetical protein

blr7943 13.5 hypothetical protein

bsl7850 12.2 unknown protein

blr1151 11.5 hypothetical protein

bll1026 11.4 hypothetical protein

blr2320 11.2 hypothetical protein

blr2321 6.6 hypothetical protein

Reactive oxygen species-inducible ECF factors of B. japonicum

 77 

bll3504 11.2 unknown protein

bll2645 11.1 hypothetical protein

bsr4431 10.7 hypothetical protein

bll0176 10.5 unknown protein

bll4461 10.3 unknown protein

bsl5486 8.8 unknown protein

blr3596 8 hypothetical protein

blr7338 7.7 hypothetical protein

blr4673 7.7 hypothetical protein

bll2701 7.1 unknown protein

blr2519 7 hypothetical protein

bll2595 6 unknown protein

bsr2594 5.6 unknown protein

bsl4436 5.4 unknown protein

bsl2593 5.4 hypothetical protein

blr0321 5.4 unknown protein

blr0485 5.4 hypothetical protein

blr4468 5.3 unknown protein

bll5259 5.3 hypothetical protein

bsl3813 5.2 unknown protein

bsl4436 4.9 unknown protein

bll1305 4.7 unknown protein

bll0734 4.7 hypothetical protein

bll6527 4.7 hypothetical protein

bll0661 4.4 hypothetical protein

bll5329 4.4 hypothetical protein

blr2827 4 hypothetical protein

bsr7111 4 unknown protein

blr8110 3.9 hypothetical protein

bll2845 3.9 unknown protein

blr0354 3.8 hypothetical protein

bll4712 3.8 unknown protein

blr1018 3.7 hypothetical protein

bll7128 3.6 unknown protein

bsl3012 3.4 hypothetical protein

bll3594 3.4 hypothetical protein

blr0248 3.4 unknown protein

bsl4593 3.3 unknown protein

bll3089 3.3 unknown protein

bll0555 3.2 hypothetical protein

blr4680 3.2 hypothetical protein

bsl6617 3.2 unknown protein

bsr7045 3.2 hypothetical protein

bll0839 3.1 hypothetical protein

blr4562 3.1 unknown protein

CHAPTER II

 78 

blr7005 3.1 hypothetical protein

blr2777 3 hypothetical protein

blr5947 3 unknown protein

bsl2206 3 hypothetical protein

bsl4014 3 unknown protein

bll7907 3 hypothetical protein

bsl1870 -3 unknown protein

bll5843 -3 hypothetical protein

blr2668 -3 hypothetical protein

bll7538 -3.1 hypothetical protein

bsr1758 -3.1 unknown protein

blr7050 -3.1 unknown protein

bsr7087 -3.1 unknown protein

blr7502 -3.1 unknown protein

bsr3073 -3.2 hypothetical protein

blr5768 -3.2 unknown protein

bsl2070 -3.2 hypothetical protein

bll7394 -3.2 hypothetical protein

bll5520 -3.2 hypothetical protein

blr1867 -3.3 hypothetical protein

bll0737 -3.4 hypothetical protein

bll5679 -3.4 hypothetical protein

bsl4522 -3.4 unknown protein

blr2044 -3.4 unknown protein

blr4624 -3.4 hypothetical protein

bll1980 -3.4 hypothetical protein

blr1879 -3.5 hypothetical protein

bll7386 -3.5 unknown protein

blr1433 -3.7 hypothetical protein

blr2975 -3.8 hypothetical protein

blr1992 -3.8 unknown protein

bll6468 -3.9 hypothetical protein

blr4988 -4 unknown protein

blr1850 -4.2 unknown protein

blr1851 -3.3 unknown protein

blr1954 -4.4 unknown protein

bll6909 -4.5 hypothetical protein

bll6577 -4.7 hypothetical protein

bll7405 -4.8 hypothetical protein

blr4174 -5.2 hypothetical protein

bsr4175 -5.2 hypothetical protein

bsl2574 -5.7 unknown protein

bll1767 -5.7 hypothetical protein

blr1130 -5.8 hypothetical protein

blr1726 -5.9 unknown protein

Reactive oxygen species-inducible ECF factors of B. japonicum

 79 

bsr2010 -6.1 unknown protein

blr2011 -5.2 unknown protein

bsr1907 -6.1 unknown protein

bll1981 -6.2 hypothetical protein

bll2085 -6.5 hypothetical protein

blr8234 -6.5 unknown protein

bll3193 -8.7 unknown protein

a Differentially expressed genes were selected based on a 3-fold change cut-off. b Nomenclature according to Kaneko et al., 2002. Numbers of genes organized in putative operons are indicated in italics with co-transcribed promoter-distal genes indented to the right. c Gene description according to Kaneko et al., 2002 with modifications. d bll5855 is annotated by Kaneko et al., 2002 as a hypothetical protein. BLAST analysis indicated that it codes for a conserved domain (MsrB) present in peptide methionine sulfoxide reductases.

CHAPTER II

 80 

Table S2.3. List of B. japonicum genes differentially expressed in the ecfQ strain compared to the wild type. Cells were grown micro-oxically and harvested after no further treatment (A) or after exposure to 2 mM H2O2 for 10 min (B).a

A Gene no.b Fold change Known or predicted gene productc

blr1214 8.1 putative lipoprotein

bll6888 7.9 putative porin

bll3735 3.8 putative outer-membrane immunogenic protein precursor

blr2455 3.1 isocitrate lyase (EC 4.1.3.1)

bsl1637 -3.2 unknown protein

bll1858 -3.3 hypothetical protein

bll2004 -3.3 unknown protein

blr8234 -3.4 unknown protein

bll1028 -24.6 factor EcfQ

B Gene no.b Fold change Known or predicted gene productc

blr1215 4.6 hypothetical protein

bll0342 4.4 fumarylacetoacetase (EC 3.7.1.2)

bsr6573 4.0 unknown protein

blr5231 3.8 sigma32-like factor

bll6888 3.7 putative porin

blr6572 3.3 unknown protein

bll0343 3.2 homogentisate 1,2-dioxygenase

bll0333 -3.0 probable alcohol dehydrogenase precursor

blr0337 -3.0 putative carbon monoxide dehydrogenase medium chain (EC 1.2.99.2)

trnN-GUU-1 -3.1 tRNA-Asn(GGT)

blr4468 -3.2 unknown protein

blr2519 -3.3 hypothetical protein

bll2494 -3.3 hypothetical protein

bll4712 -3.4 unknown protein

bll2845 -3.4 unknown protein

bll0331 -3.5 two-component response regulator

blr0321 -3.8 unknown protein

bll4173 -3.8 unknown protein

blr3534 -3.8 putative carbon monoxide dehydrogenase medium chain (EC 1.2.99.2)

bll0332 -4.4 unknown protein

blr0354 -4.5 hypothetical protein

blr5698 -4.7 similar to protein-export membrane protein SecD

blr2520 -4.8 hypothetical protein

bll3594 -5.1 hypothetical protein

bll1305 -5.2 unknown protein

blr7338 -5.3 hypothetical protein

bsl5107 -9.3 unknown protein

blr3596 -9.5 hypothetical protein

bll0176 -9.9 unknown protein

Reactive oxygen species-inducible ECF factors of B. japonicum

 81 

blr0349 -12.2 unknown protein

bsl0348 -12.7 unknown protein

bll2645 -13.5 hypothetical protein

blr7943 -38.8 hypothetical protein

bll1028 -203.3 factor EcfQ a Differentially expressed genes were selected based on a 3-fold change cut-off. b Nomenclature according to Kaneko et al., 2002. c Gene description according to Kaneko et al., 2002.

CHAPTER II

 82 

Table S2.4. List of B. japonicum genes differentially expressed in the ecfF-osrA strain compared to the wild type. Cells were grown micro-oxically and harvested after no further treatment (A) or after exposure to 2 mM H2O2 for 10 min (B).a A Gene no.b Fold change Known or predicted gene productc

blr0149 3.3 cytochrome o ubiquinol oxidase subunit II

bll6876 3.1 flagellar basal-body rod protein

bll0148 3.1 MFS permease

ecfF -7.7 ECF factor EcfF

osrA -64.9 anti- factor OsrA B Gene no.b Fold change Known or predicted gene productc

bll2542 -3.0 quinolinate synthetase A

bll5259 -3.1 hypothetical protein

blr7489 -3.1 lactoylglutathione lyase

blr7490 -3.2 hypothetical protein

blr7491 -3.6 putative 2-keto-gluconate dehydrogenase

blr0335 -3.2 putative carbon monoxide dehydrogenase small chain

blr2489 -3.3 anthranilate synthase component I and II

bll6527 -4.7 hypothetical protein

blr0336 -4.7 carbon monoxide dehydrogenase large chain

bll4784 -4.8 aldehyde dehydrogenase

blr0337 -5.0 putative carbon monoxide dehydrogenase medium chain (EC 1.2.99.2)

bll0333 -5.0 probable alcohol dehydrogenase precursor

bll0332 -9.3 unknown protein

bll0331 -5.5 two-component response regulator

bll5855d -6.2 peptide methionine sulfoxide reductase

blr7043 -7.0 peptide methionine sulfoxide reductase

bll1027 -15.4 putative cytochrome c biogenesis protein

bll1026 -20.1 hypothetical protein

bsr4431 -15.9 hypothetical protein

blr7741 -28.3 hypothetical protein

ecfF -60.6 ECF factor EcfF

osrA -210.1 anti- factor OsrA a Differentially expressed genes were selected based on a 3-fold change cut-off. b Nomenclature according to Kaneko et al., 2002. Numbers of genes organized in putative operons are indicated in italics with co-transcribed promoter-distal genes indented to the right. c Gene description according to Kaneko et al., 2002 with modifications. d bll5855 is annotated by Kaneko et al., 2002 as a hypothetical protein. BLAST analysis indicated that it codes for a conserved domain (MsrB) present in peptide methionine sulfoxide reductases.

Reactive oxygen species-inducible ECF factors of B. japonicum

 83 

Table S2.5. List of B. japonicum genes differentially expressed in micro-oxically grown cells of the osrA mutant strain compared to the wild type.a

Gene no.b Fold change Known or predicted gene productc

bll1027 89.5 putative cytochrome c biogenesis protein

bll1026 92.4 hypothetical protein

bll6527 78.3 hypothetical protein

blr7741 54.2 hypothetical protein

bll5855d 20.6 peptide methionine sulfoxide reductase

bsr4431 20.0 hypothetical protein

ecfF 18.8 ECF factor EcfF

osrA -19.9 anti- factor OsrA

bll0506 16.6 hypothetical protein

bll0505 26.6 hypothetical protein

blr7043 13.5 peptide methionine sulfoxide reductase

blr7044 5.4 peptide methionine sulfoxide reductase

blr2776 13.1 putative patatin-like phospholipase

bll1025 10.9 unknown protein

blr7434 5.8 hypothetical protein

bll0507 5.6 hypothetical protein

blr1349 4.9 hypothetical protein

bsl4407 4.7 unknown protein

blr7936 4.6 hypothetical protein

blr0834 4.2 peptide methionine sulfoxide reductase

bsr7045 4.2 hypothetical protein

bll6529 4.1 unknown protein

bsl6528 3.0 hypothetical protein

blr6167 4.0 unknown protein

blr0305 3.9 unknown protein

ecfS 3.8 ECF factor EcfS

bll2508 3.8 hypothetical glutathione S-transferase like protein

bll3384 3.8 ABC transporter ATP-binding protein

bll7811 3.8 hypothetical protein

bll1466 3.4 unknown protein

blr1469 3.3 hypothetical protein

blr3677 3.3 putative monooxygenase component

blr3678 3.2 putative oxidoreductase

bsl1473 3.2 hypothetical protein

bsr5508 3.1 peptide methionine sulfoxide reductase

blr3680 3.1 hypothetical protein

bll0304 3.1 two-component response regulator

bll6454 -3.0 ABC transporter permease protein

blr4463 -3.3 probable ABC transporter substrate-binding protein a-d see footnote of Table S2.4.

 

  

 

  

CHAPTER III Further investigations with EcfF and OsrA  

CHAPTER III

 86 

3.1 Abstract

In chapter II, it was demonstrated that the ECF factor EcfF and its cognate anti- factor

OsrA play an important role in the oxidative stress response of Bradyrhizobium japonicum. In

this chapter, we show that ecfF and osrA form one transcriptional unit and present data

supporting further the operons within the EcfF-regulon. The list of EcfF-target genes is

further verified here by the determination of the EcfF-regulon under aerobic conditions and

its comparison to the data obtained from micro-oxically grown cells. In chapter II, the

incorrect annotation of the ecfF start codon was documented. Here, arguments for a more

likely, alternative ecfF translational start site are presented together with data showing that

OsrA interacts with the respective shorter EcfF version. In addition, using the bacterial two-

hybrid system, we demonstrate that the N-terminal extension of EcfF is required but not

sufficient, for interaction with OsrA. Moreover, using an antibody against methionine

sulfoxide we confirm that OsrA is located at the cellular membrane, and we attempt to collect

evidence that methionine residues of OsrA are oxidized in B. japonicum cells exposed to

hydrogen peroxide. Finally, the attempts to develop tools for analysis of the EcfF-OsrA

system at the protein level are presented here, and construction of (ecfS-tmrS) and (ecfF-

osrA; ecfS-tmrS) deletion mutants is described.

 

Further investigations with EcfF and OsrA

 87 

3.2 Introduction

Sets of genes in prokaryotic and some eukaryotic organisms are often organized in operons in

order to coordinate gene expression. Thus, genes involved in one metabolic pathway,

required for an adequate response to stress stimuli, or a specific cellular function tend to be

transcriptionally linked and co-regulated. In regulatory cascades, genes coding for

components of two-component systems or ECF factors and regulatory cognate anti-

factors are also often situated in operons. The primary advantage of cotranscription of

‐anti- pairs is probably the tight regulation of factor activity. Since anti- factors usually

control activity of factors through protein-protein interaction, stoichiometric amounts of

and anti- factor molecules need to be maintained in a cell under conditions when the

factor is inactive. In this chapter, the question of ecfF-osrA cotranscription was addressed.

In Chapter II, incorrect annotation of the ecfF start codon was documented, which raised the

question where translation of ecfF starts. Predicted N-termini of EcfF orthologs were

compared and set into relation with the mapped transcriptional start site of ecfF. In order to

initiate peptide synthesis, bacterial ribosomes require binding to a ribosome binding site

located upstream of the start codon. The space between the transcriptional start site and the

start codon of a gene needs to be more than about 14 nucleotides (Shine and Dalgarno, 1975;

Vellanoweth and Rabinowitz, 1992; Blattner et al., 1997; Shultzaberger et al., 2001). Taking

this into account, we analyzed the N-terminus of EcfF and the 5’-end of the corresponding

gene.

To date, a number of ECF factor-anti- factor pairs have been characterized in various

bacterial species but networks of ECF factors have been described only in a few organisms.

An example for this type of analysis is the ECF factor network of Mycobacterium

tuberculosis (Park et al., 2008; Barik et al., 2010; Sklar et al., 2010; White et al., 2010).

Specifically, six out of ten ECF factors encoded in the M. tuberculosis genome were

characterized, with 4 of them being involved in oxidative stress response. An attempt to

analyze the functional relationship between ECF factors of Bradyrhizobium japonicum was

previously made by L. Reutimann in our laboratory by construction and phenotypic

characterization of blr3042 and (ecfQ, blr3042) mutant strains. factors Blr3042 and

EcfQ are the close paralogs with 62% amino acid sequence identity and thus may have

similar or overlapping functions. However, it was found that only strains deleted for ecfQ

showed phenotypic defects while mutants lacking blr3042 were indistinguishable from the

CHAPTER III

 88 

wild type (Chapter II and Reutimann, 2010). Thus, the function of the EcfQ paralog Blr3042

remains unknown.

Among ECF factors of B. japonicum, EcfS is the closest homolog to EcfF with 35% amino

acid sequence identity. Respective anti- factors TmrS and OsrA show 34% amino acid

sequence identity. Both factor-anti- factor pairs belong to the group 33 of ECF- factors

classification (Staroń et al., 2009). Interestingly, despite these similarities, the two systems

control different cellular functions. EcfF-OsrA is involved in ROS-stress response

(Chapter II), while the EcfS-TmrS system is important for the establishment of a functional

symbiotic interaction (Stockwell et al., 2012). The expression of ecfF and ecfS is differently

regulated in response to ROS-stress. As shown in Chapter II, ROS induce transcription of

ecfF but not of ecfS. In contrast, copper excess causes an increase of both ecfF and ecfS

transcription (4.0 and 5.4 folds, respectively; V. Murset, unpublished data).

Microarray analysis of the osrA strain grown aerobically (shown in this chapter) or

micro-oxically (Chapter II) indicated that expression of ecfS is slightly induced (3.2 and 3.8

fold, respectively) in this strain, which may indicate crosstalk between the EcfF-OsrA and

EcfS-TmrS pairs. To study potential similarities and differences in the function(s) of

EcfF-OsrA and EcfS-TmrS, (ecfS-tmrS) and (ecfF-osrA; ecfS-tmrS) deletion mutants were

constructed. 

Further investigations with EcfF and OsrA

 89 

3.3 Materials and methods

Bacterial strains and growth conditions

Bacterial strains used in this work are listed in Table 3.1. Escherichia coli and B. japonicum

strains were cultivated as described in section 2.3.

Table 3.1. Bacterial strains and plasmids used in this work.

Strain or plasmid Relevant genotype or phenotype Source / Reference

E. coli strains

DH5 supE44 lacU169 (80 lacZM15) hsdR17 recA1 gyrA96 thi-1 relA2

BRL, Gaithersburg, USA

S17-1 Smr Spr hsdR (RP4-2 kan::Tn7 tet::Mu; integrated into the chromosome)

(Simon et al., 1983)

BTH101 F- cya-99 araD139 galE15 galK16 rpsL1 (Strr) hsdR2 mcrA1 mcrB1

Euromedex, Souffelweyersheim, France

BL21 (ER2566) fhuA2 lacZ::T7 gene1 Ion ompT gal sulA11R(mcr-73::miniTn10-Tets)2 dcm R(zgb-210::Tn10-Tets) endA1 (mcrC-mrr)144::IS10

New England Biolabs Inc., Ipswich, MA, USA

Rosetta (DE3) F- ompT hsdSb (rB- mB-) gal dcm (DE3) pRARE Novagene Inc., Nottingham, UK

B. japonicum strains 110spc4 Spr wild type (Regensburger and

Hennecke, 1983) 0202 Spr Kmr ecfQ::aphII (opposite orientation) This work

9688 Spr Kmr (ecfF-osrA)::aphII (same orientation) This work

9692 Spr Kmr (osrA::aphII) (same orientation) This work

9708 Spr Kmr (ecfS-tmrS)::aphII (same orientation) This work

9709 Spr Kmr (ecfS-tmrS)::aphII (opposite orientation) This work

9715 Spr Strr (ecfF-osrA):: (same orientation) This work

15-02 Spr Strr Kmr (ecfF-osrA):: (same orientation), ecfQ::aphII (opposite orientation)

This work

15-08 Spr Strr Kmr (ecfF-osrA):: (same orientation), (ecfS-tmrS)::aphII (same orientation)

This work

15-09 Spr Strr Kmr (ecfF-osrA):: (same orientation), (ecfS-tmrS)::aphII (opposite orientation)

This work

Plasmids pBSL86 Apr Kmr (Alexeyev, 1995)

pBSL15 Apr Spr Strr (Lindemann et al., 2010)

pSUP202pol4 Tcr (pSUP202) part of the polylinker from pBluescript II KS(+) between EcoRI and PstI

(Fischer et al., 1993)

pKT25 Kmr expression vector, used to create translational fusion of the T25 fragment (the first 224 amino acids of CyaA) to the N-terminus of a protein

Euromedex, Souffelweyersheim, France

pKNT25 Kmr expression vector, used to create a translational fusion of the T25 fragment (the first 224 amino acids of CyaA) to the C-terminus of a protein

Euromedex, Souffelweyersheim, France

CHAPTER III

 90 

pUT18C Apr expression vector, used to create a translational fusion of the T18 fragment (amino acids 225 to 399 of CyaA) to the N-terminus of a protein

Euromedex, Souffelweyersheim, France

pET-28a(+) Kmr expression vector, used to create the fusion of His6-tag at the C-terminus of a protein

Novagen Inc., Nottingham, UK

pRJ0053 Apr (pTXB1), encodes FixK2 fused to an intein encoding a chitin-binding domain

(Bonnet, 2011)

pRJ9700 Kmr (pET-28a(+)), encodes EcfF with C-terminal His6-tag (pET-28a(+) digested with NcoI, HindIII; insert digested with PagI, HindIII)

This work

pRJ9707 Tcr (pSUP202pol4) with upstream region of ecfS (EcoRI, PstI) plus downstream region of tmrS (PstI, XbaI)

This work

pRJ9708 Tcr Kmr (pRJ9707) with PstI fragment of pBSL86 containing Kmr cassette (aphII) oriented from downstream to upstream region

This work

pRJ9709 Tcr Kmr (pRJ9707) with PstI fragment of pBSL86 containing Kmr cassette (aphII) oriented from upstream to downstream region

This work

pRJ9744 Kmr (pKT25), encodes fusion of T25 at the N-terminal of wild-type OsrA (EcoRI, PstI)

This work

pRJ9745 Kmr (pKNT25), encodes fusion of T25 at the C-terminal of wild-type OsrA (PstI, HindIII)

This work

pRJ9746 Apr (pUT18C), encodes fusion of T18 at the N-terminal end of wild-type EcfF (XbaI, PstI)

This work

pRJ9747 Apr (pUT18C), encodes fusion of T18 to the N-terminal end of wild-type EcfF fragment from Arg-44 to His-186 amino acid (XbaI, PstI)

This work

pRJ9748 Apr (pUT18C), encodes fusion of T18 to the N-terminal end of wild-type EcfF fragment from Met-1 to Pro-54 amino acid (XbaI, PstI)

This work

pRJ9758 Kmr (pKT25), encodes fusion of the T25 to the N-terminal end of the N-terminally His6-tagged version of wild-type OsrA (EcoRI, PstI)

This work

pRJ9759 Apr (pUT18C), encodes fusion of T18 to the N-terminal end of wild-type OsrA (XbaI, PstI)

This work

pRJ9761 Kmr (pKT25), encodes fusion of the T25 to the N-terminal end of the full length EcfF (EcoRI, PstI)

This work

pRJ9763 Apr (pUT18C), encodes fusion of T18 to the N-terminal end of wild-type EcfF fragment from Met-17 to His-186 amino acid (XbaI, PstI)

This work

DNA work

Recombinant DNA work was performed as described in section 2.3.

Mutant construction

Mutant strains 9708 and 9709 ([ecfS-tmrS]) were constructed by marker-exchange

mutagenesis and differ in the orientation of the kanamycin resistance cassette. The 5’- and 3’-

flanking regions of the genes to be deleted were amplified by PCR using primer pairs listed in

Table S3.1, cloned in the pGEM-T Easy vector, verified by sequencing, and finally cloned in

tandem in vector pSUP202pol4 resulting in pRJ9707. A 1.2-kb kanamycin resistance cassette

Further investigations with EcfF and OsrA

 91 

(aphII) derived from pBSL86 was introduced in both directions between the up- and

downstream regions. The resulting plasmids pRJ9708 and pRJ9709 were transformed into E.

coli S17-1 and then mobilized by conjugation into B. japonicum wild-type strain 110spc4 as

previously described (Hahn et al., 1984). The correct genomic structure of the resulting

deletion mutants 9708 and 9709 was verified by PCR. In strain 9708 the cassette was inserted

in the same orientation as the deleted genes, while in strain 9709 the cassette was oriented in

the opposite direction (Fig. 3.1). The deletion in 9708 and 9709 spans the genomic region

from position 5’463’172 to 5’464’321.

Fig. 3.1. Genetic map of the ecfF and ecfS loci in B. japonicum wild type and mutant strains. Indicated are genes coding for ECF factors EcfF and EcfS (black), the putative membrane-associated anti- factors OsrA and TmrS (grey), and hypothetical proteins Bll3037, Bll3040, Bll4927 and Blr4930. Below the wild-type region, the genotype of mutants 9708, 9709 (ecfS-tmrS) and 15-08, 15-09 (ecfF-osrA; ecfS-tmrS) is shown. In all mutants, almost the entire coding region of the deleted genes was replaced by a kanamycin (aphII) or spectinomycin/streptomycin () resistance gene present on respective cassettes (light grey bars; for more details, see text). Genome coordinates refer to start and end points of deletions.

Strains 15-08 and 15-09 (ecfF-osrA, ecfS-tmrS) were constructed using plasmids pRJ9708

and pRJ9709 to introduce the ecfS-tmrS deletion into strain 9715 (ecfF-osrA) described in

Chapter II via marker-exchange mutagenesis (Fig. 3.1). The resulting strains 15-08 and 15-09

differ in orientation of the kanamycin resistance cassette similarly to mutant strains 9708 and

9709. Apart from ecfS-tmrS they lack the ecfF-osrA region from position 3’355’445 to

3’356’598. Due to time restrictions no phenotypic analyses could be performed with the

ecfS-tmrS mutants.

CHAPTER III

 92 

Microarrays

RNA template for cDNA synthesis was isolated from aerobically grown cells of the mutant

strains 9688 and 9692. Microarray analysis was performed as described in section 2.3.

Bacterial two-hybrid system

Translational fusions of the T25 fragment of Bordetella pertussis adenylate cyclase (Cya) to

the C-terminal and N-terminal end of OsrA were generated by cloning PCR-generated

PstI-EcoRI and PstI-HindIII fragments into vectors pKT25 and pKNT25, respectively

(resulting plasmids are pRJ9744, pRJ9745; Table 3.1). Primers used for amplification are

listed in Table S3.1. Similarly, using vector pKT25, a translational fusion of OsrA harboring

an N-terminal His-tag (incorporated by PCR using primers 3039-2G-F3 and 3039-2G-R1;

Table S3.1) to the C-terminus of the T25 fragment was generated (resulted in pRJ9758).

Also, a translational fusion of OsrA to the C-terminal end of the T18 fragment was generated

by cloning a PCR-generated XbaI-PstI fragment into pUT18C (resulted in pRJ9759).

In parallel, translational fusion of the Cya T18 fragment to the N-terminal end of full length

and shorter versions of EcfF were generated. To do so, a PstI-XbaI fragment encoding the

full version of ecfF gene, or portions thereof coding for fragments corresponding to Arg-44 to

His-186 (C-terminal amino acid), Met-1 to Pro-54 and Met-17 to His-186 amino acids were

amplified and cloned into vector pUT18C yielding plasmids pRJ9746, pRJ9747, pRJ9748

and pRJ9763, respectively (Table 3.1). A translational fusion of the T25 fragment to the N-

terminal end of full-length EcfF was constructed using a PCR-generated EcoRI-PstI fragment

cloned in pKT25 (resulting in pRJ9761). All constructed plasmids were verified by

sequencing. To study the interactions between proteins, E. coli strain BTH101 was co-

transformed with different combinations of plasmids expressing a T25-derived fusion and a

T18-derived fusion. For -galactosidase activity assays, co-transformed clones were

inoculated into 6 ml LB medium containing appropriate antibiotics and 0.5 mM IPTG

(isopropyl -D-1-thiogalactopyranoside). Cultures were grown for 18 h at 30C, and aliquots

from 50 l to 200 l were used to determine -galactosidase activity as described elsewhere

(Karimova et al., 2000).

Further investigations with EcfF and OsrA

 93 

cDNA-based PCR of the ecfF-osrA junction

Wild-type B. japonicum cells were grown micro-oxically until the optical density at 600 nm

reached 0.5. Cells were then H2O2-treated (2 mM H2O2 for 10 min) and harvested by

centrifugation. RNA extraction and cDNA synthesis were done as described previously

(Hauser et al., 2007; Pessi et al., 2007). During cDNA production, a negative control reaction

in which reverse transcriptase was omitted was run in parallel. As a template for PCR

amplification of the ecfF-osrA junction, 200 ng of cDNA was used. Primers 3038-OP-F1 and

3039-RT-R used for amplification are listed in Table S3.1. Additional control reactions

contained H2O or 100 ng of chromosomal wild-type DNA as template. One-third of each

reaction was separated on a 1% agarose gel and visualized by ethidium bromide staining.

Expression of a His-tagged EcfF version

To generate a C-terminally His-tagged EcfF variant, a PCR-generated PagI-HindIII DNA

fragment coding EcfF was ligated with NcoI- and HindIII-digested pET-28a(+). The resulting

plasmid pRJ9700 (Table 3.1) was verified by sequencing. Either E. coli BL21 (ER2566) or

Rosetta cells were transformed with pRJ9700. Overnight precultures were used to inoculate

main cultures in 200 ml of LB with kanamycin. Cultures were grown at 37C until they

reached an optical density at 600 nm of 0.4. At this point, expression of the His-tagged EcfF

was induced by addition of IPTG to a final concentration of 0.5 mM and the cultures were

transferred to 30C. After 4 h, cells were harvested by centrifugation, resuspended in 2 ml of

Ni2+-NTA binding buffer (20 mM Tris-HCl pH 7.9, 500 mM NaCl, 10% glycerol, 10 mM

imidazole with one tablet of Complete Protease Inhibitor Cocktail (Roche, Switzerland) per

20 ml) and disrupted by three passages through a French press at 9,000 psi.

Preparation of membrane proteins

E. coli or B. japonicum cells were disrupted by three and five passages through a French

pressure cell at 9,000 psi, respectively. Cell debris were removed by centrifugation at 28,000

x g for 30 min at 4C. Membrane pellets were then collected by ultracentrifugation at

129,000 x g for 90 min at 4C. The pellets were resuspended in 50 mM Tris-HCl, pH 7.5 by

slow stirring overnight at 4C.

CHAPTER III

 94 

Determination of protein concentration

Protein concentration of resuspended membrane fractions or purified proteins was determined

with the Bradford method (Bradford, 1976), using a Bio-Rad assay (Bio-Rad Laboratories,

Richmond, CA, USA) with bovine serum albumin as the standard.

Protein electrophoresis and visualization

Protein samples were separated by electrophoresis on 12% sodium dodecyl sulfate

polyacrylamide (SDS-PAGE) gels (Laemmli, 1970). Gels were stained for 15-30 min with

Coomassie Blue solution (0.2% Coomassie Brilliant Blue R250, 50% methanol, 10% acetic

acid) at room temperature (RT). For destaining, gels were placed in Coomassie destaining

solution (25% methanol, 10% acetic acid) and incubated with gentle shaking at RT for 2-3 h.

Sample preparation for immunostaining using an anti-MetSO antibody

Protein samples of interest (purified FixK2 derivative, membrane fraction of E. coli cells or

total lysates of B. japonicum strains) were incubated for 1 h at RT either in presence of

100 mM H2O2 or in 1% of -mercaptoethanol in 50 mM Tris-HCl pH 7.5 buffer for intended

protein oxidation or reduction, respectively. Control reactions lacking any oxidizing/reducing

agents were also incubated for 1 h at RT. Protein samples were then mixed with loading dye

for SDS-PAGE and 500 ng of FixK2, 60 g of E. coli membrane proteins or 60 g of

B. japonicum lysates were loaded per lane on a SDS-PAGE gel.

Immunoblot analysis

Samples were separated by SDS-PAGE and transferred to a nitrocellulose membrane

(Amersham Bioscience, Buckinghamshire, UK) as described previously (Loferer et al.,

1993). The membrane was blocked overnight at 4C in 5% non-fat milk in TBS-Tween

(50 mM Tris-HCl, 150 mM NaCl, 0.1% Tween 20, pH 7.6). The blocked membrane was

incubated for 2 h at RT with anti-His4 monoclonal antibody (Qiagen, Hilden, Germany)

diluted 1:2000 in TBS-Tween or with crude serum (anti-EcfF peptide or anti-OsrA peptide)

diluted 1:200, 1:500, or 1:1000 in TBS-Tween. The membrane then was washed with

TBS-Tween and incubated for 2 h at RT with a horseradish peroxidase-labeled goat

anti-mouse antibody (when the anti-His4 antibody was used) or goat anti-rabbit antibody

(when the anti-EcfF or anti-OsrA sera were used) (Bio-Rad Laboratories, Richmond, CA,

Further investigations with EcfF and OsrA

 95 

USA) both diluted 1:3500 in TBS-Tween. After five final washing steps with TBS-Tween,

protein bands with bound immunoglobulins complexes were detected using SuperSignal

West Pico Chemiluminescent Substrate (Pierce Chemicals, Rockford, IL, USA). Methionine

sulfoxide immunoblot analysis was performed using a Methionine Sulfoxide Immunoblotting

Kit (Cayman Chemical, Michigan, MI, USA) according to the manufacturer’s protocol.

Generation of polyclonal anti-EcfF and anti-OsrA sera

For generation of antisera against EcfF and OsrA, two peptides with the sequences

H2N-MMRARVRGREDEWTG-COOH and H2N-MDTDQLIRSLAADNA-COOH

corresponding to the N-terminal 15 amino acids of each protein were synthesized. Each

synthetic peptide was injected into two rabbits. Both peptide synthesis and antiserum

production were custom made by Eurogentec (Liege, Belgium). Immunisation was performed

according to the Eurogentec speedy protocol. A medium bleed and the final bleed were

obtained 21 and 28 days after immunisation, respectively. One rabbit immunized with the

OsrA peptide died shortly after the medium bleed and was replaced. Thus, a medium bleed

and two final bleeds from three animals were tested for the anti-OsrA serum and two final

bleeds for the anti-EcfF serum.

 

CHAPTER III

 96 

3.4 Results and discussion

ecfF and osrA form one transcriptional unit

The ecfF and osrA coding regions are situated on the same DNA strand and only 2 bp apart

within the B. japonicum genome (Kaneko et al., 2002); thus, these genes might be

cotranscribed. A tiling analysis of ecfF-osrA expression using microarray data of the wild-

type B. japonicum strain grown micro-oxically unstressed or stressed by exposure to H2O2

(Chapter II) showed that expression levels of both genes respond similarly to the H2O2-

treatment (Fig. 3.2A).

Fig. 3.2. Analysis of ecfF and osrA transcription. A. Tiling analysis of the ecfF region. Hybridization signal intensities derived from individual oligonucleotide probe pairs of the ecfF region, using B. japonicum RNA from micro-oxically grown cells stressed with 2 mM H2O2 (□) or unstressed (). For better visualization, individual data points were connected by solid lines. Genes were assigned according to the annotation of (Kaneko et al., 2002). B. cDNA-based PCR was used to amplify a 493 bp region spanning the ecfF-osrA intergenic region using wild-type-derived cDNA as template. Lanes correspond to PCR products derived from 1- cDNA synthesized with reverse transcriptase (RT); 2 - mock DNA synthesized without RT; 3 – chromosomal DNA and 4 – H2O. M- molecular weight ladder with the band of 500 bp marked by the white arrowhead.

Moreover, a 493 bp DNA fragment spanning the ecfF-osrA junction was amplified using

PCR from wild-type B. japonicum-derived cDNA. No product was observed in the negative

control reactions containing either no template, or with the pseudo-template generated

without reverse transcriptase. A robust band of the expected size was observed in the positive

control reaction containing chromosomal B. japonicum DNA (Fig. 3.2B). These data indicate

that ecfF and osrA are indeed cotranscribed. Genes adjacent to ecfF-osrA are situated on the

opposite DNA strand, indicating that ecfF-osrA forms a bicistronic transcriptional unit. Such

gene organization allows equal transcription of both genes and thus probably tight regulation

of EcfF activity.

Further investigations with EcfF and OsrA

 97 

Prediction of putative operons within the EcfF regulon

To define candidate regions for searching EcfF-target promoters (Chapter II), putative

operons within the EcfF regulon (Chapter II, Table 2.4) were determined. Among the genes

whose expression differed in the (ecfF-osrA) and the osrA strains relative to the wild type,

are bll1027, bll1026 and blr7043, blr7044, bsr7045. These genes were predicted to form

operons bll1027-26 and bl/sr7043-45. Tiling analysis of bll1027-25 and bl/sr7043-45

expression using microarray data of the wild type and (ecfF-osrA) and osrA deletion

strains indicated that the genes bll1027-26, but not bll1025, and bl/sr7043-45 responded

similarly to H2O2 treatment (Fig. 3.3) and also to deletion of ecfF plus osrA or osrA alone

(data not shown).

Fig. 3.3. Tiling analysis of the bll1025-bll1027 (A) and blr7043-bsr7045 (B) regions. Hybridization signal intensities derived from individual oligonucleotide probe pairs of the bll1025-bll1027 and bl/sr7043-45 regions using B. japonicum RNA from micro-oxically grown, stressed with 2 mM H2O2 (□) and unstressed cells (). For better visualization, individual data points were connected by solid lines. Genes were assigned according to the annotation of Kaneko et al., 2002.

Thus the prediction was confirmed, and accordingly, upstream regions of bll1027, blr7043

and ecfF together with the other genes listed in Table 2.4 were inspected for the presence of

putative EcfF-target promoters.

Microarray analysis of deletion mutants (ecfF-osrA) and osrA grown aerobically

To identify genes differentially expressed in the (ecfF-osrA) and osrA strains under

aerobic conditions, microarray analyses were performed with respective mutants and the

wild-type strain. Expression of 122 and 212 genes (including ecfF and osrA) differed in the

(ecfF-osrA) and osrA mutant, respectively (Tables S3.2 and S3.3). Forty-one genes were

misregulated in both mutants grown under aerobic conditions (Table 3.2).

CHAPTER III

 98 

Table 3.2. B. japonicum genes whose expression differed in the (ecfF-osrA) and the (osrA) mutant grown aerobically relative to the wild type grown under identical conditions a.

Gene no.b Fold change

Known or predicted gene productc (ecfF-osrA) (osrA)

blr7434 6.1 12.1 hypothetical protein

blr2219 6.0 5.7 dehydrogenase

bll4820 5.4 3.6 unknown protein

trnfM-CAU 5.4 3.4 tRNA-fMet(CAT)

blr4764 4.5 5.7 unknown protein

blr2921 4.5 3.1 hypothetical protein

blr1601 4.2 3.1 ABC transporter substrate-binding protein

blr7339 4.2 4.5 unknown protein

blr2217 3.6 3.9 oxidoreductase with iron-sulfur subunit

bll2735 3.5 13.4 flavocytochrome C flavoprotein subunit

bll1826 3.3 3.6 putative transposase

bll1476 3.2 3.9 sulfate adenylate transferase subunit 2

blr7788 3.2 3.4 unknown protein

bll3768 3.2 4.6 unknown protein

blr4022 3.1 3.1 unknown protein

blr6251 -3.1 -3.3 hypothetical protein

bll1007 -3.3 -3.0 hypothetical protein

bll8244 -3.4 -3.2 unknown protein

bll3348 -3.4 -4.3 transcriptional regulatory protein MarR family

blr3450 -3.6 -3.1 unknown protein

bll5595 -3.7 -3.2 hypothetical protein

blr7300 -4.6 -3.4 unknown protein

bll8291 -5.6 -4.5 putative transposase

blr7299 -6.1 -4.0 hypothetical protein

blr5540 -8.8 -3.2 hypothetical protein

blr3166 -9.1 -4.5 putative glyoxylate carboligase protein

blr3167 -10.3 -4.8 putative hydroxypyruvate isomerase protein

blr3168 -8.1 -6.4 oxidoredutase

blr3169 -5.9 -3.4 hypothetical protein

blr7077 -13.6 -3.3 hemin ABC transporter hemin-binding protein

blr7078 -13.4 -3.8 hemin ABC transporter permease protein

bll7073 -14.2 -3.6 biopolymer transport protein

ecfF -24.0 7.1 ECF factor EcfF

osrA -26.6 -9.8 anti- factor OsrA

blr3555 -26.0 -4.3 probable ferrichrome receptor precursor

bsr3556 -38.6 -6.5 hypothetical protein

bll7968 -27.9 -6.9 probable TonB-dependent receptor

bll7967 -22.4 -5.3 similar to iron-uptake factor

bsr0067 -30.0 -28.0 unknown protein

blr7296 -70.9 -10.9 hypothetical protein

blr7297 -40.5 -7.2 unknown protein

Further investigations with EcfF and OsrA

 99 

a Differentially expressed genes were selected based on a 3-fold change cut-off. b Nomenclature according to Kaneko et al., 2002 with modifications. Numbers of genes organized in putative

operons are indicated in italics with co-transcribed promoter-distal genes indented to the right. c Gene description according to Kaneko et al., 2002 with modifications.

Unexpectedly, expression of all of these genes (exept ecfF) changed in the same direction in

the (ecfF-osrA) and osrA mutant (Table 3.2), which is counterintuitive to the function of

OsrA as an EcfF anti- factor. Thus these genes are probably not direct targets of EcfF and

therefore not relevant in the context of this work.

Except for ecfF and osrA no genes were found to be misregulated in the (ecfF-osrA) mutant

under all tested conditions, i.e., under aerobic, micro-oxic or micro-oxic H2O2-stressed

conditions (Chapter II). This indicates that EcfF is not active in the wild-type strain grown

under aerobic conditions. By contrast, 30 genes differentially expressed in the osrA strain

grown aerobically were also differentially expressed when this strain was grown

micro-oxically (Table 3.3). Among these 30 genes those eleven genes were found, which

define the EcfF-regulon (Tables 3.3 and 2.4). Thus EcfF is overfunctional in the osrA

mutant grown under micro-oxic and aerobic conditions. Interestingly, expression of ecfS is

more than 3-fold upregulated in the osrA strain grown either aerobically or micro-oxically,

which might point to some crosstalk between the EcfF-OsrA and EcfS-TmrS systems.

CHAPTER III

 100 

Table 3.3. B. japonicum genes whose expression differed in the (osrA) mutant grown aerobically and micro-oxically relative to the wild type grown under identical conditions.a

Gene no.b

Fold change

Known or predicted gene productd (osrA) (ecfF-osrA)

aerobic micro-oxic micro-oxic,

H2O2 stressedc

bll1027 137.9 89.5 -15.4 putative cytochrome c biogenesis protein

bll1026 63.0 92.4 -20.1 hypothetical protein

bll6527 64.9 78.3 -4.7 hypothetical protein

bsl6528 5.0 3.0 - hypothetical protein

bll6529 5.4 4.1 - unknown protein

blr7741 54.9 54.2 -28.3 hypothetical protein

bll0506 21.1 16.6 - hypothetical protein

bll0505 23.8 26.6 - hypothetical protein

bll1025 15.3 10.9 - unknown protein

blr7043 15.0 13.5 -7.0 peptide methionine sulfoxide reductase

blr7044 8.0 5.4 -2.9 peptide methionine sulfoxide reductase

bsr7045 8.1 4.2 -2.9 hypothetical protein

bll0304 14.5 3.1 - two-component response regulator

bsr4431 14.4 20.0 -15.9 hypothetical protein

blr2776 13.7 13.1 - putative patatin-like phospholipase

bll7811 13.6 3.8 - hypothetical protein

bll5855 13.6 20.6 -6.2 hypothetical protein

blr7434 12.1 5.8 - hypothetical protein

blr0834 11.0 4.2 - peptide methionine sulfoxide reductase

blr0305 9.0 3.9 - unknown protein

bll3384 8.4 3.8 - ABC transporter ATP-binding protein

blr6167 7.9 4.0 - unknown protein

ecfF 7.1 18.8 -60.6 ECF factor EcfF

osrA -9.8 -19.8 -210.1 anti- factor OsrA

blr1469 6.6 3.3 - hypothetical protein

blr1349 6.4 4.9 - hypothetical protein

bll2508 6.3 3.8 - hypothetical glutathione S-transferase like protein

bll0507 4.3 5.6 - hypothetical protein

bsl4407 3.4 4.7 - unknown protein

ecfS 3.2 3.8 - ECF factor EcfSa Differentially expressed genes were selected based on a 3-fold change cut-off. b Nomenclature according to Kaneko et al., 2002 with modifications. Numbers of genes organized in putative operons are indicated in italics with co-transcribed promoter-distal genes indented to the right. c Fold change of the genes of EcfF-regulon in (ecfF-osrA) strain grown micro-oxically and stressed with 2 mM H2O2 for 10 min compared to the wild type grown under identical conditions (Chapter II, Table 2.4). d Gene description according to Kaneko et al., 2002 with modifications.

Further investigations with EcfF and OsrA

 101 

Further analysis of EcfF-OsrA interactions using a bacterial two-hybrid system

In addition to the analysis of the EcfF-OsrA interaction described in Chapter II other fusion

proteins were tested in the bacterial two-hybrid system. Given the predicted OsrA

transmembrane topology which might influence complementation of the adenylate cyclase

domains, two different OsrA fusions to the T25 domain of adenylate cyclase were tested.

Plasmid pRJ9746 expressing the T18 domain fused to the N-terminus of the full-length EcfF

protein was tested in combination with either pRJ9744 or pRJ9745 encoding the T25 domain

of adenylate cyclase fused to the N- or C-terminus of wild-type OsrA, respectively. BTH101

cells cotransformed with either plasmid combination showed -galactosidase activity higher

than the negative controls (Fig. 3.4, strains 8 and 9), with the pRJ9746+pRJ9744 pair 16-fold

higher than the pRJ9746+pRJ9745 combination (strains 1 and 2). Thus the fusion of T25 to

the N-terminus of OsrA encoded in pRJ9744 is more efficient in complementation and was

chosen for the studies presented in Chapter II and below.

Fig. 3.4. Functional complementation between hybrid proteins made of EcfF and OsrA fused to domains of B. pertussis adenylate cyclase. The two adenylate cyclase domains T18 and T25 are schematized by ovals, wild-type anti- factor OsrA by grey rectangles and factor EcfF and derivatives thereof by black rectangles with the numbers indicated above boxes referring to the first and the last amino acid of the EcfF derivative present in the fusion. An engineered His-tag is shown by “His”.

For all hybrids, the N-terminus is on the left and the C-terminus on the right. Plasmids present in strains 1-9 and expressing the indicated proteins were as follows: strain 1. pRJ9746+pRJ9744; strain 2. pRJ9746+pRJ9745; strain 3. pRJ9747+pRJ9744; strain 4. pRJ9748+pRJ9744; strain 5. pRJ9746+pRJ9758; strain 6. pRJ9759+pRJ9761; strain 7. pRJ9763+pRJ9744; strain 8. pUT18C+pRJ9744; strain 9. pRJ9746+pKT25. Plasmid pairs were transformed into E. coli BTH101 in the indicated combinations to yield strains 1 to 9.

-Galactosidase activities were measured as described in Material and Methods (strains 8 and 9 served as negative controls to determine background activity). Shown are mean values and standard deviations derived from a representative experiment with four independent cultures per strain.

CHAPTER III

 102 

Apart from 70 region 2 (IPR007627) and region 4 (IPR013249) EcfF and its homologs

harbor an N-terminal extension which, in EcfF, corresponds to about 30 amino acids. To test

the hypothesis whether this region is required and sufficient for EcfF-OsrA interaction, two

truncated EcfF versions corresponding to amino acids 44-186 and 1-54 were fused to the

C-terminus of T18 (plasmids pRJ9747 and pRJ9748, respectively). None of the fusion

proteins encoded was able to complement the T25 domain expressed as C-terminal fusion

with OsrA (pRJ9744) (Fig. 3.4, strains 3 and 4). This indicated that the N-terminal extension

of EcfF is required but not sufficient for EcfF-OsrA interaction.

For potential future biochemical studies with EcfF and OsrA it is crucial to know whether

tagged derivatives of these proteins retain activity. Therefore the bacterial two-hybrid system

was used to find out whether a His-tag incorporated at the N-terminus of OsrA would

interfere with EcfF interaction. For this purpose, plasmid pRJ9758 encoding the T25 domain

fused to the N-terminus of a His-tagged OsrA variant was constructed. Only background

-galactosidase activity was detected in the BTH101 strain harboring the pRJ9758 and

pRJ9746 plasmids in contrast to pRJ9744 (encoding the T25 domain fused to wild-type

OsrA) plus pRJ9746 combination (Fig. 3.4, strains 5 and 1). These data indicate that the

incorporated His-tag interfered with the OsrA-EcfF interaction, and thus another strategy to

tag OsrA must be used in future experiments.

The proteins used above to test EcfF-OsrA interaction were the fusions of T18 to EcfF and

T25 to OsrA. For a domain swapping experiment, plasmids pRJ9759 and pRJ9761 encoding

a fusion of the T18 domain to the N-terminus of wild-type OsrA and fusion of the T25

domain to the N-terminus of full-length EcfF, respectively were constructed. E. coli BTH101

cells cotransformed with these plasmids showed high -galactosidase activity (Fig. 3.4, strain

6), indicating that complementation of adenylate cyclase activity is independent of the

combination of the protein fusion partners.

Further investigations with EcfF and OsrA

 103 

Reannotation of the ecfF start codon

Alignment of EcfF with the homologous proteins shows that about 10-15 N-terminal amino

acids of the proteins are poorly conserved (Fig. 3.5).

Fig. 3.5. Alignment of the N-terminus of EcfF and homologs. Numbers on the right refer to the position number of the last amino acid on the line within the individual protein. Shaded in black, dark grey, and light grey are amino acids which are identical in all, 80%, and 60% of the sequences, respectively. GI numbers of the proteins are as follows: Bradyrhizobium japonicum USDA 110 (BJ) EcfF – 27378149 and EcfS – 27380039, Brucella suis 1330 (BS) 23499788, Parvularcula bermudensis HTCC2503 (PB) 84701786, Pseudomonas aeruginosa (PA) 90569645, Rhizobium etli CFN 42 (RE) 86360790, Caulobacter crescentus (CC) 16127483, Sphingopyxis alaskensis RB2256 (SA) 103488157, Burkholderia pseudomallei K96243 (BP) 53719307, Loktanella vestfoldensis SKA53 (LV) 84516796. The 70 region 2 is shown above the alignment by a black rectangle. Analyzed alternative start codons of EcfF are shown in bold face, see text for more details.

Notably, the majority of the compared proteins contain a methionine residue (at position 17

of EcfF) in this region. In previous proteomic studies performed with wild-type B. japonicum

under free-living and symbiotic conditions, four tryptic peptides of EcfF were detected

(C. Ahrens, personal communication). The peptide closest to the N-terminus that was

detected corresponds to amino acids 19-30 of EcfF and thus limits the location of the ecfF

translational start site in 3’ direction (Fig. 3.6). Three potential start codons are present

upstream of the DNA sequence encoding this peptide. While the first ATG and the following

GTG codons are situated very close to the transcriptional start site (position +2 and +14,

respectively, relative to the transcription start point), the next ATG codon (located at +47)

encoding methionine 17 of EcfF is likely the translational start site.

CHAPTER III

 104 

Fig. 3.6. Analysis of the EcfF start codon. The sequence of the ecfF promoter region and 5’-end of ecfF is shown. The determined transcriptional start site is indicated by an arrowhead, and the putative -10 and -35 regions are shaded in grey. The start codon annotated according to Kaneko et al., 2002 is in italics and printed in bold face, alternative start codons are printed in bold face. The N-terminus of the EcfF amino acid sequence is indicated in one-letter code. Peptides resulting from an in silico tryptic digest of the EcfF N-terminus are shown by rectangles with the peptide detected by proteomic analysis indicated by solid line and those which were not detected by dashed lines.

Using the bacterial two-hybrid system the interaction of OsrA with the truncated version of

EcfF starting at Met-17 was verified. Plasmid pRJ9763 encoding the T18 domain fused to the

N-terminus of EcfF fragment from Met-17 to His-186 was constructed and tested in

combination with pRJ9744 (Fig. 3.4, strain 7). High -galactosidase activity of the strain

harboring these plasmids indicated an interaction between this EcfF version and OsrA.

Immunodetection of MetSO within proteins

In order to confirm/reject the hypothesis that H2O2 causes oxidation of Met residues in OsrA

an antibody against MetSO (provided in the “MetSO Immunoblotting Kit”, Cayman

Chemical, Michigan, MI, USA) was used. According to the manufacturer, the polyclonal

antibody was generated against an oxidized corn protein (MetO-DZS18) rich in methionine

and is specific for MetSO in proteins.

First, the antibody was tested using purified FixK2 protein fused to an intein domain (encoded

by plasmid pRJ0053; kindly provided by M. Bonnet). This 53.5 kDa fusion protein contains

eight methionines whose oxidation was monitored by immunostaining with the antibody

against MetSO (Fig. 3.7A). The FixK2-intein protein was used because no FixK2 protein was

available at the time when the experiments were performed. While H2O2-oxidized

FixK2-intein protein was clearly stained by the anti-MetSO serum, weaker and no

immunostained bands were detected in untreated and pretreated with 1% -mercaptoethanol

samples, respectively (Fig. 3.7A). This result indicated that the antibody is indeed able to

detect proteins containing oxidized methionines.

Further investigations with EcfF and OsrA

 105 

Fig. 3.7. Immunodetection of MetSO in proteins. A. Analysis of a FixK2-intein fusion by Coomassie-stained SDS-PAGE (left panel) and Western blot with an anti-MetSO antibody (right panel). Purified FixK2 (53.5 kDa) was incubated for 1 h at RT with 100 mM H2O2 (final concentration) in 50 mM Tris-HCl pH 7.5 - lane 1, 50 mM Tris-HCl pH 7.5 - lane 2, 1% -mercaptoethanol in 50 mM Tris-HCl pH 7.5 - lane 3. B. Western blot analysis of membrane proteins isolated from E. coli caring pKT25+pUT18C (lanes 1-3) or pRJ9744+pRJ9746 (lanes 4-6) with an anti-MetSO antibody. Extracts were incubated for 1 h at RT with 100 mM H2O2 (final concentration) in 50 mM Tris-HCl pH 7.5 - lanes 1 and 3, 50 mM Tris-HCl pH 7.5 - lanes 2 and 4, 1% -mercaptoethanol in 50 mM Tris-HCl pH 7.5 - lanes 3 and 6.

In the next experiment, the MetSO antibody was tested with membrane proteins isolated from

E. coli BTH101 cells carrying pKT25 plus pUT18C, or pRJ9744 plus pRJ9746 plasmids.

Proteins encoded by pKT25, pUT18C, pRJ9744 and pRJ9746 plasmids are of different size,

methionine content and predicted cellular localization: T25 (6 Met, 25 kDa, cytoplasmic) and

T18 (4 Met, 21.3 kDa, cytoplasmic) domains of adenylate cyclase encoded in pKT25 and

pUT18C, respectively; pRJ9744: T25 fused to the N-terminus of OsrA (18 Met, 46.6 kDa,

membrane-embedded); pRJ9746: T18 fused to the N-terminus of EcfF (4 Met, 40.8 kDa,

cytoplasmic). As shown on Fig. 3.7B, among E. coli membrane proteins, a band similar in

size to that expected for the T25-OsrA fusion was detected, documenting that OsrA protein is

indeed a membrane-associated protein that is stained with the MetSO antibody. Surprisingly,

the intensity of the putative T25-OsrA band did not change with pretreatment of the samples,

and the same was apparently true for all other methionine-containing E. coli proteins present

in the sample. This might indicate that permanently oxidized methionines were present in the

sample which could not be reverted to methionine by the treatment with -mercaptoethanol.

Finally, membrane proteins of wild-type B. japonicum and deletion mutants (ecfF-osrA),

osrA, ecfQ and (ecfQ, ecfF-osrA) untreated or treated with H2O2 prior harvesting were

analyzed by Western blot hybridization using the antibody against MetSO. Unfortunately,

results of these experiments were not conclusive and showed large sample-to-sample

variations. All attempts to improve the sample preparation failed. In conclusion, using

immunostaining with the anti-MetSO serum it was not possible to detect enhanced oxidation

of methionines neither in OsrA nor in other B. japonicum proteins as a consequence of

H2O2-treatment or deletion of ecfF.

CHAPTER III

 106 

Expression of His-tagged EcfF in E. coli

For future biochemical analysis of EcfF, an attempt was made to overproduce B. japonicum

EcfF as a C-terminally His-tagged variant in E. coli strains. Plasmid pRJ9700 encoding EcfF

with a C-terminal His-tag was constructed and transformed into either E. coli BL21 or

Rosetta cells. Protein production was tested in both strains as described in Material and

Methods. No protein overexpression was detected by SDS-PAGE and Coomassie staining of

lysates of either E. coli strain (results with E. coli Rosetta cells are shown in Fig. 3.8). By

Western blot analysis using anti-His4 tag antibody a weak band of the expected size

(19.7 kDa) was detected in induced E. coli Rosetta cells (but not in E. coli BL21 cells; data

not shown).

Fig. 3.8. Expression of His-tagged EcfF in E. coli Rosetta cells. Analysis of cell lysates by SDS-PAGE followed by Coomassie staining (left panel) and Western blot hybridization with an anti-His-tag antibody. Lane 1 – non-induced cells, lane 2 – IPTG-induced cells, for further details see Material and Methods. 

Notably, upon induction of EcfF-His6 expression by IPTG addition, optical density of both

E. coli strains remained constant while the OD of non-induced cells continued to increase.

The observed growth inhibition may be caused by competition between E. coli -factors and

EcfF. In attempt to produce the target protein in higher quantities, the protocol was modified.

E. coli Rosetta cells caring plasmid pRJ9700 were grown at 37C until the optical density

reached 1.2, when protein production was induced by addition of IPTG and cultures were

incubated for 2 more hours at 30C or 16C. Yet, no significant increase in protein

production could be achieved (data not shown). Due to the very low expression level of

EcfF-His6 no attempts were made to purify the recombinant protein by Ni2+-NTA affinity

chromatography.

Further investigations with EcfF and OsrA

 107 

Attempts to immunodetect EcfF and OsrA with anti-peptide sera

Using respective peptides an attempt was made to produce anti-EcfF and anti-OsrA sera.

According to the provider (Eurogentec, Liege, Belgium) the sera recognized the peptides

used for immunisation in an Elisa assay. Sensitivity and specificity of the anti-EcfF and

anti-OsrA sera were then tested by immunoblot analysis with extracts prepared from

B. japonicum wild-type cells and from the (ecfF-osrA) deletion mutant 9688. All sera failed

to specifically detect their target proteins in the wild type. As EcfF and OsrA are probably

expressed at very low levels in B. japonicum, extracts from E. coli BTH101 cells caring

either pRJ9744 plus pRJ9746 (expressing the T25 and T18 domains of adenylate cyclase

fused to the N-terminus of OsrA and EcfF, respectively) or pKT25 plus pUT18C (expressing

T25 and T18 domains only) were tested with the antisera because higher antigen

concentrations could be expected in these samples. Again, all sera failed to detect their

antigens. Thus, the available sera are not suitable for detection of EcfF and OsrA.

In retrospective the failure of the anti-EcfF serum to detect EcfF in samples prepared from B.

japonicum cells can be explained. Because the synthetic peptide used for immunization was

derived from the first to the 15th amino acid residue which, according to the corrected

annotation (see Fig. 3.6 and the corresponding section) are unlikely to be a part of EcfF

expressed in B. japonicum.

CHAPTER III

 108 

3.5 Supplementary material

Table S3.1. Primers used in this study.

Primer pairs Sequencea Size and properties of resulting PCR products

Used for

3038-OvEx-F2 3038-OvEx-R2

TCATGATGAGGGCGCGGGTGC TAAGCTTGTGGTCCCGCAGTTTGGC

567 bp coding region of ecfF pRJ9699

4928-up-F 4928-up-R

GAATTCGACCGCGTCATTGCGCGAGCAG CTGCAGGGTTTCCGTGGTCGTCATACCCAC

809 bp upstream region of ecfS

pRJ9707-pRJ9709

4929-down-F 4929-down-R

CTGCAGGCACCCTCGCAGGCGCATTG TCTAGACAGCATGCAGATCGCGAGGAGC

763 bp downstream region of tmrS

pRJ9707-pRJ9709

up-3038-F up-3038-R

GAATTCGTCGAGATCGTTGAGCTGGTCG CTGCAGCATGCAATTCGGCCGCTCTTTC

778 bp upstream region of ecfF

pRJ9688, pRJ9715

down-3039-F down-3039-R

CTGCAGTAGCCGCGATCGGAGCGCTG TCTAGAGGTGATCGAGGTCGCAGGAC

875 bp downstream region of osrA

pRJ9688, pRJ9692,pRJ9715

up-3039-F up-3039-R

GAATTCGACGCCGTGGCGTGACGATA CTGCAGGCCGCAAGCGAGCGAATGAG

842 bp upstream region of osrA

pRJ9692

3039-2G-F1 3039-2G-R1

ATACTGCAGGGATGGATACCGATCA ATAGAATTCTCTAATACCGCAACAC

660 bp coding region of osrA pRJ9744

3039-2G-F2 3039-2G-R2

ATAAAGCTTGATGGATACCGATCAACTCATTTACTGCAGGCATACCGCAACACCCT

657 bp coding region of osrA pRJ9745

3038-2G-F1 3038-2G-R1

AATCTGCAGGATGATGAGGGCGCGGGT ATATCTAGACTAGTGGTCCCGCAGTTTG

580 bp coding region of ecfF pRJ9746

3038-2G-F2

AATCTGCAGGCGCGGGCTGGCG Used in combination with 3038-2G-R1

448 bp fragment of ecfF coding region from Arg-44 to His-186 amino acid

pRJ9747

3038-2G-R2

ATATCTAGAGTTCGGGAGGCTGGCCGGC Used in combination with 3038-2G-F1

185 bp fragment of ecfF coding region from Met-1 to Pro-54 amino acid

pRJ9748

3039-2G-F3

ACTGCAGATCACCACCACCACCACCACATG GATACCGAT Used in combination with 3039-2G-R1

678 bp coding region of osrR with N-terminal His-tag

pRJ9758

3039-2G-F4 3039-2G-R3

TCAATCTGCAGGATGGATACCGATCAACT TGATCTAGATTAATACCGCAACACCCTC

660 bp coding region of osrR pRJ9759

3038-2G-F3 3038-2G-R3

TCACTGCAGGTATGATGAGGGCGC CATGAATTCGACTAGTGGTCCCGCA

583 bp coding region of ecfF pRJ9761

3038-2G-F5

AATCTGCAGGATGCGGTCGGCCAT Used in combination with 3038-2G-R1

532 bp fragment of ecfF coding region from Met-17 to His-186 amino acid

pRJ9763

3038-OP-F1 3039-RT-R

GTCTTCGTCAACATCGATGA GCCAACAGAATCTCCTGCAC

493 bp fragment spanning the ecfF-osrA junction

cDNA-based PCR

FixK2-F FixK2-R

GCGCATATGCTGACCCAGACAC ACTAGTGCATCTCCCGTGATGCAGGCGTCG AGATTGTGCAGGC

718 bp coding region of fixK2 with C-terminal intein

pRJ0053

a Engineered restriction enzyme sites are underlined; His-tag and intein coding sequences are in italics.

Further investigations with EcfF and OsrA

 109 

Table S3.2. List of B. japonicum genes differentially expressed in the (ecfF-osrA) strain compared to the wild type. Cells were grown aerobically in PSY.a 

Gene no.b Fold change Known or predicted gene productc

Genes of know or predicted function

blr2106 6.5 L-ectoine synthaseblr2219 6.0 dehydrogenase blr2924 5.6 amino acid ABC transporter permease proteinbll5796 5.5 Fumarate hydratase class I (EC 4.2.1.2) trnfM-CAU 5.4 tRNA-fMet(CAT) blr1816 5.3 RhcN protein blr2926 5.1 amino acid ABC transporter ATP-binding protein bll0466 4.7 aconitase blr1815 4.6 nodulation protein blr2923 4.5 amino acid ABC transporter permease protein blr0488 4.3 3-isopropylmalate dehydratase large subunit blr1813 4.3 RhcJ protein blr1601 4.2 ABC transporter substrate-binding protein blr2455 4.1 isocitrate lyase (EC 4.1.3.1) blr2217 3.6 oxidoreductase with iron-sulfur subunitbll2735 3.5 flavocytochrome C flavoprotein subunit blr2925 3.4 amino acid ABC transporter ATP-binding proteinblr1814 3.3 nodulation protein blr4804 3.3 probable phospholipid N-methyltransferase bll1826 3.3 putative transposase blr2922 3.3 ABC transporter amino acid-binding protein blr1819 3.3 RhcR protein bll1476 3.2 sulfate adenylate transferase subunit 2 bll6903 3.1 outer membrane lipoprotein blr1603 3.1 ABC transporter permease protein blr3720 -3.0 probable pyruvate dehydrogenase bll6940 -3.0 HupC protein bll3558 -3.1 two-component hybrid sensor and regulator blr3353 -3.2 ABC transporter substrate-binding proteinblr7418 -3.3 hypothetical glutathione S-transferase like protein bll4708 -3.4 probable ATP-binding proteinblr1180 -3.4 two-component response regulator bll3348 -3.4 transcriptional regulatory protein MarR family blr2694 -3.4 VirG-like two component response regulator bll2216 -3.4 transcriptional regulatory protein TetR family blr3906 -3.4 biopolymer transport protein blr3535 -3.4 oxidoreductase with iron-sulfur subunit bll7632 -3.5 putative L-2-Amino-thiazoline-4-carboxylic acid hydrolase bsl3134 -3.7 putative NAD-dependent formate dehydrogenase blr1214 -3.7 putative lipoprotein bll3559 -3.9 two-component response regulator bll3557 -4.0 putative cytochrome B561 blr0698 -4.3 putative hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4) bll0597 -4.4 similar to nickel-dependent hydrogenase, cytochrome B subunit bll3138 -4.4 NADH dehydrogenase I chain Eblr3904 -4.5 probable iron transport protein bll3135 -4.7 formate dehydrogenase bll3137 -4.9 NADH dehydrogenase I chain F

CHAPTER III

 110 

bsl6681 -5.0 putative bacterioferritin bll3136 -5.0 formate dehydrogenase alpha subunit bll8291 -5.6 putative transposase blr4504 -6.8 TonB-dependent receptor blr3168 -8.1 oxidoredutase blr3166 -9.1 putative glyoxylate carboligase protein blr3167 -10.3 putative hydroxypyruvate isomerase protein blr7079 -11.1 hemin ABC transporter ATP-binding protein bll7076 -13.0 Hemin receptor precursor blr7078 -13.4 hemin ABC transporter permease protein blr7077 -13.6 hemin ABC transporter hemin-binding protein bll7073 -14.2 biopolymer transport protein bll7071 -14.8 TonB protein bll7072 -19.2 biopolymer transport protein bll7967 -22.4 similar to iron-uptake factor ecfF -24.0 ECF factor EcfF blr3555 -26.0 probable ferrichrome receptor precursor osrA -26.6 anti- factor OsrA bll7968 -27.9 probable TonB-dependent receptor bll4920 -30.1 ferrichrome iron receptor

Hypothetical proteins and proteins of unknown function

bsl1870 8.6 unknown protein blr7434 6.1 hypothetical protein bsr7449 5.6 unknown protein bll4820 5.4 unknown protein bll1605 5.0 unknown protein bll3000 5.0 unknown protein bsl1678 4.8 hypothetical proteinblr4764 4.5 unknown protein blr2921 4.5 hypothetical proteinblr4566 4.5 hypothetical protein blr7339 4.2 unknown protein blr1888 4.2 unknown protein bll5203 4.2 unknown protein blr4568 3.8 hypothetical protein blr0850 3.8 unknown protein blr3188 3.8 unknown protein bll1560 3.6 unknown protein blr4567 3.5 hypothetical protein bsl4913 3.5 unknown protein bsl2574 3.4 unknown protein blr7788 3.2 unknown proteinbsl5756 3.2 unknown protein bll3768 3.2 unknown proteinbsl6845 3.1 unknown protein blr4022 3.1 unknown protein blr7603 -3.0 unknown protein bsl3687 -3.1 unknown protein blr3452 -3.1 hypothetical protein blr6251 -3.1 hypothetical protein blr3905 -3.1 hypothetical protein bll1076 -3.2 hypothetical protein bll1007 -3.3 hypothetical protein

Further investigations with EcfF and OsrA

 111 

bsr6521 -3.3 hypothetical protein bll8244 -3.4 unknown protein blr0278 -3.5 hypothetical protein blr3450 -3.6 unknown protein bll5595 -3.7 hypothetical protein blr3554 -4.0 unknown protein blr0697 -4.1 hypothetical protein bll4506 -4.1 unknown protein bsr6522 -4.1 hypothetical protein blr7300 -4.6 unknown protein blr8267 -5.5 unknown protein blr3169 -5.9 hypothetical protein blr7299 -6.1 hypothetical protein blr4505 -6.6 hypothetical protein bll7075 -6.7 hypothetical protein blr4507 -7.3 unknown protein blr5540 -8.8 hypothetical protein bll7074 -19.3 hypothetical protein bsr0067 -30.0 unknown protein bsr3556 -38.6 hypothetical protein blr7297 -40.5 unknown protein blr7296 -70.9 hypothetical protein

a Differentially expressed genes were selected based on a 3-fold change cut-off. b Nomenclature according to Kaneko et al., 2002 with modifications. c Gene description according to Kaneko et al., 2002 with modifications.

CHAPTER III

 112 

Table S3.3. List of B. japonicum genes differentially expressed in the osrA strain compared to the wild type. Cells were grown aerobically in PSY.a

Gene no.b Fold change Known or predicted gene productc

Genes of know or predicted function

bll1027 137.9 putative cytochrome C biogenesis protein

blr0293 18.6 oxidoreductase

blr7043 15.0 peptide methionine sulfoxide reductase

bll0304 14.5 two-component response regulator

blr2776 13.7 putative patatin-like phospholipase

bll2735 13.4 flavocytochrome C flavoprotein subunit

blr0834 11.0 peptide methionine sulfoxide reductase

bll2737 8.8 oxidoreductase with iron-sulfur subunit

bll3384 8.4 ABC transporter ATP-binding protein

blr7044 8.0 peptide methionine sulfoxide reductase

blr6526 7.4 putative acetyltransferase

bll2736 7.1 putative aldehyde dehydrogenase protein

ecfF 7.1 ECF factor EcfF

bll0303 6.6 two-component sensor histidine kinase

bll2508 6.3 hypothetical glutathione S-transferase like protein

blr2219 5.7 dehydrogenase

blr5233 5.3 small heat shock protein

bll1028 5.3 RNA polymerase sigma factor

blr5220 4.5 small heat shock protein

bll0489 4.4 putative glycine-rich protein

bll6455 4.3 ABC transporter substrate-binding protein

bll2733 4.2 probable sulfur oxidation protein

bll5219 4.0 small heat shock protein

blr2591 4.0 serine protease DO-like protease

blr2217 3.9 oxidoreductase with iron-sulfur subunit

bsr2892 3.9 phenylacetic acid degradation protein

bll1476 3.9 sulfate adenylate transferase subunit 2

bll6452 3.8 acyl-CoA dehydrogenase

bll0301 3.8 cation efflux protein

bll0557 3.7 putative cytochrome P450

bll7010 3.7 sulfonate monooxygenase

blr5698 3.6 similar to protein-export membrane protein SecD

blr2891 3.6 putative phenylacetic acid degradation protein

bll1826 3.6 putative transposase bll0265 3.5 probable 2-(5-triphosphoribosyl)-3-dephosphocoenzyme-A

blr4023 3.5 putative acetolactate synthase (EC 4.1.3.18)

blr3517 3.5 probable sulfite oxidase cytochrome subunit

blr1233 3.5 putative sulfonate binding protein

bll6911 3.4 ABC transporter ATP-binding protein

trnfM-CAU 3.4 tRNA-fMet(CAT)

blr3130 3.4 serine protease DO-like precursor

Further investigations with EcfF and OsrA

 113 

bll0932 3.4 multidrug resistance protein A

blr2893 3.4 putative phenylacetic acid degradation protein

bll7559 3.4 probable Fe-Mn superoxide dismutase (EC 1.15.1.1)

bsl3938 3.4 putative biotinylated protein

blr3121 3.3 two-component response regulator

bll0196 3.3 ABC transporter substrate-binding protein

blr8160 3.3 ABC transporter molybdenum-binding protein

bll7011 3.3 ABC transporter aliphatic-sulfonate-binding protein

bll3375 3.2 probable dehydrogenase

ecfS 3.2 ECF factor EcfS

bll7008 3.2 aliphatic sulfonate ABC transporter ATP-binding protein

bll5510 3.2 outer-membrane immunogenic protein precursor

bll0198 3.1 amidase (EC 3.5.1.4)

blr1482 3.1 ABC transporter sulfate-binding protein

blr1601 3.1 ABC transporter substrate-binding protein

blr5877 3.1 two-component hybrid sensor and regulator

blr3131 3.1 two-component response regulator

blr6456 3.1 probable aliphatic sulfonates binding protein

bll0933 3.0 transcriptional regulatory protein MarR family

bll3382 3.0 ABC transporter permease protein

blr2753 3.0 ABC transporter HlyB-MsbA family

bll6180 3.0 oxidoreductase

bll6388 -3.0 ABC transporter substrate-binding protein

bll6387 -3.1 ABC transporter ATP-binding protein

blr2763 -3.3 cytochrome-c oxidase

blr7077 -3.3 hemin ABC transporter hemin-binding protein

bll7073 -3.6 biopolymer transport protein

bll7125 -3.6 NAD(P) transhydrogenase subunit alpha part 2 (EC 1.6.1.2)

blr7078 -3.8 hemin ABC transporter permease protein

blr3555 -4.3 probable ferrichrome receptor precursor

bll3348 -4.3 transcriptional regulatory protein MarR family

bll8291 -4.5 putative transposase

blr3166 -4.5 putative glyoxylate carboligase protein

bll2060 -4.7 GroES3 chaperonin

blr3167 -4.8 putative hydroxypyruvate isomerase protein

bll7967 -5.3 similar to iron-uptake factor

trnA-GGC -5.5 tRNA-Ala(GGC)

blr3168 -6.4 oxidoredutase

bll7968 -6.9 probable TonB-dependent receptor

osrA -9.8 anti- factor OsrA

Hypothetical proteins and proteins of unknown function

bll6527 64.9 hypothetical protein

bll1026 63.0 hypothetical protein

blr7741 54.9 hypothetical protein

bll0505 23.8 hypothetical protein

CHAPTER III

 114 

bll0506 21.1 hypothetical protein

bll1025 15.3 unknown protein

bsr4431 14.4 hypothetical protein

blr0306 13.8 hypothetical protein

bll7811 13.6 hypothetical protein

bll5855 13.6 hypothetical protein

bll7617 12.2 hypothetical protein

blr7434 12.1 hypothetical protein

blr7618 10.4 hypothetical protein

blr0305 9.0 unknown protein

bsr7633 8.8 unknown protein

bsr7045 8.1 hypothetical protein

blr6167 7.9 unknown protein

bsl6617 7.7 unknown protein

bll2734 7.2 hypothetical protein

blr1468 6.7 hypothetical protein

blr0274 6.6 unknown protein

blr1469 6.6 hypothetical protein

blr1349 6.4 hypothetical protein

blr1206 6.3 unknown protein

bll6449 6.2 hypothetical protein

blr5229 5.9 unknown protein

blr4764 5.7 unknown protein

bll6529 5.4 unknown protein

blr3898 5.3 hypothetical protein

bll2743 5.3 hypothetical protein

bll6626 5.2 unknown protein

bsl5717 5.2 hypothetical protein

bll7018 5.0 unknown protein

bsl6528 5.0 hypothetical protein

blr8159 4.7 hypothetical protein

bll1339 4.7 unknown protein

bsr2797 4.7 hypothetical protein

blr4046 4.6 unknown protein

bll3768 4.6 unknown protein

bll4828 4.6 unknown protein

blr5292 4.6 unknown protein

bsr1232 4.6 hypothetical protein

blr7339 4.5 unknown protein

blr5348 4.4 unknown protein

bll1285 4.3 unknown protein

bll0507 4.3 hypothetical protein

bll3387 4.2 unknown protein

blr4621 4.0 unknown protein

blr5712 4.0 hypothetical protein

Further investigations with EcfF and OsrA

 115 

bll3370 4.0 unknown protein

bll0556 4.0 hypothetical protein

bll3764 4.0 hypothetical protein

bsl4437 4.0 unknown protein

bll7562 4.0 hypothetical protein

bsl2575 3.9 hypothetical protein

bsr2129 3.9 hypothetical protein

bsr4694 3.9 unknown protein

bsr0862 3.8 unknown protein

bsl4665 3.8 unknown protein

bll7252 3.8 hypothetical protein

tmrS 3.8 anti- factor TmrS

bll2537 3.8 hypothetical protein

blr5768 3.7 unknown protein

bll0233 3.7 hypothetical protein

bll6525 3.7 unknown protein

blr5716 3.7 hypothetical protein

bsl7915 3.6 hypothetical protein

bll0555 3.6 hypothetical protein

bll4820 3.6 unknown protein

bll6168 3.6 hypothetical protein

blr5713 3.6 hypothetical protein

blr6629 3.6 unknown protein

blr2641 3.5 hypothetical protein

bsr7564 3.5 unknown protein

bll1342 3.5 hypothetical protein

bll3993 3.5 hypothetical protein

bll7164 3.5 unknown protein

bsl6653 3.5 unknown protein

blr0360 3.4 hypothetical protein

blr7788 3.4 unknown protein

blr2243 3.4 unknown protein

bll7425 3.4 hypothetical protein

bsl4407 3.4 unknown protein

blr1539 3.3 hypothetical protein

bll2849 3.3 unknown protein

blr7935 3.3 hypothetical protein

bll6433 3.3 hypothetical protein

bll7511 3.3 unknown protein

bll2796 3.3 hypothetical protein

bll1010 3.3 hypothetical protein

bll1110 3.2 hypothetical protein

bsl1208 3.2 hypothetical protein

bsl7903 3.2 hypothetical protein

bll7487 3.2 unknown protein

CHAPTER III

 116 

bll1467 3.2 hypothetical protein

bll5323 3.2 unknown protein

bll5579 3.1 hypothetical protein

bll7790 3.1 hypothetical protein

blr3860 3.1 unknown protein

blr2921 3.1 hypothetical protein

blr4022 3.1 unknown protein

bll7279 3.1 unknown protein

blr5502 3.1 hypothetical protein

bsl4014 3.1 unknown protein

bll4278 3.1 unknown protein

blr4684 3.0 hypothetical protein

blr0276 3.0 hypothetical protein

bll8056 3.0 unknown protein

bll5218 3.0 unknown protein

bll1007 -3.0 hypothetical protein

bll2516 -3.0 hypothetical protein

blr4646 -3.1 hypothetical protein

blr3450 -3.1 unknown protein

bll6069 -3.1 hypothetical protein

bll3194 -3.2 unknown protein

bll5595 -3.2 hypothetical protein

bsr5820 -3.2 unknown protein

bll8244 -3.2 unknown protein

blr5540 -3.2 hypothetical protein

blr6251 -3.3 hypothetical protein

blr3169 -3.4 hypothetical protein

blr7283 -3.4 unknown protein

blr7300 -3.4 unknown protein

blr6990 -3.5 hypothetical protein

bsl5891 -3.7 hypothetical protein

blr7299 -4.0 hypothetical protein

bll2330 -4.6 hypothetical protein

bsr3556 -6.5 hypothetical protein

blr7297 -7.2 unknown protein

blr7296 -10.9 hypothetical protein

bsr0067 -28.0 unknown protein a Differentially expressed genes were selected based on a 3-fold change cut-off. b Nomenclature according to Kaneko et al., 2002 with modifications. c Gene description according to Kaneko et al., 2002 with modifications.

 

  

CHAPTER IV EcfG-NepR-PhyR signalling cascade: In search for functions of target genes and a sensory kinase  

CHAPTER IV

 118 

4.1 Abstract

In the nitrogen-fixing soybean symbiont Bradyrhizobium japonicum, the general stress

response involves ECF factor EcfG controlled by a partner-switching mechanism similar to

that in other -proteobacteria via anti- factor NepR and anti-anti- factor PhyR. Phenotypic

analysis of deletion mutants revealed that both ecfG and phyR genes are also required for

symbiotic interactions of B. japonicum with host plants (Gourion et al., 2009). Microarray

analysis showed that PhyR and EcfG control highly congruent regulons which include a large

portion of genes of unknown function, suggesting that the PhyR and EcfG regulators control

the Bradyrhizobium–legume interaction and stress responses via yet largely unknown factors.

Among EcfG/PhyR target genes is a cluster of five functionally undefined genes that are

organized in two divergently oriented operons, bll1465-67 and blr1468-69, with two

EcfG-target consensus promoters located between them. Data presented in this chapter shows

that deletion mutants of this gene cluster are symbiotically proficient but more sensitive to

heat exposure and UV radiation than the wild-type strain. Thus, the EcfG/PhyR regulon can

probably be subdivided into genes whose products are crucial for free-living stress

conditions, symbiosis, or both.

Furthermore, biochemical analysis of a putative histidine kinase, Blr1461, which might be

involved in PhyR-/NepR-mediated signalling to EcfG is described in this chapter. However,

attempts to document autophosphorylation of Blr1461-variants have failed, suggesting an

alternative function of this protein. Repeated attempts to construct a deletion mutant in the

blr1461 gene were unsuccessful implying that the function of Blr1461 is probably

indispensable.

 

EcfG-NepR-PhyR signalling cascade

 119 

4.2 Introduction

As described in Chapter I, the regulation of the general stress response in -proteobacteria

involves ECF factor EcfG, its anti- factor NepR and an unusual type of response

regulator, PhyR, which is specific for -proteobacteria (Francez-Charlot et al., 2009). PhyR

consists of an N-terminal ECF factor-like domain and a C-terminal receiver domain. Based

on genetic and biochemical data a "partner switching" model was proposed in which the

receiver domain of PhyR becomes phosphorylated under stress conditions and interacts as an

anti-anti- factor with NepR, thereby releasing EcfG and allowing it to associate with RNA

polymerase to transcribe stress genes (Fig. 4.1; Francez-Charlot et al., 2009).

Fig. 4.1. Partner-switching model proposed for EcfG regulation by PhyR and NepR. PhyR is inactive in unstressed cells and the ECF σ factor EcfG is bound to its anti- factor NepR. One or several unknown histidine kinase(s), possibly belonging to the HWE family (HWE HK), respond(s) to stress conditions and phosphorylate(s) PhyR. Phosphorylated PhyR interacts with NepR, enabling EcfG to associate with RNA polymerase and transcribe target genes. Among the EcfG target genes/operons in Bradyrhizobium japonicum are bll1467-65 and blr1468-69. Modified from Francez-Charlot et al., 2009.

Recent studies unraveled the crystal structures of the phosphorylated factor-like domain of

PhyR in complex with NepR from Sphingomonas sp. and Caulobacter crescentus, and thus

defined the key molecular determinants of the EcfG/NepR/PhyR partner switch mechanism

(Campagne et al., 2012; Herrou et al., 2012).

In B. japonicum, EcfG (Blr7797) is encoded along with its putative anti- factor NepR

(Blr7796) in an operon which is oppositely oriented to the gene for PhyR (Bll7795). Studies

performed with B. japonicum and Sinorhizobium meliloti suggest that EcfG-NepR-PhyR-

mediated regulation in these rhizobial species follows the same mechanism described for the

paradigms Methylobacterium extorquens, Sphingomonas sp. and C. crescentus (Francez-

Charlot et al., 2009; Gourion et al., 2009; Bastiat et al., 2010). Using deletion mutants and

phenotypic analyses it was shown that PhyR and EcfG of B. japonicum are involved in the

general stress response and in formation of an efficient symbiosis. Furthermore, microarray

CHAPTER IV

 120 

analysis revealed that PhyR and EcfG control highly congruent, relatively small regulons

suggesting that both regulators are indeed part of the same signalling cascade. Remarkably, a

large number of genes of unknown function is present in the PhyR/EcfG regulon, and,

together with the conspicuous symbiotic phenotype, this suggests that the PhyR/EcfG

regulators are involved in the Bradyrhizobium–legume interaction via yet unknown factors

(Gourion et al., 2009).

PhyR contains in its C-terminal receiver domain a highly conserved aspartic acid residue

(Asp-194) predicted to be phosphorylated. However, no enzymatic phosphotransfer to the

conserved Asp residue has been shown in any of the systems investigated to date. It was

noted that genes encoding histidine kinases (HKs) are often found in direct vicinity of ecfG

and phyR orthologs in various α-proteobacteria. About 50% of those HKs belong to the HWE

family of HKs (Staroń et al., 2009). Members of this family differ from most other HKs by

the absence of a recognizable F box and the presence of several uniquely conserved amino

acid residues, including a histidine in the N box and a Trp-X-Glu motif in the G1 box, which

was used to define them as HWE HK family (Karniol and Vierstra, 2004). According to the

Interpro database, the B. japonicum genome encodes 7 HWE HKs (Bll0892, Blr1461,

Bll2598, Bll2795, Bll7183, Bll7708, Blr8039).

B. japonicum Blr1461 is a 552-amino-acid protein harboring 2 predicted transmembrane

regions and two conserved domains, a C-terminal cytoplasmic HWE HK domain and a

periplasmic CHASE domain (Cyclases/Histidine Kinases Associated Sensory Extracellular

domain) predicted to bind various molecular weight ligands and found in a number of

bacterial, plant and other eukaryotic receptors (Fig. 4.2; Anantharaman and Aravind, 2001).

Fig. 4.2. Topology model of Blr1461. The figure shows the predicted topology of putative histidine kinase (HK) Blr1461 with annotated domains indicated by ovals. Numbers refer to amino acid positions at the beginning and the end of two transmembrane-spanning, the CHASE and the HWE HK domains.

The blr1461 gene is located in close vicinity to a cluster of presumed EcfG target genes

described in the next paragraph. Very similar HWE HKs are encoded in Bradyrhizobium sp.

BTAi1I (BBta7004; 79% identity) and Bradyrhizobium sp. ORS278 (BRADO1046; 78%

identity) adjacent to the respective nepR-ecfG, phyR loci. Taken together, this made Blr1461

EcfG-NepR-PhyR signalling cascade

 121 

a primary candidate for the presumed kinase phosphorylating PhyR, a hypothesis that was

tested by biochemical analysis of the purified Blr1461 protein derivatives. Repeated attempts

to construct a null mutation in the blr1461 gene were not successful for reasons that are not

obvious. It may indicate an indispensable role of the blr1461 gene for viability of

B. japonicum.

Among the (putative) PhyR/EcfG target genes are the functionally undefined genes

bll/r1465-69, likely to be organized in two oppositely oriented operons as depicted in

Fig. 4.1. Putative EcfG-dependent target promoters are present upstream of bll1467 and

blr1468. In the photosynthetic Bradyrhizobium sp. BTAi1 and ORS278 strains, orthologs of

these genes are present next to the phyR-ecfG locus. For their functional analysis, the genes

were deleted in the B. japonicum genome and a phenotypical characterization of the resulting

strains is presented here.

CHAPTER IV

 122 

4.3 Materials and methods

Bacterial strains and growth conditions

Bacterial strains used in this work are listed in Table 4.1. Escherichia coli and B. japonicum

strains were cultivated as described in sections 2.3. B. japonicum cells were subjected to

carbon starvation as described (Gourion et al., 2009).

Table 4.1. Bacterial strains and plasmids used in this work.

Strain or plasmid Relevant genotype or phenotype Source / Reference

E. coli strains

DH5 supE44 lacU169 (80 lacZM15) hsdR17 recA1 gyrA96 thi-1 relA2

BRL, Gaithersburg, USA

S17-1 Smr Spr hsdR (RP4-2 kan::Tn7 tet::Mu; integrated into the chromosome)

(Simon et al., 1983)

BL21 (ER2566)

fhuA2 lacZ::T7 gene1 Ion ompT gal sulA11R(mcr-73::miniTn10-Tets)2 dcm R(zgb-210::Tn10-Tets) endA1 (mcrC-mrr)144::IS10

New England Biolabs Inc., Ipswich, MA, USA

B. japonicum strains

110spc4 Spr wild type (Regensburger and Hennecke, 1983)

110-RKpol1 Spr Tcr wild type caring pRKpol1 This work

8402 Spr Kmr phyR::aphII (same orientation) (Gourion et al., 2009)

8404 Spr Kmr ecfG::aphII (same orientation) (Gourion et al., 2009)

8439 Spr Kmr (bll1465-1467, blr1468-69)::aphII (same orientation as blr1468-69)

This work

8440 Spr Kmr (bll1465-1467, blr1468-69)::aphII (same orientation as bll1465-67)

This work

8440-RKpol1 Spr Kmr Tcr 8440 carrying pRKpol1 This work

8440-52 Spr Kmr Tcr 8440 carrying pRJ9652 This work

8440-53 Spr Kmr Tcr 8440 carrying pRJ9653 This work

8440-54 Spr Kmr Tcr 8440 carrying pRJ9654 This work

Plasmids

pGEM-T Easy Apr cloning vector Promega, Madison, WI

pBSL86 Apr Kmr (Alexeyev, 1995)

pSUP202pol4 Tcr (pSUP202) part of the polylinker from pBluescript II KS(+) between EcoRI and PstI

(Fischer et al., 1993)

pET-28a(+) Kmr expression vector, used to create a His6-tag fusion at the C-terminus of a protein

Novagen Inc., Nottingham, UK

pET-28b(+) Kmr expression vector, used to create a His6-tag fusion at the C-terminus of a protein

Novagen Inc., Nottingham, UK

pRKpol1 Tcr, broad-host-range vector pRK290 carrying the polylinker of pBLS II (from SacII to ApaI) in the EcoRI site

P. Grob, unpublished

pRJ2455 Kmr (pET-28b(+)) expresses N-terminally His6-tagged RegS portion from Ala-216 to Gly-440

S. Balsiger, unpublished

pRJ8435 Apr Kmr (pBluescript KS(+)) containing downstream region of bll1465 (EcoRI, PstI) plus PstI fragment of pBSL86 containing Kmr cassette (aphII) plus downstream region of

S. Susler, unpublished

EcfG-NepR-PhyR signalling cascade

 123 

blr1469 (PstI, XbaI); aphII is oriented from the downstream region of bll1465 to the downstream region of blr1469

pRJ8436 Apr Kmr (pBluescript KS(+)) containing downstream region of bll1465 (EcoRI, PstI) plus PstI fragment of pBSL86 containing Kmr cassette (aphII) plus downstream region of blr1469 (PstI, XbaI) ; aphII is oriented from the downstream region of blr1469 to the downstream region of bll1465

S. Sulser, unpublished

pRJ8439 Tcr Kmr (pSUP202pol4) containing EcoRI-XbaI fragment of pRJ8436

This work

pRJ8440 Tcr Kmr (pSUP202pol4) containing EcoRI-XbaI fragment of pRJ8435

This work

pRJ9652 Tcr (pRKpol1) containing promoter region and coding regions of bll1465-67 (ClaI, PstI)

This work

pRJ9653 Tcr (pRKpol1) containing promoter region and coding regions of blr1468-69 (XbaI, PstI)

This work

pRJ9654 Tcr (pRJ9652) containing HindIII-XbaI fragment of pRJ9653 with promoter region and coding regions of blr1468-69

This work

pRJ9655 Kmr (pET-28a(+)) expresses N-terminally His-tagged Blr1461 without first transmembrane domain, from Ala-23 to Arg-552 (EcoRI, NdeI)

This work

pRJ9656 Kmr (pET-28a(+)) expresses C-terminally His-tagged Blr1461 without first transmembrane domain, from Ala-23 to Arg-552 (NcoI, HindIII)

This work

pRJ9665 Kmr (pET-28a(+)) expresses N-terminally His-tagged cytoplasmic portion of Blr1461, from Asn-323 to Arg-552 (NdeI, EcoRI)

This work

DNA work

Recombinant DNA work was performed as described in section 2.3.

Mutant construction

Mutant strains 8439 and 8440 ([bll1465-67, blr1468-69]) were constructed by marker-

exchange mutagenesis and differ in orientation of the resistance cassette. The pBluescript

KS(+)-based plasmids pRJ8435 and pRJ8436 containing downstream regions of bll1465 and

blr1469 cloned in tandem, and the aphII gene within the resistance cassette inserted in

between in different orientations were kindly provided by S. Sulser (Table 4.1). The EcoRI-

XbaI DNA fragment containing the bll1465 downstream region, resistance cassette and the

blr1469 downstream region was excised from pRJ8435 and pRJ8436 and transferred into

pSUP202pol4 resulting in plasmids pRJ8440 and pRJ8439, respectively. These plasmids

were then transformed into E. coli S17-1 and mobilized by conjugation into B. japonicum

wild-type strain 110spc4 as previously described (Hahn et al., 1984). The correct genomic

structure of the resulting deletion mutants 8439 and 8440 was verified by PCR. In strain

8439, the cassette was inserted in the same orientation as the deleted bll1465-67 genes, while

CHAPTER IV

 124 

in strain 8440 the cassette was oriented in the opposite direction (Fig. 4.3A). The deletion in

these strains spans the genomic region from position 1’596’210 to 1’599’953.

Fig. 4.3. Genetic map of the bll/r1465-69 locus in B. japonicum wild type and mutant strains. A. Genotype of deletion strains. Genes of the bll/r1465-69 cluster are shown in black, the neighboring genes in white. Below the wild-type region, the genotype of mutants 8439 and 8440 is shown. In the mutants, almost the entire coding region of the deleted genes was replaced by a kanamycin (aphII) resistance gene present on the aphII cassette (light grey bars; for more details, see text). Genome coordinates refer to start and end points of deletions. B. Regions used for complementation of the B. japonicum 8440 mutant strain. Plasmid containing the highlighted regions (open bars) are specified. Genome coordinates refer to start and end points of region for complementation.

To complement the 8440 deletion strain, two DNA fragments containing (i) genes bll1465-67

with the associated promoter region (position no. 1’595’952 to 1’598’550) and (ii)

blr1468-69 with the associated promoter region (position no. 1’597’892 to 1’600’064)

(Fig. 4.3B) were amplified using primer pairs listed in Table S4.1. The fragments were then

cloned in pGEM-T-Easy, verified by sequencing and transferred as ClaI-PstI and XbaI-PstI

fragments, respectively, into pRKpol1 resulting in plasmids pRJ9652 (bll1465-67) and

pRJ9653 (blr1468-69). Using a natural HindIII restriction site located at the beginning of the

bll1467 gene, the two DNA fragments were combined in pRJ9654 which restored the

complete genomic region from position no. 1’595’952 to 1’600’064. Plasmids pRJ9652,

pRJ9653 and pRJ9654 were then transformed into E. coli S17-1 and mobilized by

conjugation into B. japonicum mutant strain 8440, resulting in strains 8440-52, 8440-53 and

8440-54, respectively. As control, pRKpol1 plasmid was conjugated into the wild type and

8440 mutant strain, resulting in strains 110-RKpol1 and 8440-RKpol1, respectively. The

EcfG-NepR-PhyR signalling cascade

 125 

presence of the plasmids was verified by PCR amplification of fragments within the

resistance cassette, bll1467-65 and blr1468-69 regions.

Plant inoculation and cultivation

Soybean G. max (L) Merr. cv. Williams and cv. ‘Green Butterbeans’ (Johnny’s selected

seeds, Albion, ME, USA) were surface-sterilized by soaking seeds 5 min in absolute ethanol

followed by treatment with 17.5% H2O2 (cv. Williams) or with 35% H2O2 (cv. ‘Green

Butterbeans’) for 15 min. Germination, inoculation and cultivation of plants, determination of

the symbiotic phenotype (nodule number, nodule dry weight, acetylene reduction activity)

were done as described previously (Göttfert et al., 1990).

Analyses of stress sensitivity

Sensitivity towards UV radiation, high-salt concentration (NaCl) and desiccation was tested

as described (Gourion et al., 2009). To test heat sensitivity, the strains were cultivated

aerobically in PSY medium supplemented with 0.1% L-arabinose to an optical density at

600 nm 0.8-1. The cell suspentions were adjusted to the same optical density (0.8) and either

directly exposed to 48C for 10, 20, 40 and 60 min or carbon starved overnight prior high

temperature exposure. Dilution series of the cells challenged at 48C were then spotted on

PSY agar plates with 0.1% of L-arabinose and incubated for 3-4 days at 30C.

Overproduction and purification of His-tagged versions of Blr1461

Plasmids pRJ9655 and pRJ9656 encoding N-terminally and C-terminally His-tagged

fragments of Blr1461 spanning from Ala-23 to Arg-552 at the end of the protein were

constructed using pET-28a(+) vector and PCR amplicons generated with the primer pairs

listed in Table S4.1. Similarly, plasmid pRJ5665 encoding an N-terminally His-tagged

cytoplasmic portion of Blr1461 (from Asn-323 to Arg-552) was constructed. Resulting

plasmids were verified by sequencing and transformed into E. coli BL21 (ER2566) cells.

Overnight precultures were used to inoculate the main cultures which were 200 ml (for

analysis of protein expression) or 500 ml (for protein purification) of LB with kanamycin.

Cultures were grown at 37C until they reached an optical density at 600 nm of 0.4. At this

point, expression of the His-tagged Blr1461 versions was induced by addition of IPTG to a

final concentration of 0.5 mM and the cultures were transferred to 30C. After 4 h the cells

CHAPTER IV

 126 

were harvested by centrifugation at 2’600 x g for 10 min at 4C. In an attempt to increase

expression levels of target proteins, expression was induced by addition of IPTG to a final

concentration of 0.1, 0.5, or 1 mM, and conducted overnight at 16C. For protein purification,

BL21 cells containing pRJ9665 were resuspended in 10 ml of Ni2+-NTA binding buffer (20

mM Tris-HCl pH 7.9, 500 mM NaCl, 10% glycerol, 10 mM imidazole containing one tablet

of Complete Protease Inhibitor Cocktail (Roche, Switzerland) per 20 ml). For the analysis of

protein expression and autophosphorylation experiments, cells BL21 containing pRJ9655 or

pRJ9656 were resuspended in 4 ml of TEPDM buffer (Bauer et al., 1998). Cells were then

disrupted by three passages through a French press at 9,000 psi, cell debris were removed by

centrifugation at 22’000 x g for 30 min at 4C. For analysis of protein expression, appropriate

aliquots of the lysates were run on SDS-PAGE gels. Proteins were visualized using

Coomassie Blue or transferred to a membrane for Western blot analysis using an anti-His4

antibody. Affinity purification of His-tagged cytoplasmic portion of Blr1461 was performed

using a self-packed 5 ml Ni2+-NTA column (Qiagen, Hilden, Germany). Unspecifically

bound proteins were washed off with buffers based on 20 mM Tris-HCl pH 7.9, 500 mM

NaCl, 10% glycerol containing increasing concentrations of imidazole from 20 mM to 200

mM. The His6-'Blr1461 protein was eluted with 200 mM imidazole.

Determination of protein concentration, protein electrophoresis and visualization

The procedures were performed as described in section 3.3.

Protein autophosphorylation

The buffer of the His6-'Blr1461 protein eluate was exchanged to TEPDM buffer (Bauer et al.,

1998) using a PD10 desalting column (Amersham Biosciences, now part of GE Healthcare,

Little Chalfont, Buckinghamshire, United Kingdom). Cell lysates were used without buffer

exchange since they were prepared in TEPDM buffer. Each authophosphorylation reaction

contained either 1.5 g of purified His6-'Blr1461 protein, His6-'RegS protein (served as a

positive control; encoded by plasmid pRJ2455) or 500 ng of cell lysate. Protein samples were

mixed with ATP mixture to a final concentration of 33 M ATP (prepared by combining 5 l

of 1 mM cold ATP with 3 l of radiolabeled -32PATP 10 Ci/l with 5000 Ci/mmol).

Reactions of 10 l (final volume) were incubated at room temperature for 1, 5, 10, 30, and 60

min before 5x SDS sample buffer was added to stop the reaction and the samples were run on

EcfG-NepR-PhyR signalling cascade

 127 

a 14% SDS-PAGE gel. The gel was dried on Whatman paper and bands were visualized with

a phosphorimager.

Immunoblot analysis

Samples separated by SDS-PAGE were transferred to a nitrocellulose membrane (Amersham

Bioscience, Buckinghamshire, UK) as described previously (Loferer et al., 1993). The

membrane was blocked overnight at 4C in 5% non-fat milk in TBS-Tween (50 mM Tris-

HCl, 150 mM NaCl, 0.1% Tween 20, pH 7.6). The blocked membrane was incubated for 2 h

at RT with an anti-His4 monoclonal antibody (Qiagen, Hilden, Germany) diluted 1:2000 in

TBS-Tween. The membrane was washed with TBS-Tween and incubated for 2 h at RT with a

horseradish peroxidase-labeled goat anti-mouse antibody (Bio-Rad Laboratories, Richmond,

CA, USA) diluted 1:3,500 in TBS-Tween. After five final washing steps with TBS-Tween,

protein bands with bound immunoglobulins complexes were detected using SuperSignal

West Pico Chemiluminescent Substrate (Pierce Chemicals, Rockford, IL, USA).

Bioinformatic analyses

Searches for amino acid sequence similarities were performed with BlastP

(http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE = Proteins). Topology prediction for the

proteins encoded by bll/r1465-69 cluster genes and Blr1461 was done with TOPCONS

(http://topcons.cbr.su.se/; Bernsel et al., 2009). Protein localization prediction based on signal

peptide search was performed using SignalP 4.0 (http://www.cbs.dtu.dk/services/SignalP/;

Petersen et al., 2011). Prediction of transmembrane regions within a protein was done using

TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/).

CHAPTER IV

 128 

4.4 Results

Bioinformatic analysis of the proteins encoded in the bll/r1465-69 cluster

The proteins encoded by the genes in the bll/r1465-59 cluster are functionally

uncharacterized, yet they comprise a number of conserved domains, which together with

some other features are summarized in Table 4.2. All genes of bll/r1465-69 cluster are

weaker expressed in ecfG and phyR mutants compared to the wild type (Table 4.2).

Table 4.2. Selected features and expression profile of the genes within bll/r1465-69 cluster.

Gene no.a No. of amino acidsb

Putative localizationc

No. ofTMRd

Functional domainsb

Fold changee Starvation PSY

phyR ecfG phyR ecfGbll1467 382 transmembrane 7 TqsA -7.0 -370.0 -23.4 -57.8

bll1466 150 membrane-anchored 1 DUF883 -2.4 -43.2 -4.5 -5.2 bll1465 159 transmembrane 4 - -6.7 -44.8 -2.2 -2.3

blr1468 272 periplasm 0 YkuD -4.6 -60.7 -5.5 -6.4 blr1469 216 periplasm 0 DUF2865 -7.3 -66.2 -7.5 -7.2

a Nomenclature according to Kaneko et al., 2002. Co-transcribed promoter-distal genes indented to the right. b According to Kaneko et al., 2002. c Putative cellular localization of the encoded protein was predicted using TOPCONS. d Number of transmembrane regions (TMR) of the encoded protein was predicted using TMHMM Server v. 2.0. e Expression data from Gourion et al., 2009.

The genes of the cluster are restricted to the Bradyrhizobiaceae family according to a

STRING database analysis. Since no conserved domain was found in Bll1465 and only the

domains of unknown function (DUF) were identified in Bll1466 and Blr1469 (Table 4.2), no

prediction of the function for these proteins could be made. Bll1467 harbors a "pheromone

autoinducer 2 transporter domain" (TqsA) previously reported to control biofilms formation

in E. coli (Herzberg et al., 2006). Blr1468 contains a L,D-transpeptidase catalytic domain

(YkuD) involved in an alternative pathways for peptidoglycan cross-linking in bacteria

(Biarrotte-Sorin et al., 2006). Nevertheless, the available information about these proteins is

not sufficient to predict a cellular function of this group of proteins.

Tiling analysis based on previously generated microarray data from ecfG and phyR

mutants and the wild type all grown aerobically in PSY revealed that genes bll1465-67 and

blr1468-blr1469 are co-regulated, as they respond similarly to the deletion of EcfG or PhyR

and are likely organized in operons (Fig. 4.4). The operon structure was further supported by

the identification of two divergently oriented consensus EcfG-target promoters upstream of

bll1467 and blr1468 (Gourion et al., 2009).

EcfG-NepR-PhyR signalling cascade

 129 

Fig. 4.4. Transcript analysis of the bll1465-bll1467 (A) and blr1468-blr1469 (B) regions. Hybridization signal intensities derived from individual oligonucleotide probe pairs of the bll1465-bll1467 and blr1468-blr1469 regions, using B. japonicum RNA from aerobically grown wild-type strain (), phyR (□) and ecfG () mutant strains. For better visualization, individual data points were connected by solid lines. Genes were assigned according to the annotation of Kaneko et al., 2002.

Genes of the bll/r1465-59 cluster are not required for symbiosis but are involved in the

stress response of B. japonicum

In order to investigate the function of the bll/r1465-69 cluster in B. japonicum, mutant strains

8439 and 8440 (bll1465-67, blr1468-69) were constructed (Fig. 4.3A). Both mutant strains

were symbiotically proficient and indistinguishable from the wild type when tested on two

soybean varieties (Glycine max cv. Williams 82 and cv. “Green Butterbean”) (data not

shown). Moreover, growth of both mutants was similar to that of the wild type when the

strains were grown in rich medium (PSY; aerobic and micro-oxic conditions) or in minimal

medium (aerobic conditions) (data not shown).

The tolerance to heat exposure, UV radiation, high-salt concentration (NaCl) and desiccation

of mutant strains 8439 and 8440 was compared to the wild type. When bacteria were

cultivated aerobically in PSY and challenged with different stresses during late exponential

growth phase no significant and/or reproducible differences between the mutants and the wild

type were observed (data not shown). However, when cells were subjected to overnight

carbon starvation in minimal medium prior exposure to stress, both mutant strains showed

higher sensitivity towards heat exposure (Fig. 4.5) and UV radiation (Fig. 4.6). No significant

difference was found in respect to high salt conditions and desiccation (data not shown).

CHAPTER IV

 130 

Fig. 4.5. Heat sensitivity test. Cultures of B. japonicum wild type, ecfG mutant strain (for comparison) and 8440 (bll1465-67, blr1468-69) were pre-grown to early stationary phase and subjected to overnight carbon starvation. Then the cells were incubated at 48C for 10 min and aliquots of serial dilutions were spotted (four independent dilution series per strain). The cells spotted on the plate shown in the upper panel were not exposed to heat (for more details, see Materials and Methods).

Fig. 4.6. UV sensitivity test. Cultures of B. japonicum wild type and mutant strain 8440 (bll1465-67, blr1468-69) were pre-grown to early stationary phase and subjected to overnight carbon starvation. Then aliquots of serial dilutions were spotted on plates (four independent dilution series per strain) and exposed to UV for 20 sec. The control plate shown on the left panel was not exposed to UV (for more details, see Materials and Methods).

In mutant strain 8440 the resistance cassette is inserted in the same orientation as the deleted

blr1468-69 genes and probably does not influence transcription of the downstream genes

which are oriented in the opposite direction. Using this strain, an attempt was made to restore

wild-type properties by complementation to probably narrow down the genes which, when

absent, caused the phenotypic defects. Plasmids pRJ9652, pRJ9653 and pRJ9654 harboring

regions bll1465-67, blr1468-69 or the entire bll/r1465-69 region, respectively, were

constructed and mobilized by conjugation into B. japonicum 8440 resulting in 8440-52,

8440-53 and 8440-54 strains, respectively. As controls, pRKpol1 was mobilized into the

wild-type strain and into 8440 resulting in strains 110-RKpol1 and 8440-RKpol1,

respectively. All plasmid-containing strains derived from 8440 were as sensitive to heat

EcfG-NepR-PhyR signalling cascade

 131 

exposure and UV radiation as the 8440-RKpol1 strain (data not shown) indicating that

complementation was not successful.

Biochemical analysis of Blr1461

In order to study the biochemical properties of Blr1461, plasmids pRJ9655 and pRJ9656

encoding an N- or C-terminally His6-tagged Blr1461 fragment from Ala-23Arg-552 at the

end of the protein, respectively, were constructed. The first transmembrane domain was

omitted in hope to increase solubility of the His-tagged proteins. The overexpression of the

desired proteins in E. coli BL21 was tested by SDS-PAGE gel stained with Coomassie blue.

A band of the expected size was detected in E. coli containing plasmid pRJ9655, but not in

the cells carring pRJ9656. Analysis of the soluble proteins documented that the N-terminally

tagged Blr1461 protein expressed from pRJ9655 was mostly insoluble. In an attempt to

increase the proportion of soluble N-terminally tagged Blr1461 protein, and to produce the C-

terminally tagged Blr1461 expressed from pRJ9656 in higher quantities, the protocol was

modified. Protein expression was induced by 0.1, 0.5 or 1 mM of IPTG and conducted

overnight at 16C. Yet, no significant increase in protein solubility and/or production was

achieved (Fig. 4.7). An attempt to purify the N-terminally tagged Blr1461 from the soluble

fraction using Ni2+-NTA agarose column was not successful (data not shown).

Fig. 4.7. Overexpression of His6-‘Blr1461 and ‘Blr1461-His6 variants in E. coli. Proteins of crude lysates (A) and soluble fraction (B) of BL21 cells harboring pRJ9655 (His6-'Blr1461; 61.0 kDa) and pRJ9656 ('Blr1461-His6; 62.5 kDa) plasmids were analyzed by SDS-PAGE. Protein expression was induced by IPTG at 0.1 mM (lanes 1), 0.5 mM (lanes 2) and 1 mM (lanes 3) and conducted overnight

at 16C. The lanes marked with asterisks show the proteins from BL21 cells harboring pRJ9655 with protein expression induced by 1 mM IPTG and conducted at 30C for 3 hours. Arrows on the left indicate the bands of the fusion protein His6-'Blr1461.

Since we could not purify the Blr1461 variants described above, lysates of BL21 E. coli cells

carying pRJ9654, pRJ9655 or pET-18a(+) were used to test autophosphorylation of these

proteins. The lysates were incubated with radioactive -P32 labeled ATP as described in

Material and Methods. No difference in the phosphorylation pattern between the strains

expressing tagged Blr1461 variants and the control strain harboring pET-18a(+) was detected,

CHAPTER IV

 132 

indicating that the Blr1461 variants were unable to autophosphorylate under the conditions

tested (data not shown).

In addition, plasmid pRJ9665 encoding only the cytoplasmic portion of Blr1461 (from

Asn-323 to Arg-552) with an N-terminal His6-tag was constructed. Higher solubility and

expression level of the His6-tagged cytoplasmic portion of Blr1461 allowed purification of

this protein from E. coli BL21 cells (Fig. 4.8), which was then tested for autophosphorylation

(Fig. 4.9).

Fig. 4.8. Overexpression and purification of N-terminally His6-tagged cytoplasmic portion of Blr1461 protein in E. coli. A. Proteins of total lysates or soluble fractions of E. coli BL21 cells containing pRJ9665 (His6-tagged 'Blr1461 fragment from Asn-323 to Arg-552; 28.0 kDa) are shown on Coomassie-stained SDS-PAGE gels. Samples were prepared from non-induced () and IPTG induced (+) cells. B. Coomassie-stained SDS-PAGE gel shows 0.5 g His6-'Blr1461 protein purified using a gravity flow Ni2+-NTA agarose column. For more details, see Materials and Methods.

Fig. 4.9. Result of autophosphorylation of purified His6-'Blr1461 and His6-RegS. Purified cytoplasmic portion of Blr1461 was incubated with -32PATP at room temperature for 1, 5, 10, 30 and 60 min (lanes 1-5). Purified RegS was used as a positive control and was incubated with -32PATP under the same conditions for 5 and 30 min, lanes 6 and 7, respectively.

No autophosphorylation of the cytoplasmic Blr1461 portion was detected in contrast to the

positive control in which autophosphorylation of a soluble RegS variant was monitored. The

failure to detect phosphorylation of tagged Blr1461 variants may indicate that the HWE HK

domain of Blr1461 is not functional in these derivatives, the conditions used to test

autophosphorylation were not appropriate, or Blr1461 is not a conventional histidine kinase

(or a combination of these possibilities).

EcfG-NepR-PhyR signalling cascade

 133 

4.5 Discussion

Genes under control of the general stress response cascade consisting of EcfG, NepR and

PhyR in B. japonicum encode mainly functionally uncharacterized proteins. Among them is

the bll/r1465-69 gene cluster. Mutational analysis of the bll/r1465-69 cluster presented here

showed that these genes are required, in the wild type, for tolerance to heat exposure and UV

radiation, but they are dispensable for symbiosis of B. japonicum. The stress sensitivity

phenotype was observed only when cells were starved for carbon prior to stress exposure.

Such pretreatment was also needed to document the elevated stress sensitivity of ecfG and

phyR mutant strains, which further supports the assumption that EcfG-NepR-PhyR cascade

controls transcription of the genes within bll/r1465-69 cluster. It is concluded, that at least

one if not several or all genes of the bll/r1465-69 cluster are required for heat and

UV-radiation resistance.

Attempts to narrow down by complementation the gene(s) within the bll/r1465-69 cluster

which, when deleted, caused the observed phenotype of mutants 8439 and 8440 were not

successful. When the deleted region was introduced on the replicating plasmid pRJ9654 into

the 8440 deletion mutant, wild-type tolerance levels towards heat and UV-radiation could not

be restored. It is possible that the prediction of the operon structure by the tiling analysis (Fig.

4.4) and bioinformatics is incorrect. While the blr1468-69 operon is restricted to two genes

because the next gene downstream of blr1469, bll1470, is oriented in the opposite direction,

the bll1467-65 operon could include additional gene(s), because the adjacent three genes,

bll1464 to bll1462, are all oriented in the same direction as the bll1467-65 operon with rather

short intergenic regions. If this was true the deletion in strain 8440 might have polar effects

which cannot be corrected by plasmid pRJ9654. Formally, the elevated copy number of the

genes present on plasmid pRJ9654 could be another explanation for the unsuccessful

complementation experiment.

Finally, the predicted histidine kinase Blr1461 was analyzed in this part of the work. Interest

in this protein is based on the co-localization of genes encoding orthologs of Blr1461 with the

phyR-ecfG locus in photosynthetic rhizobia and also because the blr1461 gene is located

close to the EcfG/NepR/PhyR-regulated bll/r1465-69 gene cluster in B. japonicum. Given

these observations, it was hypothesized that Blr1461 might be involved in phosphorylation of

PhyR. It was found that (i) blr1461 likely codes for an essential protein with an important, yet

unknown, cellular function because several attempts to delete this gene were not successful,

CHAPTER IV

 134 

and (ii) despite the conserved HWE HK domain in Blr1461, its function might be different

from a conventional kinase since tested variants of Blr1461 did not exhibit

autophosphorylation activity.

EcfG-NepR-PhyR signalling cascade

 135 

4.6 Supplementary material

Table S4.1. Primers used in this study.

Primer pairs

Sequencea Resulting PCR products or location

Used for

1469-1 1469-2

5’-ACTGCAGCCGAATGCGAGTTTGGCGGCA CGCAGATAACCAC-3’ 5’-AATCTAGAGGCGACGCAGGAGATCACC CGCAGCACGCAATATG-3’

550 bp downstream region of blr1469

pRJ8432

1465-1 1465-2

5’-GGAATTCGAAAGATGCGTGTCGCCGCGACGACGTAG-3’ 5’-ACTGCAGGTCGCACTCGGAATCATGGCG AGTAGG-3’

595 bp downstream region of bll1465

pRJ8432

1465-4 1468-1

5’-GACATCGATTTTGCGTGAGGAGGGCCGG TTTGTC-3’ 5’-CTACTGCAGTCTGCGCATTTGCGCTGCC GAAAGG-3’

2599 bp containing promoter and coding regions of bll1465-67

pRJ9652, pRJ9654

1467-3 1469-4

5’-CTACTGCAGATTCCATTGCGGGCACGGC AATCAG-3’ CTTAGATCTCGGGCATTGCATCACGCGAGA TGTC-3’

2173 bp containing promoter and coding regions of blr1468-69

pRJ9688, pRJ9715

1461-F1 1461-R1

AGCCATATGGCCTATCGCGTCCACGAC GCTGGAATTCTTATCGCACAGGCCTCACC

1612 bp containing 'blr1461 coding for fragment from Ala-23 to Arg-552

pRJ9655

1461-F2 1461-R2

ATTGACCATGGCCTATCGCGTCCACGAC TATGGAAGCTTGTCGCACAGGCCTCACCG

1612 bp containing 'blr1461 coding for fragment from Ala-23 to Arg-552

pRJ9656

1461-F3

AGCCATATGAACAATCTGCGGCTCAGCC Used in combination with 1461-R1

711 bp containing 'blr1461 coding for fragment from Asn-323 to Arg-552

pRJ9665

1467-1 1467-2

GAGTGCGTTCAGCGACAACC ACTTCGTCACGCCGACCATC

Used to sequence bll1465-7 region on pRJ9652

1468-2 1468-3

CCACCACCATCGGCAAGTTC ACCCTGGCGCCGATATTGAC

Used to sequence blr1468-9 complementation region pRJ9653

a Engineered restriction enzyme sites are underlined.

 

  

 

  

CHAPTER V Future perspectives  

CHAPTER V

 138 

In the present work, we investigated the role of ECF factors in the oxidative and general

stress response of Bradyrhizobium japonicum. Regulatory pathways controlling

expression/activity of these factors and functions of their target genes were characterized to

different extents. Despite considerable progress, many open questions remain.

5.1 Oxidative stress response in B. japonicum

In this work, two ECF factors, EcfQ and EcfF, involved in the oxidative stress response in

B. japonicum were characterized. The results are summarized in a working model of the

oxidative stress response in B. japonicum (Fig. 5.1).

Fig. 5.1. Working model of oxidative stress response in B. japonicum. This model integrates data presented in Chapters II and III of this work. Transcription factors (TF) are represented by hexagons. TFs whose expression is influenced by ROS are colored in gray. EcfQ-related elements are depicted in green. The conserved palindromic repeats upstream of ecfQ are represented by rectangles. A hypothetical yet unidentified TF controlling expression of ecfQ and EcfQ-target genes are depicted. The EcfF-OsrA regulatory cascade is depicted in purple. Topology of OsrA is shown with methionine residues represented by bars and cysteine residues by circles. Cysteine 129 which might be involved in the OsrA-EcfF interaction is shown by an open circle and cysteine 179 required for H2O2 sensing by a solid circle. EcfF-target promoters are symbolized by two rectangles with the nucleotides defining the consensus promoter indicated above them. EcfF-target genes including the system of methionine-sulfoxide reductases (MsrA/B) are colored in blue. Electron (e-) transfer pathways from thioredoxin (Trx) to MsrA/B are shown by arrows.

Regarding the EcfF-OsrA cascade, several questions would be interesting to further pursue.

Among EcfF-targets we found genes that encode a putative enzymatic system to repair

Future perspectives

 139 

oxidized methionines in proteins. It includes three methionine sulfoxide reductases and two

proteins containing a DsbD- and thioredoxin-like domain, respectively (Fig. 5.1).

To provide further evidence for the involvement of EcfF-OsrA in methionine sulfoxide repair

one could compare the proportion of oxidized methionines of selected proteins in the wild

type with that in the (ecfF-osrA) and/or osrA mutant. To experimentally detect the status

of methionines, a targeted proteomics approach could be chosen. Using this method, the mass

of selected methionine-containing proteins or peptides could be monitored, which should

provide information about the oxidation state of the methionine(s). Mass spectrometry-based

proteomics is probably well suited because of its high sensitivity and resolution combined

with the possibility to monitor multiple peptides at the same time. Target proteins need to be

chosen carefully with regard to their amino acid sequence, expression level and cellular

localization. In principle, the same approach could be used to investigate whether OsrA

senses stimuli through oxidation of its cysteine and/or methionine residues. Since OsrA is a

transmembrane protein and presumably weakly expressed, the lysates of B. japonicum cells

should be enriched for OsrA prior to proteomic analysis.

Another aspect that was not completed in this work, concerns deletion mutants (ecfS-tmrS)

and (ecfF-osrA; ecfS-tmrS) which were constructed but not yet analyzed. In the future, their

phenotypic characterization must be conducted in order to study similarities and differences

in the function(s) of the EcfF-OsrA and EcfS-TmrR regulatory systems.

With regard to the EcfQ regulatory pathway, identification of the transcription factor

controlling expression of ecfQ would be of a particular interest. A pull-down approach with

the upstream region of ecfQ could be used to fish the putative DNA-binding protein which

may be present in B. japonicum to induce ecfQ transcription in response to oxidative stress.

Because attempts to identify a consensus promoter sequence recognized by EcfQ were not

successful, the list of potential EcfQ target genes should be verified. To do so a strain

overexpressing EcfQ could be constructed and analyzed by microarrays. Genes upregulated

in this strain and downregulated in the ecfQ mutant are good candidates for direct EcfQ

targets. Their upstream regions should thus be inspected for a common motif which may be

recognized by EcfQ.

Finally, apart from ecfF and ecfQ, expression of 27 genes encoding transcription factors was

altered upon H2O2 exposure (Fig. 5.1). The question remains, however, whether these genes

contribute to the oxidative stress response in B. japonicum or not. To investigate this aspect,

bioinformatic analysis could be conducted in order to select the TFs whose orthologs are

CHAPTER V

 140 

involved in oxidative stress response in other bacteria. Rather demanding and time

consuming approaches to construct deletion mutants and analyze them phenotypically could

be then used to identify the role of these TFs in the oxidative stress response of B. japonicum.

5.2 EcfG-NepR-PhyR regulatory cascade

Genes contributing to the phenotype of the ecfG and phyR deletion strains

Despite rather extensive knowledge of the EcfG-NepR-PhyR signaling mechanism, functions

of the EcfG-target genes are largely unknown. To continue characterization of the

bll/r1465-69 gene cluster, complementation of the (bll1467-65, blr1468-69) deletion strain

using longer DNA regions which include genes downstream of bll1465 could be attempted.

Such an approach would restore transcription of the downstream genes, if prediction of the

operon structure was incorrect. Furthermore, once established, the complementation approach

could be used to narrow down the role of individual genes. Based on a plasmid that can

complement the phenotype of the deletion mutant, a set of plasmids lacking individual genes

could be constructed and tested for complementation ability.

Function of the putative histidine kinase Blr1461

Rather unexpectedly, we failed to construct a blr1461 deletion mutant, meaning that the

function of Blr1461 might be essential for viability of B. japonicum. For a number of

bacterial species, tools for construction of conditional knockout mutants are well established.

Unfortunately, no such tools are available to date for B. japonicum. Development of a

controlled expression system is thus an interesting perspective not only in the context of the

analysis of blr1461 but also for other purposes. Examples of promoters that might be tested

are nodulation gene promoters that can be induced by flavonoids. As an alternative to a

conditional blr1461 mutant a strain overexpressing Blr1461 could be constructed followed by

comparison of the gene expression pattern of this strain with that of wild type. This approach

would reveal the genes whose expression is under Blr1461 influence.

 

  

REFERENCES

Aguirre, J.D., and Culotta, V.C. (2012) Battles with iron: manganese in oxidative stress protection. J Biol Chem 287: 13541-13548.

Akyol, I., and Shearman, C.A. (2008) Regulation of flpA, flpB and rcfA promoters in Lactococcus lactis. Curr Microbiol 57: 200-205.

Alamuri, P., and Maier, R.J. (2004) Methionine sulphoxide reductase is an important antioxidant enzyme in the gastric pathogen Helicobacter pylori. Mol Microbiol 53: 1397-1406.

Alexeyev, M.F. (1995) Three kanamycin resistance gene cassettes with different polylinkers. Biotechniques 18: 52, 54, 56.

Altuvia, S., Weinstein-Fischer, D., Zhang, A., Postow, L., and Storz, G. (1997) A small, stable RNA induced by oxidative stress: role as a pleiotropic regulator and antimutator. Cell 90: 43-53.

Alvarez-Martinez, C.E., Baldini, R.L., and Gomes, S.L. (2006) A Caulobacter crescentus extracytoplasmic function sigma factor mediating the response to oxidative stress in stationary phase. J Bacteriol 188: 1835-1846.

Alvarez-Martinez, C.E., Lourenço, R.F., Baldini, R.L., Laub, M.T., and Gomes, S.L. (2007) The ECF sigma factor T is involved in osmotic and oxidative stress responses in Caulobacter crescentus. Mol Microbiol 66: 1240-1255.

Anantharaman, V., and Aravind, L. (2001) The CHASE domain: a predicted ligand-binding module in plant cytokinin receptors and other eukaryotic and bacterial receptors. Trends Biochem Sci 26: 579-582.

Antelmann, H., and Helmann, J.D. (2011) Thiol-based redox switches and gene regulation. Antioxid Redox Signal 14: 1049-1063.

Antelmann, H., Engelmann, S., Schmid, R., Sorokin, A., Lapidus, A., and Hecker, M. (1997) Expression of a stress- and starvation-induced dps/pexB-homologous gene is controlled by the alternative sigma factor B in Bacillus subtilis. J Bacteriol 179: 7251-7256.

Anthony, J.R., Newman, J.D., and Donohue, T.J. (2004) Interactions between the Rhodobacter sphaeroides ECF sigma factor, E, and its anti-sigma factor, ChrR. J Mol Biol 341: 345-360.

Anthony, J.R., Warczak, K.L., and Donohue, T.J. (2005) A transcriptional response to singlet oxygen, a toxic byproduct of photosynthesis. Proc Natl Acad Sci U S A 102: 6502-6507.

Apel, K., and Hirt, H. (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol 55: 373-399.

Ardissone, S., Frendo, P., Laurenti, E., Jantschko, W., Obinger, C., Puppo, A., and Ferrari, R.P. (2004) Purification and physical-chemical characterization of the three hydroperoxidases from the symbiotic bacterium Sinorhizobium meliloti. Biochemistry 43: 12692-12699.

Arnason, J.T., Towers, G.H.N., Philogène, B.J.R., and Lambert, J.D.H. (1983) The role of natural photosensitizers in plant resistance to insects. In Plant resistance to insects. Hedin, P. (ed). Washington, DC, USA., pp. 139-151.

Arnér, E.S., and Holmgren, A. (2000) Physiological functions of thioredoxin and thioredoxin reductase. Eur J Biochem 267: 6102-6109.

Arosio, P., Ingrassia, R., and Cavadini, P. (2009) Ferritins: a family of molecules for iron storage, antioxidation and more. Biochim Biophys Acta 1790: 589-599.

Arsène, F., Tomoyasu, T., and Bukau, B. (2000) The heat shock response of Escherichia coli. Int J Food Microbiol 55: 3-9.

References

 142 

Aslund, F., and Beckwith, J. (1999) The thioredoxin superfamily: redundancy, specificity, and gray-area genomics. J Bacteriol 181: 1375-1379.

Atack, J.M., and Kelly, D.J. (2008) Contribution of the stereospecific methionine sulphoxide reductases MsrA and MsrB to oxidative and nitrosative stress resistance in the food-borne pathogen Campylobacter jejuni. Microbiology 154: 2219-2230.

Bae, H.W., and Cho, Y.H. (2012) Mutational analysis of Pseudomonas aeruginosa OxyR to define the regions required for peroxide resistance and acute virulence. Res Microbiol 163: 55-63.

Bae, J.B., Park, J.H., Hahn, M.Y., Kim, M.S., and Roe, J.H. (2004) Redox-dependent changes in RsrA, an anti-sigma factor in Streptomyces coelicolor: zinc release and disulfide bond formation. J Mol Biol 335: 425-435.

Barik, S., Sureka, K., Mukherjee, P., Basu, J., and Kundu, M. (2010) RseA, the SigE specific anti-sigma factor of Mycobacterium tuberculosis, is inactivated by phosphorylation-dependent ClpC1P2 proteolysis. Mol Microbiol 75: 592-606.

Barloy-Hubler, F., Cheron, A., Hellegouarch, A., and Galibert, F. (2004) Smc01944, a secreted peroxidase induced by oxidative stresses in Sinorhizobium meliloti 1021. Microbiology 150: 657-664.

Barne, K.A., Bown, J.A., Busby, S.J., and Minchin, S.D. (1997) Region 2.5 of the Escherichia coli RNA polymerase 70 subunit is responsible for the recognition of the 'extended-10' motif at promoters. EMBO J 16: 4034-4040.

Barnett, M.J., Bittner, A.N., Toman, C.J., Oke, V., and Long, S.R. (2012) Dual RpoH sigma factors and transcriptional plasticity in a symbiotic bacterium. J Bacteriol 194: 4983-4994.

Baroli, I., Gutman, B.L., Ledford, H.K., Shin, J.W., Chin, B.L., Havaux, M., and Niyogi, K.K. (2004) Photo-oxidative stress in a xanthophyll-deficient mutant of Chlamydomonas. J Biol Chem 279: 6337-6344.

Barth, E., Gora, K.V., Gebendorfer, K.M., Settele, F., Jakob, U., and Winter, J. (2009) Interplay of cellular cAMP levels, S activity and oxidative stress resistance in Escherichia coli. Microbiology 155: 1680-1689.

Bastiat, B., Sauviac, L., and Bruand, C. (2010) Dual control of Sinorhizobium meliloti RpoE2 sigma factor activity by two PhyR-type two-component response regulators. J Bacteriol 192: 2255-2265.

Battesti, A., Majdalani, N., and Gottesman, S. (2011) The RpoS-mediated general stress response in Escherichia coli. Annu Rev Microbiol 65: 189-213.

Batut, J., Andersson, S.G., and O'Callaghan, D. (2004) The evolution of chronic infection strategies in the -proteobacteria. Nat Rev Microbiol 2: 933-945.

Bauer, E., Kaspar, T., Fischer, H.M., and Hennecke, H. (1998) Expression of the fixR-nifA operon in Bradyrhizobium japonicum depends on a new response regulator, RegR. J Bacteriol 180: 3853-3863.

Becana, M., and Klucas, R.V. (1992) Transition metals in legume root nodules: iron-dependent free radical production increases during nodule senescence. Proc Natl Acad Sci U S A 89: 8958-8962.

Becana, M., Matamoros, M.A., Udvardi, M., and Dalton, D.A. (2010) Recent insights into antioxidant defenses of legume root nodules. New Phytol 188: 960-976.

Beck, C., Marty, R., Kläusli, S., Hennecke, H., and Göttfert, M. (1997) Dissection of the transcription machinery for housekeeping genes of Bradyrhizobium japonicum. J Bacteriol 179: 364-369.

References

 143 

Bellapadrona, G., Ardini, M., Ceci, P., Stefanini, S., and Chiancone, E. (2010) Dps proteins prevent Fenton-mediated oxidative damage by trapping hydroxyl radicals within the protein shell. Free Radic Biol Med 48: 292-297.

Bernsel, A., Viklund, H., Hennerdal, A., and Elofsson, A. (2009) TOPCONS: consensus prediction of membrane protein topology. Nucleic Acids Res 37: W465-468.

Biarrotte-Sorin, S., Hugonnet, J.E., Delfosse, V., Mainardi, J.L., Gutmann, L., Arthur, M., and Mayer, C. (2006) Crystal structure of a novel -lactam-insensitive peptidoglycan transpeptidase. J Mol Biol 359: 533-538.

Bittner, A.N., and Oke, V. (2006) Multiple groESL operons are not key targets of RpoH1 and RpoH2 in Sinorhizobium meliloti. J Bacteriol 188: 3507-3515.

Bittner, A.N., Foltz, A., and Oke, V. (2007) Only one of five groEL genes is required for viability and successful symbiosis in Sinorhizobium meliloti. J Bacteriol 189: 1884-1889.

Blattner, F.R., Plunkett, G., Bloch, C.A., Perna, N.T., Burland, V., Riley, M. et al. (1997) The complete genome sequence of Escherichia coli K-12. Science 277: 1453-1462.

Bonnet, M. (2011) Biochemical studies on FixK2, a global regulatory protein from Bradyrhizobium japonicum: proteolytic control and attempts at crystallization. Dissertation ETH Zürich No.19926.

Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254.

Brooks, B.E., and Buchanan, S.K. (2008) Signaling mechanisms for activation of extracytoplasmic function (ECF) sigma factors. Biochim Biophys Acta 1778: 1930-1945.

Brot, N., Collet, J.F., Johnson, L.C., Jonsson, T.J., Weissbach, H., and Lowther, W.T. (2006) The thioredoxin domain of Neisseria gonorrhoeae PilB can use electrons from DsbD to reduce downstream methionine sulfoxide reductases. J Biol Chem 281: 32668-32675.

Bsat, N., Herbig, A., Casillas-Martinez, L., Setlow, P., and Helmann, J.D. (1998) Bacillus subtilis contains multiple Fur homologues: identification of the iron uptake (Fur) and peroxide regulon (PerR) repressors. Mol Microbiol 29: 189-198.

Buchmeier, N., Bossie, S., Chen, C.Y., Fang, F.C., Guiney, D.G., and Libby, S.J. (1997) SlyA, a transcriptional regulator of Salmonella typhimurium, is required for resistance to oxidative stress and is expressed in the intracellular environment of macrophages. Infect Immun 65: 3725-3730.

Bueno, P., Soto, M.J., Rodríguez-Rosales, M.P., Sanjuan, J., Olivares, J., and Donaire, J.P. (2001) Time-course of lipoxygenase, antioxidant enzyme activities and H2O2 accumulation during the early stages of Rhizobium–legume symbiosis. New Phytologist 152: 91-96.

Bush, M., and Dixon, R. (2012) The role of bacterial enhancer binding proteins as specialized activators of 54-dependent transcription. Microbiol Mol Biol Rev 76: 497-529.

Bussmann, M., Baumgart, M., and Bott, M. (2010) RosR (Cg1324), a hydrogen peroxide-sensitive MarR-type transcriptional regulator of Corynebacterium glutamicum. J Biol Chem 285: 29305-29318.

Cadenas, E. (1989) Biochemistry of oxygen toxicity. Annu Rev Biochem 58: 79-110. Campagne, S., Damberger, F.F., Kaczmarczyk, A., Francez-Charlot, A., Allain, F.H., and

Vorholt, J.A. (2012) Structural basis for sigma factor mimicry in the general stress response of Alphaproteobacteria. Proc Natl Acad Sci U S A 109: E1405-1414.

Campbell, E.A., Greenwell, R., Anthony, J.R., Wang, S., Lim, L., Das, K. et al. (2007) A conserved structural module regulates transcriptional responses to diverse stress signals in bacteria. Mol Cell 27: 793-805.

References

 144 

Carpenter, B.M., Whitmire, J.M., and Merrell, D.S. (2009) This is not your mother's repressor: the complex role of Fur in pathogenesis. Infect Immun 77: 2590-2601.

Carter, R.A., Worsley, P.S., Sawers, G., Challis, G.L., Dilworth, M.J., Carson, K.C. et al. (2002) The vbs genes that direct synthesis of the siderophore vicibactin in Rhizobium leguminosarum: their expression in other genera requires ECF factor RpoI. Mol Microbiol 44: 1153-1166.

Chang, C., Damiani, I., Puppo, A., and Frendo, P. (2009) Redox changes during the legume-rhizobium symbiosis. Mol Plant 2: 370-377.

Chen, L., Keramati, L., and Helmann, J.D. (1995) Coordinate regulation of Bacillus subtilis peroxide stress genes by hydrogen peroxide and metal ions. Proc Natl Acad Sci U S A 92: 8190-8194.

Chen, L., Ge, X., Wang, X., Patel, J.R., and Xu, P. (2012) SpxA1 involved in hydrogen peroxide production, stress tolerance and endocarditis virulence in Streptococcus sanguinis. PLoS One 7: e40034.

Chen, L., Sharma, P., Le Gall, J., Mariano, A.M., Teixeira, M., and Xavier, A.V. (1994) A blue non-heme iron protein from Desulfovibrio gigas. Eur J Biochem 226: 613-618.

Chen, N.Y., Zhang, J.J., and Paulus, H. (1989) Chromosomal location of the Bacillus subtilis aspartokinase II gene and nucleotide sequence of the adjacent genes homologous to uvrC and trx of Escherichia coli. J Gen Microbiol 135: 2931-2940.

Chen, P.R., Bae, T., Williams, W.A., Duguid, E.M., Rice, P.A., Schneewind, O., and He, C. (2006) An oxidation-sensing mechanism is used by the global regulator MgrA in Staphylococcus aureus. Nat Chem Biol 2: 591-595.

Chen, P.R., Nishida, S., Poor, C.B., Cheng, A., Bae, T., Kuechenmeister, L. et al. (2009) A new oxidative sensing and regulation pathway mediated by the MgrA homologue SarZ in Staphylococcus aureus. Mol Microbiol 71: 198-211.

Chen, Y.F., Helmann J.D. (1992) Restoration of motility to an Escherichia coli fliA flagellar mutant by a Bacillus subtilis sigma factor. Proc Natl Acad Sci U S A 89:5123-5127.

Chen, Z., Lewis, K.A., Shultzaberger, R.K., Lyakhov, I.G., Zheng, M., Doan, B. et al. (2007) Discovery of Fur binding site clusters in Escherichia coli by information theory models. Nucleic Acids Res 35: 6762-6777.

Chiang, S.M., and Schellhorn, H.E. (2010) Evolution of the RpoS regulon: origin of RpoS and the conservation of RpoS-dependent regulation in bacteria. J Mol Evol 70: 557-571.

Chiang, S.M., and Schellhorn, H.E. (2012) Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Arch Biochem Biophys.

Choi, H., Kim, S., Mukhopadhyay, P., Cho, S., Woo, J., Storz, G., and Ryu, S.E. (2001) Structural basis of the redox switch in the OxyR transcription factor. Cell 105: 103-113.

Choi, S.Y., Reyes, D., Leelakriangsak, M., and Zuber, P. (2006) The global regulator Spx functions in the control of organosulfur metabolism in Bacillus subtilis. J Bacteriol 188: 5741-5751.

Christman, M.F., Morgan, R.W., Jacobson, F.S., and Ames, B.N. (1985) Positive control of a regulon for defenses against oxidative stress and some heat-shock proteins in Salmonella typhimurium. Cell 41: 753-762.

Chuchue, T., Tanboon, W., Prapagdee, B., Dubbs, J.M., Vattanaviboon, P., and Mongkolsuk, S. (2006) ohrR and ohr are the primary sensor/regulator and protective genes against organic hydroperoxide stress in Agrobacterium tumefaciens. J Bacteriol 188: 842-851.

Chung, H.J., Kim, E.J., Suh, B., Choi, J.H., and Roe, J.H. (1999) Duplicate genes for Fe-containing superoxide dismutase in Streptomyces coelicolor A3(2). Gene 231: 87-93.

Claiborne, A., and Fridovich, I. (1979) Purification of the o-dianisidine peroxidase from Escherichia coli. J Biol Chem 254: 4245-4252.

References

 145 

Clark, S.R., Oresnik, I.J., and Hynes, M.F. (2001) RpoN of Rhizobium leguminosarum bv. viciae strain VF39SM plays a central role in FnrN-dependent microaerobic regulation of genes involved in nitrogen fixation. Mol Gen Genet 264: 623-633.

Clay, M.D., Jenney, F.E., Jr., Noh, H.J., Hagedoorn, P.L., Adams, M.W., and Johnson, M.K. (2002) Resonance Raman characterization of the mononuclear iron active-site vibrations and putative electron transport pathways in Pyrococcus furiosus superoxide reductase. Biochemistry 41: 9833-9841.

Clennan, E.L., Hightower, S.E., and Greer, A. (2005) Conformationally induced electrostatic stabilization of persulfoxides: a new suggestion for inhibition of physical quenching of singlet oxygen by remote functional groups. J Am Chem Soc 127: 11819-11826.

Constantinidou, C., Hobman, J.L., Griffiths, L., Patel, M.D., Penn, C.W., Cole, J.A., and Overton, T.W. (2006) A reassessment of the FNR regulon and transcriptomic analysis of the effects of nitrate, nitrite, NarXL, and NarQP as Escherichia coli K12 adapts from aerobic to anaerobic growth. J Biol Chem 281: 4802-4815.

Conter, A., Gangneux, C., Suzanne, M., and Gutierrez, C. (2001) Survival of Escherichia coli during long-term starvation: effects of aeration, NaCl, and the rpoS and osmC gene products. Res Microbiol 152: 17-26.

Cornelis, P., Wei, Q., Andrews, S.C., and Vinckx, T. (2011) Iron homeostasis and management of oxidative stress response in bacteria. Metallomics 3: 540-549.

Crack, J.C., Jervis, A.J., Gaskell, A.A., White, G.F., Green, J., Thomson, A.J., and Le Brun, N.E. (2008) Signal perception by FNR: the role of the iron-sulfur cluster. Biochem Soc Trans 36: 1144-1148.

Crooks, G.E., Hon, G., Chandonia, J.M., and Brenner, S.E. (2004) WebLogo: a sequence logo generator. Genome Res 14: 1188-1190.

Cunningham, L., Gruer, M.J., and Guest, J.R. (1997) Transcriptional regulation of the aconitase genes (acnA and acnB) of Escherichia coli. Microbiology 143: 3795-3805.

D'Autréaux, B., and Toledano, M.B. (2007) ROS as signalling molecules: mechanisms that generate specificity in ROS homeostasis. Nat Rev Mol Cell Biol 8: 813-824.

D'Haeze, W., De Rycke, R., Mathis, R., Goormachtig, S., Pagnotta, S., Verplancke, C. et al. (2003) Reactive oxygen species and ethylene play a positive role in lateral root base nodulation of a semiaquatic legume. Proc Natl Acad Sci U S A 100: 11789-11794.

Dainese, E., Rodrigue, S., Delogu, G., Provvedi, R., Laflamme, L., Brzezinski, R. et al. (2006) Posttranslational regulation of Mycobacterium tuberculosis extracytoplasmic-function sigma factor L and roles in virulence and in global regulation of gene expression. Infect Immun 74: 2457-2461.

Daugherty, A., Suvarnapunya, A.E., and Runyen-Janecky, L. (2012) The role of oxyR and soxRS in oxidative stress survival in Shigella flexneri. Microbiol Res 167: 238-245.

Davies, M.J. (2003) Singlet oxygen-mediated damage to proteins and its consequences. Biochem Biophys Res Commun 305: 761-770.

Davies, M.J., and Puppo, A. (1992) Direct detection of a globin-derived radical in leghaemoglobin treated with peroxides. Biochem J 281: 197-201.

De Rosso, V.V., Moran Vieyra, F.E., Mercadante, A.Z., and Borsarelli, C.D. (2008) Singlet oxygen quenching by anthocyanin's flavylium cations. Free Radic Res 42: 885-891.

Delany, I., Grifantini, R., Bartolini, E., Rappuoli, R., and Scarlato, V. (2006) Effect of Neisseria meningitidis Fur mutations on global control of gene transcription. J Bacteriol 188: 2483-2492.

Dolla, A., Fournier, M., and Dermoun, Z. (2006) Oxygen defense in sulfate-reducing bacteria. J Biotechnol 126: 87-100.

References

 146 

Dombrecht, B., Heusdens, C., Beullens, S., Verreth, C., Mulkers, E., Proost, P. et al. (2005) Defence of Rhizobium etli bacteroids against oxidative stress involves a complexly regulated atypical 2-Cys peroxiredoxin. Mol Microbiol 55: 1207-1221.

Donati, A.J., Jeon, J.M., Sangurdekar, D., So, J.S., and Chang, W.S. (2011) Genome-wide transcriptional and physiological responses of Bradyrhizobium japonicum to paraquat-mediated oxidative stress. Appl Environ Microbiol 77: 3633-3643.

Dubbs, J.M., and Mongkolsuk, S. (2012) Peroxide-sensing transcriptional regulators in bacteria. J Bacteriol 194: 5495-5503.

Dufour, Y.S., Landick, R., and Donohue, T.J. (2008) Organization and evolution of the biological response to singlet oxygen stress. J Mol Biol 383: 713-730.

Eiamphungporn, W., Charoenlap, N., Vattanaviboon, P., and Mongkolsuk, S. (2006) Agrobacterium tumefaciens soxR is involved in superoxide stress protection and also directly regulates superoxide-inducible expression of itself and a target gene. J Bacteriol 188: 8669-8673.

El Yahyaoui, F., Küster, H., Ben Amor, B., Hohnjec, N., Pühler, A., Becker, A. et al. (2004) Expression profiling in Medicago truncatula identifies more than 750 genes differentially expressed during nodulation, including many potential regulators of the symbiotic program. Plant Physiol 136: 3159-3176.

Ellermeier, C.D., and Losick, R. (2006) Evidence for a novel protease governing regulated intramembrane proteolysis and resistance to antimicrobial peptides in Bacillus subtilis. Genes Dev 20: 1911-1922.

Engelmann, S., and Hecker, M. (1996) Impaired oxidative stress resistance of Bacillus subtilis sigB mutants and the role of katA and katE. FEMS Microbiol Lett 145: 63-69.

Escuredo, P.R., Minchin, F.R., Gogorcena, Y., Iturbe-Ormaetxe, I., Klucas, R.V., and Becana, M. (1996) Involvement of activated oxygen in nitrate-induced senescence of pea root nodules. Plant Physiol 110: 1187-1195.

Evans, P.J., Gallesi, D., Mathieu, C., Hernandez, M.J., de Felipe, M., Halliwell, B., and Puppo, A. (1999) Oxidative stress occurs during soybean nodule senescence. Planta 208: 73-79.

Ezraty, B., Aussel, L., and Barras, F. (2005) Methionine sulfoxide reductases in prokaryotes. Biochim Biophys Acta 1703: 221-229.

Ezraty, B., Grimaud, R., El Hassouni, M., Moinier, D., and Barras, F. (2004) Methionine sulfoxide reductases protect Ffh from oxidative damages in Escherichia coli. EMBO J 23: 1868-1877.

Fahrenholtz, S.R., Doleiden, F.H., Trozzolo, A.M., and Lamola, A.A. (1974) On the quenching of singlet oxygen by -tocopherol. Photochem Photobiol 20: 505-509.

Fang, F.C., Vazquez-Torres, A., and Xu, Y. (1997) The transcriptional regulator SoxS is required for resistance of Salmonella typhimurium to paraquat but not for virulence in mice. Infect Immun 65: 5371-5375.

Fernandes, A.P., Fladvad, M., Berndt, C., Andrésen, C., Lillig, C.H., Neubauer, P. et al. (2005) A novel monothiol glutaredoxin (Grx4) from Escherichia coli can serve as a substrate for thioredoxin reductase. J Biol Chem 280: 24544-24552.

Ferreira, A., O'Byrne, C.P., and Boor, K.J. (2001) Role of B in heat, ethanol, acid, and oxidative stress resistance and during carbon starvation in Listeria monocytogenes. Appl Environ Microbiol 67: 4454-4457.

Fischer, H.M., Babst, M., Kaspar, T., Acuña, G., Arigoni, F., and Hennecke, H. (1993) One member of a groESL-like chaperonin multigene family in Bradyrhizobium japonicum is co-regulated with symbiotic nitrogen fixation genes. EMBO J 12: 2901-2912.

References

 147 

Flechard, M., Fontenelle, C., Trautwetter, A., Ermel, G., and Blanco, C. (2009) Sinorhizobium meliloti rpoE2 is necessary for H2O2 stress resistance during the stationary growth phase. FEMS Microbiol Lett 290: 25-31.

Fleischhacker, A.S., Stubna, A., Hsueh, K.L., Guo, Y., Teter, S.J., Rose, J.C. et al. (2012) Characterization of the [2Fe-2S] cluster of Escherichia coli transcription factor IscR. Biochemistry 51: 4453-4462.

Flint, D.H., Tuminello, J.F., and Emptage, M.H. (1993) The inactivation of Fe-S cluster containing hydro-lyases by superoxide. J Biol Chem 268: 22369-22376.

Fontenelle, C., Blanco, C., Arrieta, M., Dufour, V., and Trautwetter, A. (2011) Resistance to organic hydroperoxides requires ohr and ohrR genes in Sinorhizobium meliloti. BMC Microbiol 11: 100.

Fontes, M., Galbis-Martínez, L., and Murillo, F.J. (2003) A novel regulatory gene for light-induced carotenoid synthesis in the bacterium Myxococcus xanthus. Mol Microbiol 47: 561-571.

Francez-Charlot, A., Frunzke, J., Reichen, C., Ebneter, J.Z., Gourion, B., and Vorholt, J.A. (2009) Sigma factor mimicry involved in regulation of general stress response. Proc Natl Acad Sci U S A 106: 3467-3472.

Friedman, Y.E., and O'Brian, M.R. (2004) The ferric uptake regulator (Fur) protein from Bradyrhizobium japonicum is an iron-responsive transcriptional repressor in vitro. J Biol Chem 279: 32100-32105.

Fuangthong, M., and Helmann, J.D. (2002) The OhrR repressor senses organic hydroperoxides by reversible formation of a cysteine-sulfenic acid derivative. Proc Natl Acad Sci U S A 99: 6690-6695.

Fuangthong, M., Atichartpongkul, S., Mongkolsuk, S., and Helmann, J.D. (2001) OhrR is a repressor of ohrA, a key organic hydroperoxide resistance determinant in Bacillus subtilis. J Bacteriol 183: 4134-4141.

Gage, D.J. (2004) Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes. Microbiol Mol Biol Rev 68: 280-300.

Galbis-Martínez, L., Galbis-Martínez, M., Murillo, F.J., and Fontes, M. (2008) An anti-antisigma factor in the response of the bacterium Myxococcus xanthus to blue light. Microbiology 154: 895-904.

Galbis-Martínez, M., Padmanabhan, S., Murillo, F.J., and Elías-Arnanz, M. (2012) CarF mediates signaling by singlet oxygen, generated via photoexcited protoporphyrin IX, in Myxococcus xanthus light-induced carotenogenesis. J Bacteriol 194: 1427-1436.

Georgellis, D., Kwon, O., and Lin, E.C. (2001) Quinones as the redox signal for the Arc two-component system of bacteria. Science 292: 2314-2316.

Ghosh, T., Bose, D., and Zhang, X. (2010) Mechanisms for activating bacterial RNA polymerase. FEMS Microbiol Rev 34: 611-627.

Giel, J.L., Rodionov, D., Liu, M., Blattner, F.R., and Kiley, P.J. (2006) IscR-dependent gene expression links iron-sulphur cluster assembly to the control of O2-regulated genes in Escherichia coli. Mol Microbiol 60: 1058-1075.

Glaeser, J., and Klug, G. (2005) Photo-oxidative stress in Rhodobacter sphaeroides: protective role of carotenoids and expression of selected genes. Microbiology 151: 1927-1938.

Glaeser, J., Nuss, A.M., Berghoff, B.A., and Klug, G. (2011) Singlet oxygen stress in microorganisms. Adv Microb Physiol 58: 141-173.

Gogorcena, Y., Gordon, A.J., Escuredo, P.R., Minchin, F.R., Witty, J.F., Moran, J.F., and Becana, M. (1997) N2 fixation, carbon metabolism, and oxidative damage in nodules of dark-stressed common bean plants. Plant Physiol 113: 1193-1201.

References

 148 

Gorham, H.C., McGowan, S.J., Robson, P.R., and Hodgson, D.A. (1996) Light-induced carotenogenesis in Myxococcus xanthus: light-dependent membrane sequestration of ECF sigma factor CarQ by anti-sigma factor CarR. Mol Microbiol 19: 171-186.

Gort, A.S., Ferber, D.M., and Imlay, J.A. (1999) The regulation and role of the periplasmic copper, zinc superoxide dismutase of Escherichia coli. Mol Microbiol 32: 179-191.

Göttfert, M., Hitz, S., and Hennecke, H. (1990) Identification of nodS and nodU, two inducible genes inserted between the Bradyrhizobium japonicum nodYABC and nodIJ genes. Mol Plant Microbe Interact 3: 308-316.

Gould, P., Maguire, M., and Lund, P.A. (2007) Distinct mechanisms regulate expression of the two major groEL homologues in Rhizobium leguminosarum. Arch Microbiol 187: 1-14.

Gourion, B., Francez-Charlot, A., and Vorholt, J.A. (2008) PhyR is involved in the general stress response of Methylobacterium extorquens AM1. J Bacteriol 190: 1027-1035.

Gourion, B., Sulser, S., Frunzke, J., Francez-Charlot, A., Stiefel, P., Pessi, G. et al. (2009) The PhyR-EcfG signalling cascade is involved in stress response and symbiotic efficiency in Bradyrhizobium japonicum. Mol Microbiol 73: 291-305.

Govezensky, D., Greener, T., Segal, G., and Zamir, A. (1991) Involvement of GroEL in nif gene regulation and nitrogenase assembly. J Bacteriol 173: 6339-6346.

Grainger, D.C., Aiba, H., Hurd, D., Browning, D.F., and Busby, S.J. (2007) Transcription factor distribution in Escherichia coli: studies with FNR protein. Nucleic Acids Res 35: 269-278.

Gralnick, J., and Downs, D. (2001) Protection from superoxide damage associated with an increased level of the YggX protein in Salmonella enterica. Proc Natl Acad Sci U S A 98: 8030-8035.

Greenwell, R., Nam, T.W., and Donohue, T.J. (2011) Features of Rhodobacter sphaeroides ChrR required for stimuli to promote the dissociation of E/ChrR complexes. J Mol Biol 407: 477-491.

Grossman, A.D., Erickson, J.W., Gross, C.A. (1984) The htpR gene product of E. coli is a sigma factor for heat-shock promoters. Cell 38:383-390.

Grote, A., Klein, J., Retter, I., Haddad, I., Behling, S., Bunk, B. et al. (2009) PRODORIC (release 2009): a database and tool platform for the analysis of gene regulation in prokaryotes. Nucleic Acids Res 37: D61-65.

Gruber, T.M., and Gross, C.A. (2003) Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol 57: 441-466.

Grunden, A.M., Jenney, F.E., Jr., Ma, K., Ji, M., Weinberg, M.V., and Adams, M.W. (2005) In vitro reconstitution of an NADPH-dependent superoxide reduction pathway from Pyrococcus furiosus. Appl Environ Microbiol 71: 1522-1530.

Gruszka, J., Pawlak, A., and Kruk, J. (2008) Tocochromanols, plastoquinol, and other biological prenyllipids as singlet oxygen quenchersdetermination of singlet oxygen quenching rate constants and oxidation products. Free Radic Biol Med 45: 920-928.

Gunesekere, I.C., Kahler, C.M., Ryan, C.S., Snyder, L.A., Saunders, N.J., Rood, J.I., and Davies, J.K. (2006) Ecf, an alternative sigma factor from Neisseria gonorrhoeae, controls expression of msrAB, which encodes methionine sulfoxide reductase. J Bacteriol 188: 3463-3469.

Gunther, C., Schlereth, A., Udvardi, M., and Ott, T. (2007) Metabolism of reactive oxygen species is attenuated in leghemoglobin-deficient nodules of Lotus japonicus. Mol Plant Microbe Interact 20: 1596-1603.

Hahn, J.S., Oh, S.Y., and Roe, J.H. (2002) Role of OxyR as a peroxide-sensing positive regulator in Streptomyces coelicolor A3(2). J Bacteriol 184: 5214-5222.

References

 149 

Hahn, J.S., Oh, S.Y., Chater, K.F., Cho, Y.H., and Roe, J.H. (2000) H2O2-sensitive Fur-like repressor CatR regulating the major catalase gene in Streptomyces coelicolor. J Biol Chem 275: 38254-38260.

Hahn, M., Meyer, L., Studer, D., Regensburger, B., and Hennecke, H. (1984) Insertion and deletion mutations within the nif region of Rhizobium japonicum Plant Mol Biol 3: 159-168.

Hahn, M.Y., Raman, S., Anaya, M., and Husson, R.N. (2005) The Mycobacterium tuberculosis extracytoplasmic-function sigma factor SigL regulates polyketide synthases and secreted or membrane proteins and is required for virulence. J Bacteriol 187: 7062-7071.

Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41: 95-98.

Halliwell, B., and Gutteridge, J. (1999) Free radicals in biology and medicine: Clarendon Press (Oxford and New York)

Haugen, S.P., Ross, W., Manrique, M., and Gourse, R.L. (2008) Fine structure of the promoter- region 1.2 interaction. Proc Natl Acad Sci U S A 105: 3292-3297.

Hauser, F., Lindemann, A., Vuilleumier, S., Patrignani, A., Schlapbach, R., Fischer, H.M., and Hennecke, H. (2006) Design and validation of a partial-genome microarray for transcriptional profiling of the Bradyrhizobium japonicum symbiotic gene region. Mol Genet Genomics 275: 55-67.

Hauser, F., Pessi, G., Friberg, M., Weber, C., Rusca, N., Lindemann, A. et al. (2007) Dissection of the Bradyrhizobium japonicum NifA+54 regulon, and identification of a ferredoxin gene (fdxN) for symbiotic nitrogen fixation. Mol Genet Genomics 278: 255-271.

Hecker, M., Pané-Farré, J., and Volker, U. (2007) SigB-dependent general stress response in Bacillus subtilis and related gram-positive bacteria. Annu Rev Microbiol 61: 215-236.

Hecker, M., Reder, A., Fuchs, S., Pagels, M., and Engelmann, S. (2009) Physiological proteomics and stress/starvation responses in Bacillus subtilis and Staphylococcus aureus. Res Microbiol 160: 245-258.

Heinrich, J., and Wiegert, T. (2006) YpdC determines site-1 degradation in regulated intramembrane proteolysis of the RsiW anti-sigma factor of Bacillus subtilis. Mol Microbiol 62: 566-579.

Heinrich, J., Hein, K., and Wiegert, T. (2009) Two proteolytic modules are involved in regulated intramembrane proteolysis of Bacillus subtilis RsiW. Mol Microbiol 74: 1412-1426.

Helmann, J.D. (2002) The extracytoplasmic function (ECF) sigma factors. Adv Microb Physiol 46: 47-110.

Hendrischk, A.K., Braatsch, S., Glaeser, J., and Klug, G. (2007) The phrA gene of Rhodobacter sphaeroides encodes a photolyase and is regulated by singlet oxygen and peroxide in a E-dependent manner. Microbiology 153: 1842-1851.

Hérouart, D., Sigaud, S., Moreau, S., Frendo, P., Touati, D., and Puppo, A. (1996) Cloning and characterization of the katA gene of Rhizobium meliloti encoding a hydrogen peroxide-inducible catalase. J Bacteriol 178: 6802-6809.

Herrou, J., Rotskoff, G., Luo, Y., Roux, B., and Crosson, S. (2012) Structural basis of a protein partner switch that regulates the general stress response of -proteobacteria. Proc Natl Acad Sci U S A 109: 1415-1423.

Herzberg, M., Kaye, I.K., Peti, W., and Wood, T.K. (2006) YdgG (TqsA) controls biofilm formation in Escherichia coli K-12 through autoinducer 2 transport. J Bacteriol 188: 587-598.

References

 150 

Hidalgo, E., and Demple, B. (1994) An iron-sulfur center essential for transcriptional activation by the redox-sensing SoxR protein. EMBO J 13: 138-146.

Hidalgo, E., Bollinger, J.M., Jr., Bradley, T.M., Walsh, C.T., and Demple, B. (1995) Binuclear [2Fe-2S] clusters in the Escherichia coli SoxR protein and role of the metal centers in transcription. J Biol Chem 270: 20908-20914.

Ho, T.D., and Ellermeier, C.D. (2011) PrsW is required for colonization, resistance to antimicrobial peptides, and expression of extracytoplasmic function factors in Clostridium difficile. Infect Immun 79: 3229-3238.

Hong, H.J., Paget, M.S., and Buttner, M.J. (2002) A signal transduction system in Streptomyces coelicolor that activates the expression of a putative cell wall glycan operon in response to vancomycin and other cell wall-specific antibiotics. Mol Microbiol 44: 1199-1211.

Hong, M., Fuangthong, M., Helmann, J.D., and Brennan, R.G. (2005) Structure of an OhrR-ohrA operator complex reveals the DNA binding mechanism of the MarR family. Mol Cell 20: 131-141.

Hoopman, T.C., Liu, W., Joslin, S.N., Pybus, C., Brautigam, C.A., and Hansen, E.J. (2011) Identification of gene products involved in the oxidative stress response of Moraxella catarrhalis. Infect Immun 79: 745-755.

Hopman, C.T., Speijer, D., van der Ende, A., and Pannekoek, Y. (2010) Identification of a novel anti-E factor in Neisseria meningitidis. BMC Microbiol 10: 164.

Hussein, S., Hantke, K., and Braun, V. (1981) Citrate-dependent iron transport system in Escherichia coli K-12. Eur J Biochem 117: 431-437.

Ieva, R., Roncarati, D., Metruccio, M.M., Seib, K.L., Scarlato, V., and Delany, I. (2008) OxyR tightly regulates catalase expression in Neisseria meningitidis through both repression and activation mechanisms. Mol Microbiol 70: 1152-1165.

Imlay, J.A. (2002) What biological purpose is served by superoxide reductase? J Biol Inorg Chem 7: 659-663.

Imlay, J.A. (2003) Pathways of oxidative damage. Annu Rev Microbiol 57: 395-418. Imlay, J.A. (2008) Cellular defenses against superoxide and hydrogen peroxide. Annu Rev

Biochem 77: 755-776. Italiani, V.C., da Silva Neto, J.F., Braz, V.S., and Marques, M.V. (2011) Regulation of

catalase-peroxidase KatG is OxyR dependent and Fur independent in Caulobacter crescentus. J Bacteriol 193: 1734-1744.

Iuchi, S., and Lin, E.C. (1992) Purification and phosphorylation of the Arc regulatory components of Escherichia coli. J Bacteriol 174: 5617-5623.

Iuchi, S., and Weiner, L. (1996) Cellular and molecular physiology of Escherichia coli in the adaptation to aerobic environments. J Biochem 120: 1055-1063.

Jabour, S., and Hamed, M.Y. (2009) Binding of the Zn2+ ion to ferric uptake regulation protein from E. coli and the competition with Fe2+ binding: a molecular modeling study of the effect on DNA binding and conformational changes of Fur. J Comput Aided Mol Des 23: 199-208.

Jamet, A., Sigaud, S., Van de Sype, G., Puppo, A., and Hérouart, D. (2003) Expression of the bacterial catalase genes during Sinorhizobium meliloti-Medicago sativa symbiosis and their crucial role during the infection process. Mol Plant Microbe Interact 16: 217-225.

Jamet, A., Kiss, E., Batut, J., Puppo, A., and Herouart, D. (2005) The katA catalase gene is regulated by OxyR in both free-living and symbiotic Sinorhizobium meliloti. J Bacteriol 187: 376-381.

Jenney, F.E., Jr., Verhagen, M.F., Cui, X., and Adams, M.W. (1999) Anaerobic microbes: oxygen detoxification without superoxide dismutase. Science 286: 306-309.

References

 151 

Jeon, J.M., Lee, H.I., Donati, A.J., So, J.S., Emerich, D.W., and Chang, W.S. (2011) Whole-genome expression profiling of Bradyrhizobium japonicum in response to hydrogen peroxide. Mol Plant Microbe Interact 24: 1472-1481.

Jones, K.M., Kobayashi, H., Davies, B.W., Taga, M.E., and Walker, G.C. (2007) How rhizobial symbionts invade plants: the Sinorhizobium-Medicago model. Nat Rev Microbiol 5: 619-633.

Jung, Y.G., Cho, Y.B., Kim, M.S., Yoo, J.S., Hong, S.H., and Roe, J.H. (2011) Determinants of redox sensitivity in RsrA, a zinc-containing anti-sigma factor for regulating thiol oxidative stress response. Nucleic Acids Res 39: 7586-7597.

Justino, M.C., Almeida, C.C., Teixeira, M., and Saraiva, L.M. (2007) Escherichia coli di-iron YtfE protein is necessary for the repair of stress-damaged iron-sulfur clusters. J Biol Chem 282: 10352-10359.

Kaczmarczyk, A., Campagne, S., Danza, F., Metzger, L.C., Vorholt, J.A., and Francez-Charlot, A. (2011) Role of Sphingomonas sp. strain Fr1 PhyR-NepR-EcfG cascade in general stress response and identification of a negative regulator of PhyR. J Bacteriol 193: 6629-6638.

Kadokura, H., and Beckwith, J. (2010) Mechanisms of oxidative protein folding in the bacterial cell envelope. Antioxid Redox Signal 13: 1231-1246.

Kallifidas, D., Thomas, D., Doughty, P., and Paget, M.S. (2010) The R regulon of Streptomyces coelicolor A32 reveals a key role in protein quality control during disulphide stress. Microbiology 156: 1661-1672.

Kaneko, T., Nakamura, Y., Sato, S., Minamisawa, K., Uchiumi, T., Sasamoto, S. et al. (2002) Complete genomic sequence of nitrogen-fixing symbiotic bacterium Bradyrhizobium japonicum USDA110. DNA Res 9: 189-197.

Kang, Y., Weber, K.D., Qiu, Y., Kiley, P.J., and Blattner, F.R. (2005) Genome-wide expression analysis indicates that FNR of Escherichia coli K-12 regulates a large number of genes of unknown function. J Bacteriol 187: 1135-1160.

Karimova, G., Ullmann, A., and Ladant, D. (2000) A bacterial two-hybrid system that exploits a cAMP signaling cascade in Escherichia coli. Methods Enzymol 328: 59-73.

Karimova, G., Pidoux, J., Ullmann, A., and Ladant, D. (1998) A bacterial two-hybrid system based on a reconstituted signal transduction pathway. Proc Natl Acad Sci U S A 95: 5752-5756.

Karniol, B., and Vierstra, R.D. (2004) The HWE histidine kinases, a new family of bacterial two-component sensor kinases with potentially diverse roles in environmental signaling. J Bacteriol 186: 445-453.

Kauffmann, B., Favier, F., Olry, A., Boschi-Muller, S., Carpentier, P., Branlant, G., and Aubry, A. (2002) Crystallization and preliminary X-ray diffraction studies of the peptide methionine sulfoxide reductase B domain of Neisseria meningitidis PILB. Acta Crystallogr D Biol Crystallogr 58: 1467-1469.

Kaufusi, P.H., Forsberg, L.S., Tittabutr, P., and Borthakur, D. (2004) Regulation of exopolysaccharide synthesis in Rhizobium sp. strain TAL1145 involves an alternative sigma factor gene, rpoH2. Microbiology 150: 3473-3482.

Kawasaki, S., Watamura, Y., Ono, M., Watanabe, T., Takeda, K., and Niimura, Y. (2005) Adaptive responses to oxygen stress in obligatory anaerobes Clostridium acetobutylicum and Clostridium aminovalericum. Appl Environ Microbiol 71: 8442-8450.

Kim, M.S., Hahn, M.Y., Cho, Y., Cho, S.N., and Roe, J.H. (2009a) Positive and negative feedback regulatory loops of thiol-oxidative stress response mediated by an unstable isoform of R in actinomycetes. Mol Microbiol 73: 815-825.

References

 152 

Kim, M.S., Dufour, Y.S., Yoo, J.S., Cho, Y.B., Park, J.H., Nam, G.B. et al. (2012) Conservation of thiol-oxidative stress responses regulated by SigR orthologues in actinomycetes. Mol Microbiol 85: 326-344.

Kim, S.H., Lee, B.Y., Lau, G.W., and Cho, Y.H. (2009b) IscR modulates catalase A (KatA) activity, peroxide resistance and full virulence of Pseudomonas aeruginosa PA14. J Microbiol Biotechnol 19: 1520-1526.

Kim, Y., Wang, X., Zhang, X.S., Grigoriu, S., Page, R., Peti, W., and Wood, T.K. (2010) Escherichia coli toxin/antitoxin pair MqsR/MqsA regulate toxin CspD. Environ Microbiol 12: 1105-1121.

Kirilovsky, D., and Kerfeld, C.A. (2012) The orange carotenoid protein in photoprotection of photosystem II in cyanobacteria. Biochim Biophys Acta 1817: 158-166.

Kobayashi, K., and Tagawa, S. (2004) Activation of SoxR-dependent transcription in Pseudomonas aeruginosa. J Biochem 136: 607-615.

Kobayashi, K., Ehrlich, S.D., Albertini, A., Amati, G., Andersen, K.K., Arnaud, M. et al. (2003) Essential Bacillus subtilis genes. Proc Natl Acad Sci U S A 100: 4678-4683.

Korshunov, S.S., and Imlay, J.A. (2002) A potential role for periplasmic superoxide dismutase in blocking the penetration of external superoxide into the cytosol of Gram-negative bacteria. Mol Microbiol 43: 95-106.

Koua, D., Cerutti, L., Falquet, L., Sigrist, C.J., Theiler, G., Hulo, N., and Dunand, C. (2009) PeroxiBase: a database with new tools for peroxidase family classification. Nucleic Acids Res 37: D261-266.

Kouchi, H., Shimomura, K., Hata, S., Hirota, A., Wu, G.J., Kumagai, H. et al. (2004) Large-scale analysis of gene expression profiles during early stages of root nodule formation in a model legume, Lotus japonicus. DNA Res 11: 263-274.

Krieger-Liszkay, A., Fufezan, C., and Trebst, A. (2008) Singlet oxygen production in photosystem II and related protection mechanism. Photosynth Res 98: 551-564.

Krupp, R., Chan, C., and Missiakas, D. (2001) DsbD-catalyzed transport of electrons across the membrane of Escherichia coli. J Biol Chem 276: 3696-3701.

Kryukov, G.V., Kumar, R.A., Koc, A., Sun, Z., and Gladyshev, V.N. (2002) Selenoprotein R is a zinc-containing stereo-specific methionine sulfoxide reductase. Proc Natl Acad Sci U S A 99: 4245-4250.

Kullik, I., Giachino, P., and Fuchs, T. (1998) Deletion of the alternative sigma factor B in Staphylococcus aureus reveals its function as a global regulator of virulence genes. J Bacteriol 180: 4814-4820.

Kullik, I., Fritsche, S., Knobel, H., Sanjuan, J., Hennecke, H., and Fischer, H.M. (1991) Bradyrhizobium japonicum has two differentially regulated, functional homologs of the 54 gene (rpoN). J Bacteriol 173: 1125-1138.

Kunst, F., Ogasawara, N., Moszer, I., Albertini, A.M., Alloni, G., Azevedo, V. et al. (1997) The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390: 249-256.

Kurtz, D.M., Jr. (2006) Avoiding high-valent iron intermediates: superoxide reductase and rubrerythrin. J Inorg Biochem 100: 679-693.

Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685.

Lan, L., Murray, T.S., Kazmierczak, B.I., and He, C. (2010) Pseudomonas aeruginosa OspR is an oxidative stress sensing regulator that affects pigment production, antibiotic resistance and dissemination during infection. Mol Microbiol 75: 76-91.

Latch, D.E., and McNeill, K. (2006) Microheterogeneity of singlet oxygen distributions in irradiated humic acid solutions. Science 311: 1743-1747.

References

 153 

Lazazzera, B.A., Bates, D.M., and Kiley, P.J. (1993) The activity of the Escherichia coli transcription factor FNR is regulated by a change in oligomeric state. Genes Dev 7: 1993-2005.

Lee, C., Lee, S.M., Mukhopadhyay, P., Kim, S.J., Lee, S.C., Ahn, W.S. et al. (2004) Redox regulation of OxyR requires specific disulfide bond formation involving a rapid kinetic reaction path. Nat Struct Mol Biol 11: 1179-1185.

Lee, J.W., and Helmann, J.D. (2006a) The PerR transcription factor senses H2O2 by metal-catalysed histidine oxidation. Nature 440: 363-367.

Lee, J.W., and Helmann, J.D. (2006b) Biochemical characterization of the structural Zn2+ site in the Bacillus subtilis peroxide sensor PerR. J Biol Chem 281: 23567-23578.

Lewin, A., Cervantes, E., Chee-Hoong, W., and Broughton, W.J. (1990) nodSU, two new nod genes of the broad host range Rhizobium strain NGR234 encode host-specific nodulation of the tropical tree Leucaena leucocephala. Mol Plant Microbe Interact 3: 317-326.

Li, W., Bottrill, A.R., Bibb, M.J., Buttner, M.J., Paget, M.S., and Kleanthous, C. (2003) The role of zinc in the disulphide stress-regulated anti-sigma factor RsrA from Streptomyces coelicolor. J Mol Biol 333: 461-472.

Li, W., Stevenson, C.E., Burton, N., Jakimowicz, P., Paget, M.S., Buttner, M.J. et al. (2002) Identification and structure of the anti-sigma factor-binding domain of the disulphide-stress regulated sigma factor R from Streptomyces coelicolor. J Mol Biol 323: 225-236.

Li, Z., and Demple, B. (1994) SoxS, an activator of superoxide stress genes in Escherichia coli. Purification and interaction with DNA. J Biol Chem 269: 18371-18377.

Li, Z., Keasling, J.D., and Niyogi, K.K. (2012) Overlapping photoprotective function of vitamin E and carotenoids in Chlamydomonas. Plant Physiol 158: 313-323.

Lindemann, A., Moser, A., Pessi, G., Hauser, F., Friberg, M., Hennecke, H., and Fischer, H.M. (2007) New target genes controlled by the Bradyrhizobium japonicum two-component regulatory system RegSR. J Bacteriol 189: 8928-8943.

Lindemann, A., Koch, M., Pessi, G., Müller, A.J., Balsiger, S., Hennecke, H., and Fischer, H.M. (2010) Host-specific symbiotic requirement of BdeAB, a RegR-controlled RND-type efflux system in Bradyrhizobium japonicum. FEMS Microbiol Lett 312: 184-191.

Liochev, S.I., and Fridovich, I. (1992) Fumarase C, the stable fumarase of Escherichia coli, is controlled by the soxRS regulon. Proc Natl Acad Sci U S A 89: 5892-5896.

Liu, X., Brutlag, D.L., and Liu, J.S. (2001) BioProspector: discovering conserved DNA motifs in upstream regulatory regions of co-expressed genes. Pac Symp Biocomput: 127-138.

Loferer, H., Bott, M., and Hennecke, H. (1993) Bradyrhizobium japonicum TlpA, a novel membrane-anchored thioredoxin-like protein involved in the biogenesis of cytochrome aa3 and development of symbiosis. EMBO J 12: 3373-3383.

Lohar, D.P., Haridas, S., Gantt, J.S., and VandenBosch, K.A. (2007) A transient decrease in reactive oxygen species in roots leads to root hair deformation in the legume-rhizobia symbiosis. New Phytol 173: 39-49.

Lombard, M., Touati, D., Fontecave, M., and Nivière, V. (2000) Superoxide reductase as a unique defense system against superoxide stress in the microaerophile Treponema pallidum. J Biol Chem 275: 27021-27026.

Loui, C., Chang, A.C., and Lu, S. (2009) Role of the ArcAB two-component system in the resistance of Escherichia coli to reactive oxygen stress. BMC Microbiol 9: 183.

Lourenço, R.F., and Gomes, S.L. (2009) The transcriptional response to cadmium, organic hydroperoxide, singlet oxygen and UV-A mediated by the E-ChrR system in Caulobacter crescentus. Mol Microbiol 72: 1159-1170.

References

 154 

Lourenço, R.F., Kohler, C., and Gomes, S.L. (2011) A two-component system, an anti-sigma factor and two paralogous ECF sigma factors are involved in the control of general stress response in Caulobacter crescentus. Mol Microbiol 80: 1598-1612.

Lowther, W.T., Weissbach, H., Etienne, F., Brot, N., and Matthews, B.W. (2002) The mirrored methionine sulfoxide reductases of Neisseria gonorrhoeae pilB. Nat Struct Biol 9: 348-352.

Lu, S., Killoran, P.B., Fang, F.C., and Riley, L.W. (2002) The global regulator ArcA controls resistance to reactive nitrogen and oxygen intermediates in Salmonella enterica serovar Enteritidis. Infect Immun 70: 451-461.

Luka, S., Patriarca, E.J., Riccio, A., Iaccarino, M., and Defez, R. (1996) Cloning of the rpoD analog from Rhizobium etli: sigA of R. etli is growth phase regulated. J Bacteriol 178: 7138-7143.

Lund, P.A. (2001) Microbial molecular chaperones. Adv Microb Physiol 44: 93-140. Luo, L., Qi, M.S., Yao, S.Y., Cheng, H.P., Zhu, J.B., and Yu, G.Q. (2005) Role of oxyR from

Sinorhizobium meliloti in regulating the expression of catalases. Acta Biochim Biophys Sin (Shanghai) 37: 421-428.

Luong, T.T., Dunman, P.M., Murphy, E., Projan, S.J., and Lee, C.Y. (2006) Transcription profiling of the mgrA regulon in Staphylococcus aureus. J Bacteriol 188: 1899-1910.

Lynch, R.E., and Fridovich, I. (1978) Permeation of the erythrocyte stroma by superoxide radical. J Biol Chem 253: 4697-4699.

Manganelli, R., Voskuil, M.I., Schoolnik, G.K., and Smith, I. (2001) The Mycobacterium tuberculosis ECF sigma factor E: role in global gene expression and survival in macrophages. Mol Microbiol 41: 423-437.

Manganelli, R., Voskuil, M.I., Schoolnik, G.K., Dubnau, E., Gomez, M., and Smith, I. (2002) Role of the extracytoplasmic-function factor H in Mycobacterium tuberculosis global gene expression. Mol Microbiol 45: 365-374.

Martínez-Salazar, J.M., Salazar, E., Encarnación, S., Ramírez-Romero, M.A., and Rivera, J. (2009) Role of the extracytoplasmic function sigma factor RpoE4 in oxidative and osmotic stress responses in Rhizobium etli. J Bacteriol 191: 4122-4132.

Mathieu, C., Moreau, S., Frendo, P., Puppo, A., and Davies, M.J. (1998) Direct detection of radicals in intact soybean nodules: presence of nitric oxide-leghemoglobin complexes. Free Radic Biol Med 24: 1242-1249.

Mesa, S., Ucurum, Z., Hennecke, H., and Fischer, H.M. (2005) Transcription activation in vitro by the Bradyrhizobium japonicum regulatory protein FixK2. J Bacteriol 187: 3329-3338.

Mesa, S., Reutimann, L., Fischer, H.M., and Hennecke, H. (2009) Posttranslational control of transcription factor FixK2, a key regulator for the Bradyrhizobium japonicum-soybean symbiosis. Proc Natl Acad Sci U S A 106: 21860-21865.

Mesa, S., Hauser, F., Friberg, M., Malaguti, E., Fischer, H.M., and Hennecke, H. (2008) Comprehensive assessment of the regulons controlled by the FixLJ-FixK2-FixK1 cascade in Bradyrhizobium japonicum. J Bacteriol 190: 6568-6579.

Meyer, Y., Buchanan, B.B., Vignols, F., and Reichheld, J.P. (2009) Thioredoxins and glutaredoxins: unifying elements in redox biology. Annu Rev Genet 43: 335-367.

Michiels, J., Moris, M., Dombrecht, B., Verreth, C., and Vanderleyden, J. (1998a) Differential regulation of Rhizobium etli rpoN2 gene expression during symbiosis and free-living growth. J Bacteriol 180: 3620-3628.

Michiels, J., Van Soom, T., D'Hooghe, I., Dombrecht, B., Benhassine, T., de Wilde, P., and Vanderleyden, J. (1998b) The Rhizobium etli rpoN locus: DNA sequence analysis and

References

 155 

phenotypical characterization of rpoN, ptsN, and ptsA mutants. J Bacteriol 180: 1729-1740.

Miller, A.F. (2012) Superoxide dismutases: ancient enzymes and new insights. FEBS Lett 586: 585-595.

Miller, C.D., Kim, Y.C., and Anderson, A.J. (2001) Competitiveness in root colonization by Pseudomonas putida requires the rpoS gene. Can J Microbiol 47: 41-48.

Miller, J.H. (1972) Experiments in molecular genetics. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y., USA.

Mills, S.A., and Marletta, M.A. (2005) Metal binding characteristics and role of iron oxidation in the ferric uptake regulator from Escherichia coli. Biochemistry 44: 13553-13559.

Mishra, M.N., Kumar, S., Gupta, N., Kaur, S., Gupta, A., and Tripathi, A.K. (2011) An extracytoplasmic function sigma factor cotranscribed with its cognate anti-sigma factor confers tolerance to NaCl, ethanol and methylene blue in Azospirillum brasilense Sp7. Microbiology 157: 988-999.

Mitchell, J.E., Zheng, D., Busby, S.J., and Minchin, S.D. (2003) Identification and analysis of 'extended -10' promoters in Escherichia coli. Nucleic Acids Res 31: 4689-4695.

Mitrophanov, A.Y., and Groisman, E.A. (2008) Signal integration in bacterial two-component regulatory systems. Genes Dev 22: 2601-2611.

Mitsui, H., Sato, T., Sato, Y., Ito, N., and Minamisawa, K. (2004) Sinorhizobium meliloti RpoH1 is required for effective nitrogen-fixing symbiosis with alfalfa. Mol Genet Genomics 271: 416-425.

Mittler, R. (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7: 405-410.

Mittler, R., Vanderauwera, S., Gollery, M., and Van Breusegem, F. (2004) Reactive oxygen gene network of plants. Trends Plant Sci 9: 490-498.

Mongkolsuk, S., and Helmann, J.D. (2002) Regulation of inducible peroxide stress responses. Mol Microbiol 45: 9-15.

Mongkolsuk, S., Panmanee, W., Atichartpongkul, S., Vattanaviboon, P., Whangsuk, W., Fuangthong, M. et al. (2002) The repressor for an organic peroxide-inducible operon is uniquely regulated at multiple levels. Mol Microbiol 44: 793-802.

Mooney, R.A., Darst, S.A., and Landick, R. (2005) Sigma and RNA polymerase: an on-again, off-again relationship? Mol Cell 20: 335-345.

Moreau, S., Davies, M.J., Mathieu, C., Hérouart, D., and Puppo, A. (1996) Leghemoglobin-derived radicals. Evidence for multiple protein-derived radicals and the initiation of peribacteroid membrane damage. J Biol Chem 271: 32557-32562.

Morikawa, K., Ohniwa, R.L., Kim, J., Maruyama, A., Ohta, T., and Takeyasu, K. (2006) Bacterial nucleoid dynamics: oxidative stress response in Staphylococcus aureus. Genes Cells 11: 409-423.

Moskovitz, J. (2005) Roles of methionine suldfoxide reductases in antioxidant defense, protein regulation and survival. Curr Pharm Des 11: 1451-1457.

Moskovitz, J., Rahman, M.A., Strassman, J., Yancey, S.O., Kushner, S.R., Brot, N., and Weissbach, H. (1995) Escherichia coli peptide methionine sulfoxide reductase gene: regulation of expression and role in protecting against oxidative damage. J Bacteriol 177: 502-507.

Moura, I., Tavares, P., Moura, J.J., Ravi, N., Huynh, B.H., Liu, M.Y., and LeGall, J. (1990) Purification and characterization of desulfoferrodoxin. J Biol Chem 265: 21596-21602.

References

 156 

Murakami, K.S., Masuda, S., Campbell, E.A., Muzzin, O., and Darst, S.A. (2002) Structural basis of transcription initiation: an RNA polymerase holoenzyme-DNA complex. Science 296: 1285-1290.

Nakano, S., Küster-Schöck, E., Grossman, A.D., and Zuber, P. (2003) Spx-dependent global transcriptional control is induced by thiol-specific oxidative stress in Bacillus subtilis. Proc Natl Acad Sci U S A 100: 13603-13608.

Nakano, S., Erwin, K.N., Ralle, M., and Zuber, P. (2005) Redox-sensitive transcriptional control by a thiol/disulphide switch in the global regulator, Spx. Mol Microbiol 55: 498-510.

Nanda, A.K., Andrio, E., Marino, D., Pauly, N., and Dunand, C. (2010) Reactive oxygen species during plant-microorganism early interactions. J Integr Plant Biol 52: 195-204.

Nandal, A., Huggins, C.C., Woodhall, M.R., McHugh, J., Rodríguez-Quiñones, F., Quail, M.A. et al. (2010) Induction of the ferritin gene (ftnA) of Escherichia coli by Fe2+-Fur is mediated by reversal of H-NS silencing and is RyhB independent. Mol Microbiol 75: 637-657.

Narberhaus, F., Weiglhofer, W., Fischer, H.M., and Hennecke, H. (1996) The Bradyrhizobium japonicum rpoH1 gene encoding a 32-like protein is part of a unique heat shock gene cluster together with groESL1 and three small heat shock genes. J Bacteriol 178: 5337-5346.

Narberhaus, F., Krummenacher, P., Fischer, H.M., and Hennecke, H. (1997) Three disparately regulated genes for 32-like transcription factors in Bradyrhizobium japonicum. Mol Microbiol 24: 93-104.

Nesbit, A.D., Giel, J.L., Rose, J.C., and Kiley, P.J. (2009) Sequence-specific binding to a subset of IscR-regulated promoters does not require IscR Fe-S cluster ligation. J Mol Biol 387: 28-41.

Newberry, K.J., Fuangthong, M., Panmanee, W., Mongkolsuk, S., and Brennan, R.G. (2007) Structural mechanism of organic hydroperoxide induction of the transcription regulator OhrR. Mol Cell 28: 652-664.

Newman, J.D., Anthony, J.R., and Donohue, T.J. (2001) The importance of zinc-binding to the function of Rhodobacter sphaeroides ChrR as an anti-sigma factor. J Mol Biol 313: 485-499.

Newton, G.L., and Fahey, R.C. (2008) Regulation of mycothiol metabolism by R and the thiol redox sensor anti-sigma factor RsrA. Mol Microbiol 68: 805-809.

Nicholas, K.B., Jr., N.H.B., and Deerfield, D.W.I. (1997) GeneDoc: Analysis and visualization of genetic variation. EMBNET NEWS 4: 14.

Niederhoffer, E.C., Naranjo, C.M., Bradley, K.L., and Fee, J.A. (1990) Control of Escherichia coli superoxide dismutase (sodA and sodB) genes by the ferric uptake regulation (fur) locus. J Bacteriol 172: 1930-1938.

Nivière, V., and Fontecave, M. (2004) Discovery of superoxide reductase: an historical perspective. J Biol Inorg Chem 9: 119-123.

Notredame, C., Higgins, D.G., and Heringa, J. (2000) T-Coffee: A novel method for fast and accurate multiple sequence alignment. J Mol Biol 302: 205-217.

Nuñez Oreza, L.A., Alvarez, A.F., Arias, O., II, Torres Larios, A., and Georgellis, D. (2012) The ArcB leucine zipper domain is required for proper ArcB signaling. PLoS One 7: e38187.

Ogawa, J., and Long, S.R. (1995) The Rhizobium meliloti groELc locus is required for regulation of early nod genes by the transcription activator NodD. Genes Dev 9: 714-729.

References

 157 

Oh, S.Y., Shin, J.H., and Roe, J.H. (2007) Dual role of OhrR as a repressor and an activator in response to organic hydroperoxides in Streptomyces coelicolor. J Bacteriol 189: 6284-6292.

Oke, V., Rushing, B.G., Fisher, E.J., Moghadam-Tabrizi, M., and Long, S.R. (2001) Identification of the heat-shock sigma factor RpoH and a second RpoH-like protein in Sinorhizobium meliloti. Microbiology 147: 2399-2408.

Oldroyd, G.E., and Downie, J.A. (2008) Coordinating nodule morphogenesis with rhizobial infection in legumes. Annu Rev Plant Biol 59: 519-546.

Ono, Y., Mitsui, H., Sato, T., and Minamisawa, K. (2001) Two RpoH homologs responsible for the expression of heat shock protein genes in Sinorhizobium meliloti. Mol Gen Genet 264: 902-912.

Osawa, A., Kasahara, A., Mastuoka, S., Gassel, S., Sandmann, G., and Shindo, K. (2011) Isolation of a novel carotenoid, OH-chlorobactene glucoside hexadecanoate, and related rare carotenoids from Rhodococcus sp. CIP and their antioxidative activities. Biosci Biotechnol Biochem 75: 2142-2147.

Österberg, S., del Peso-Santos, T., and Shingler, V. (2011) Regulation of alternative sigma factor use. Annu Rev Microbiol 65: 37-55.

Paget, M.S., and Helmann, J.D. (2003) The 70 family of sigma factors. Genome Biol 4: 203. Paget, M.S., Kang, J.G., Roe, J.H., and Buttner, M.J. (1998) R, an RNA polymerase sigma

factor that modulates expression of the thioredoxin system in response to oxidative stress in Streptomyces coelicolor A3(2). EMBO J 17: 5776-5782.

Pamp, S.J., Frees, D., Engelmann, S., Hecker, M., and Ingmer, H. (2006) Spx is a global effector impacting stress tolerance and biofilm formation in Staphylococcus aureus. J Bacteriol 188: 4861-4870.

Panek, H.R., and O'Brian, M.R. (2004) KatG is the primary detoxifier of hydrogen peroxide produced by aerobic metabolism in Bradyrhizobium japonicum. J Bacteriol 186: 7874-7880.

Park, K.J., Kang, M.J., Kim, S.H., Lee, H.J., Lim, J.K., Choi, S.H. et al. (2004) Isolation and characterization of rpoS from a pathogenic bacterium, Vibrio vulnificus: role of S in survival of exponential-phase cells under oxidative stress. J Bacteriol 186: 3304-3312.

Park, S.T., Kang, C.M., and Husson, R.N. (2008) Regulation of the SigH stress response regulon by an essential protein kinase in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 105: 13105-13110.

Passardi, F., Theiler, G., Zamocky, M., Cosio, C., Rouhier, N., Teixera, F. et al. (2007) PeroxiBase: the peroxidase database. Phytochemistry 68: 1605-1611.

Pauly, N., Pucciariello, C., Mandon, K., Innocenti, G., Jamet, A., Baudouin, E. et al. (2006) Reactive oxygen and nitrogen species and glutathione: key players in the legume-Rhizobium symbiosis. J Exp Bot 57: 1769-1776.

Pessi, G., Ahrens, C.H., Rehrauer, H., Lindemann, A., Hauser, F., Fischer, H.M., and Hennecke, H. (2007) Genome-wide transcript analysis of Bradyrhizobium japonicum bacteroids in soybean root nodules. Mol Plant Microbe Interact 20: 1353-1363.

Petersen, T.N., Brunak, S., von Heijne, G., and Nielsen, H. (2011) SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods 8: 785-786.

Petersohn, A., Brigulla, M., Haas, S., Hoheisel, J.D., Völker, U., and Hecker, M. (2001) Global analysis of the general stress response of Bacillus subtilis. J Bacteriol 183: 5617-5631.

Pfaffl, M.W. (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: 2002-2007.

References

 158 

Pinto, A.F., Rodrigues, J.V., and Teixeira, M. (2010) Reductive elimination of superoxide: Structure and mechanism of superoxide reductases. Biochim Biophys Acta 1804: 285-297.

Poirot, O., O'Toole, E., and Notredame, C. (2003) Tcoffee@igs: a web server for computing, evaluating and combining multiple sequence alignments. Nucleic Acids Research 31: 3503-3506.

Pomposiello, P.J., Bennik, M.H., and Demple, B. (2001) Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate. J Bacteriol 183: 3890-3902.

Poole, L.B. (2005) Bacterial defenses against oxidants: mechanistic features of cysteine-based peroxidases and their flavoprotein reductases. Arch Biochem Biophys 433: 240-254.

Poole, L.B., Reynolds, C.M., Wood, Z.A., Karplus, P.A., Ellis, H.R., and Li Calzi, M. (2000) AhpF and other NADH:peroxiredoxin oxidoreductases, homologues of low Mr thioredoxin reductase. Eur J Biochem 267: 6126-6133.

Puppo, A., Herrada, G., and Rigaud, J. (1991) Lipid peroxidation in peribacteroid membranes from French-bean nodules. Plant Physiol 96: 826-830.

Raivio, T.L., and Silhavy, T.J. (2001) Periplasmic stress and ECF sigma factors. Annu Rev Microbiol 55: 591-624.

Ramel, F., Birtic, S., Cuiné, S., Triantaphylidès, C., Ravanat, J.L., and Havaux, M. (2012) Chemical quenching of singlet oxygen by carotenoids in plants. Plant Physiol 158: 1267-1278.

Ramu, S.K., Peng, H.M., and Cook, D.R. (2002) Nod factor induction of reactive oxygen species production is correlated with expression of the early nodulin gene rip1 in Medicago truncatula. Mol Plant Microbe Interact 15: 522-528.

Raymond, J. (2009) The role of horizontal gene transfer in photosynthesis, oxygen production, and oxygen tolerance. Methods Mol Biol 532: 323-338.

Rea, R., Hill, C., and Gahan, C.G. (2005) Listeria monocytogenes PerR mutants display a small-colony phenotype, increased sensitivity to hydrogen peroxide, and significantly reduced murine virulence. Appl Environ Microbiol 71: 8314-8322.

Regensburger, B., and Hennecke, H. (1983) RNA polymerase from Rhizobium japonicum. Arch Microbiol 135: 103-109.

Reutimann, L. (2010) Impact of oxidative stress on transcription regulator FixK2 and two ECF factors in Bradyrhizobium japonicum. Dissertation ETH Zürich No. 19199.

Rhee, S.G., Bae, Y.S., Lee, S.R., and Kwon, J. (2000) Hydrogen peroxide: a key messenger that modulates protein phosphorylation through cysteine oxidation. Sci STKE 2000: pe1.

Rincon-Enriquez, G., Crété, P., Barras, F., and Py, B. (2008) Biogenesis of Fe/S proteins and pathogenicity: IscR plays a key role in allowing Erwinia chrysanthemi to adapt to hostile conditions. Mol Microbiol 67: 1257-1273.

Rodrigo, M.J., Moskovitz, J., Salamini, F., and Bartels, D. (2002) Reverse genetic approaches in plants and yeast suggest a role for novel, evolutionarily conserved, selenoprotein-related genes in oxidative stress defense. Mol Genet Genomics 267: 613-621.

Ronson, C.W., Nixon, B.T., Albright, L.M., and Ausubel, F.M. (1987) Rhizobium meliloti ntrA (rpoN) gene is required for diverse metabolic functions. J Bacteriol 169: 2424-2431.

Rubio, M.C., James, E.K., Clemente, M.R., Bucciarelli, B., Fedorova, M., Vance, C.P., and Becana, M. (2004) Localization of superoxide dismutases and hydrogen peroxide in legume root nodules. Mol Plant Microbe Interact 17: 1294-1305.

References

 159 

Rudolph, G., Semini, G., Hauser, F., Lindemann, A., Friberg, M., Hennecke, H., and Fischer, H.M. (2006) The iron control element, acting in positive and negative control of iron-regulated Bradyrhizobium japonicum genes, is a target for the Irr protein. J Bacteriol 188: 2294-2294.

Rushing, B.G., and Long, S.R. (1995) Cloning and characterization of the sigA gene encoding the major sigma subunit of Rhizobium meliloti. J Bacteriol 177: 6952-6957.

Saeki, K. (2011) Rhizobial measures to evade host defense strategies and endogenous threats to persistent symbiotic nitrogen fixation: a focus on two legume-rhizobium model systems. Cell Mol Life Sci 68: 1327-1339.

Sainsbury, S., Ren, J., Nettleship, J.E., Saunders, N.J., Stuart, D.I., and Owens, R.J. (2010) The structure of a reduced form of OxyR from Neisseria meningitidis. BMC Struct Biol 10: 10.

Salmeen, A., Andersen, J.N., Myers, M.P., Meng, T.C., Hinks, J.A., Tonks, N.K., and Barford, D. (2003) Redox regulation of protein tyrosine phosphatase 1B involves a sulphenyl-amide intermediate. Nature 423: 769-773.

Salmon, K., Hung, S.P., Mekjian, K., Baldi, P., Hatfield, G.W., and Gunsalus, R.P. (2003) Global gene expression profiling in Escherichia coli K12. The effects of oxygen availability and FNR. J Biol Chem 278: 29837-29855.

Sambrook, J., and Russell, D.W. (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y., USA.

Santos-Silva, T., Trincão, J., Carvalho, A.L., Bonifácio, C., Auchère, F., Raleiras, P. et al. (2006) The first crystal structure of class III superoxide reductase from Treponema pallidum. J Biol Inorg Chem 11: 548-558.

Santos, R., Bocquet, S., Puppo, A., and Touati, D. (1999) Characterization of an atypical superoxide dismutase from Sinorhizobium meliloti. J Bacteriol 181: 4509-4516.

Santos, R., Hérouart, D., Puppo, A., and Touati, D. (2000) Critical protective role of bacterial superoxide dismutase in Rhizobium-legume symbiosis. Mol Microbiol 38: 750-759.

Santos, R., Hérouart, D., Sigaud, S., Touati, D., and Puppo, A. (2001) Oxidative burst in alfalfa-Sinorhizobium meliloti symbiotic interaction. Mol Plant Microbe Interact 14: 86-89.

Sauviac, L., Philippe, H., Phok, K., and Bruand, C. (2007) An extracytoplasmic function sigma factor acts as a general stress response regulator in Sinorhizobium meliloti. J Bacteriol 189: 4204-4216.

Schäfer, A., Tauch, A., Jäger, W., Kalinowski, J., Thierbach, G., and Pühler, A. (1994) Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145: 69-73.

Scharf, C., Riethdorf, S., Ernst, H., Engelmann, S., Völker, U., and Hecker, M. (1998) Thioredoxin is an essential protein induced by multiple stresses in Bacillus subtilis. J Bacteriol 180: 1869-1877.

Schöbel, S., Zellmeier, S., Schumann, W., and Wiegert, T. (2004) The Bacillus subtilis W anti-sigma factor RsiW is degraded by intramembrane proteolysis through YluC. Mol Microbiol 52: 1091-1105.

Schwartz, C.J., Giel, J.L., Patschkowski, T., Luther, C., Ruzicka, F.J., Beinert, H., and Kiley, P.J. (2001) IscR, an Fe-S cluster-containing transcription factor, represses expression of Escherichia coli genes encoding Fe-S cluster assembly proteins. Proc Natl Acad Sci U S A 98: 14895-14900.

References

 160 

Scott, C., Rawsthorne, H., Upadhyay, M., Shearman, C.A., Gasson, M.J., Guest, J.R., and Green, J. (2000) Zinc uptake, oxidative stress and the FNR-like proteins of Lactococcus lactis. FEMS Microbiol Lett 192: 85-89.

Seaver, L.C., and Imlay, J.A. (2001) Alkyl hydroperoxide reductase is the primary scavenger of endogenous hydrogen peroxide in Escherichia coli. J Bacteriol 183: 7173-7181.

Shine, J., and Dalgarno, L. (1975) Determinant of cistron specificity in bacterial ribosomes. Nature 254: 34-38.

Shultzaberger, R.K., Bucheimer, R.E., Rudd, K.E., and Schneider, T.D. (2001) Anatomy of Escherichia coli ribosome binding sites. J Mol Biol 313: 215-228.

Simon, R., Priefer, U., and Pühler, A. (1983) A broad host range mobilization system for in vivo genetic-engineering - transposon mutagenesis in gram-negative bacteria. Bio/Technology 1: 784-791.

Singh, V.K., and Moskovitz, J. (2003) Multiple methionine sulfoxide reductase genes in Staphylococcus aureus: expression of activity and roles in tolerance of oxidative stress. Microbiology 149: 2739-2747.

Sklar, J.G., Makinoshima, H., Schneider, J.S., and Glickman, M.S. (2010) M. tuberculosis intramembrane protease Rip1 controls transcription through three anti-sigma factor substrates. Mol Microbiol 77: 605-617.

Smits, W.K., Dubois, J.Y., Bron, S., van Dijl, J.M., and Kuipers, O.P. (2005) Tricksy business: transcriptome analysis reveals the involvement of thioredoxin A in redox homeostasis, oxidative stress, sulfur metabolism, and cellular differentiation in Bacillus subtilis. J Bacteriol 187: 3921-3930.

Sneath, P.H.A., and Sokal, R.R. (1973) Numerical Taxonomy. W. H. Freeman. San Francisco, CA, USA.

Soonsanga, S., Lee, J.W., and Helmann, J.D. (2008a) Oxidant-dependent switching between reversible and sacrificial oxidation pathways for Bacillus subtilis OhrR. Mol Microbiol 68: 978-986.

Soonsanga, S., Lee, J.W., and Helmann, J.D. (2008b) Conversion of Bacillus subtilis OhrR from a 1-Cys to a 2-Cys peroxide sensor. J Bacteriol 190: 5738-5745.

Spiro, S., and D'Autreaux, B. (2012) Non-heme iron sensors of reactive oxygen and nitrogen species. Antioxid Redox Signal 17: 1264-1276.

Staroń, A., and Mascher, T. (2010) General stress response in -proteobacteria: PhyR and beyond. Mol Microbiol 78: 271-277.

Staroń, A., Sofia, H.J., Dietrich, S., Ulrich, L.E., Liesegang, H., and Mascher, T. (2009) The third pillar of bacterial signal transduction: classification of the extracytoplasmic function (ECF) sigma factor protein family. Mol Microbiol 74: 557-581.

Stigter, J., Schneider, M., and de Bruijn, F.J. (1993) Azorhizobium caulinodans nitrogen fixation (nif/fix) gene regulation: mutagenesis of the nifA -24/-12 promoter element, characterization of a ntrA (rpoN) gene, and derivation of a model. Mol Plant Microbe Interact 6: 238-252.

Stockwell, S.B., Reutimann, L., and Guerinot, M.L. (2012) A role for Bradyrhizobium japonicum ECF16 sigma factor EcfS in the formation of a functional symbiosis with soybean. Mol Plant Microbe Interact 25: 119-128.

Subsin, B., Thomas, M.S., Katzenmeier, G., Shaw, J.G., Tungpradabkul, S., and Kunakorn, M. (2003) Role of the stationary growth phase sigma factor RpoS of Burkholderia pseudomallei in response to physiological stress conditions. J Bacteriol 185: 7008-7014.

Sutton, V.R., Stubna, A., Patschkowski, T., Munck, E., Beinert, H., and Kiley, P.J. (2004) Superoxide destroys the [2Fe-2S]2+ cluster of FNR from Escherichia coli. Biochemistry 43: 791-798.

References

 161 

Takano, H., Obitsu, S., Beppu, T., and Ueda, K. (2005) Light-induced carotenogenesis in Streptomyces coelicolor A3(2): identification of an extracytoplasmic function sigma factor that directs photodependent transcription of the carotenoid biosynthesis gene cluster. J Bacteriol 187: 1825-1832.

Takano, H., Asker, D., Beppu, T., and Ueda, K. (2006) Genetic control for light-induced carotenoid production in non-phototrophic bacteria. J Ind Microbiol Biotechnol 33: 88-93.

Tamura, K., Dudley, J., Nei, M., and Kumar, S. (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596-1599.

Tao, K., Makino, K., Yonei, S., Nakata, A., and Shinagawa, H. (1991) Purification and characterization of the Escherichia coli OxyR protein, the positive regulator for a hydrogen peroxide-inducible regulon. J Biochem 109: 262-266.

Taylor, B.L., and Zhulin, I.B. (1999) PAS domains: internal sensors of oxygen, redox potential, and light. Microbiol Mol Biol Rev 63: 479-506.

Thakur, K.G., Praveena, T., and Gopal, B. (2010) Structural and biochemical bases for the redox sensitivity of Mycobacterium tuberculosis RslA. J Mol Biol 397: 1199-1208.

Thirunavukkarasu, N., Mishra, M.N., Spaepen, S., Vanderleyden, J., Gross, C.A., and Tripathi, A.K. (2008) An extra-cytoplasmic function sigma factor and anti-sigma factor control carotenoid biosynthesis in Azospirillum brasilense. Microbiology 154: 2096-2105.

Thomas-Chollier, M., Defrance, M., Medina-Rivera, A., Sand, O., Herrmann, C., Thieffry, D., and van Helden, J. (2011) RSAT 2011: regulatory sequence analysis tools. Nucleic Acids Res 39: W86-91.

Tokumoto, U., and Takahashi, Y. (2001) Genetic analysis of the isc operon in Escherichia coli involved in the biogenesis of cellular iron-sulfur proteins. J Biochem 130: 63-71.

Triantaphylidès, C., and Havaux, M. (2009) Singlet oxygen in plants: production, detoxification and signaling. Trends Plant Sci 14: 219-228.

Tseng, H.J., McEwan, A.G., Apicella, M.A., and Jennings, M.P. (2003) OxyR acts as a repressor of catalase expression in Neisseria gonorrhoeae. Infect Immun 71: 550-556.

Vachali, P., Bhosale, P., and Bernstein, P.S. (2012) Microbial carotenoids. Methods Mol Biol 898: 41-59.

van Montfort, R.L., Congreve, M., Tisi, D., Carr, R., and Jhoti, H. (2003) Oxidation state of the active-site cysteine in protein tyrosine phosphatase 1B. Nature 423: 773-777.

van Vliet, A.H., Baillon, M.L., Penn, C.W., and Ketley, J.M. (1999) Campylobacter jejuni contains two Fur homologs: characterization of iron-responsive regulation of peroxide stress defense genes by the PerR repressor. J Bacteriol 181: 6371-6376.

VanBogelen, R.A., Kelley, P.M., and Neidhardt, F.C. (1987) Differential induction of heat shock, SOS, and oxidation stress regulons and accumulation of nucleotides in Escherichia coli. J Bacteriol 169: 26-32.

Vargas Mdel, C., Encarnación, S., Dávalos, A., Reyes-Pérez, A., Mora, Y., García-de los Santos, A. et al. (2003) Only one catalase, katG, is detectable in Rhizobium etli, and is encoded along with the regulator OxyR on a plasmid replicon. Microbiology 149: 1165-1176.

Vattanaviboon, P., Seeanukun, C., Whangsuk, W., Utamapongchai, S., and Mongkolsuk, S. (2005) Important role for methionine sulfoxide reductase in the oxidative stress response of Xanthomonas campestris pv. phaseoli. J Bacteriol 187: 5831-5836.

Vázquez-Torres, A. (2012) Redox active thiol sensors of oxidative and nitrosative stress. Antioxid Redox Signal 17: 1201-1214.

References

 162 

Vellanoweth, R.L., and Rabinowitz, J.C. (1992) The influence of ribosome-binding-site elements on translational efficiency in Bacillus subtilis and Escherichia coli in vivo. Mol Microbiol 6: 1105-1114.

Vijay, K., Brody, M.S., Fredlund, E., and Price, C.W. (2000) A PP2C phosphatase containing a PAS domain is required to convey signals of energy stress to the B transcription factor of Bacillus subtilis. Mol Microbiol 35: 180-188.

Vollack, K.U., Härtig, E., Körner, H., and Zumft, W.G. (1999) Multiple transcription factors of the FNR family in denitrifying Pseudomonas stutzeri: characterization of four fnr-like genes, regulatory responses and cognate metabolic processes. Mol Microbiol 31: 1681-1694.

Wang, X., Kim, Y., Hong, S.H., Ma, Q., Brown, B.L., Pu, M. et al. (2011) Antitoxin MqsA helps mediate the bacterial general stress response. Nat Chem Biol 7: 359-366.

Watanabe, S., Kita, A., Kobayashi, K., and Miki, K. (2008) Crystal structure of the [2Fe-2S] oxidative-stress sensor SoxR bound to DNA. Proc Natl Acad Sci U S A 105: 4121-4126.

White, M.J., He, H., Penoske, R.M., Twining, S.S., and Zahrt, T.C. (2010) PepD participates in the mycobacterial stress response mediated through MprAB and SigE. J Bacteriol 192: 1498-1510.

Winterbourn, C.C. (2008) Reconciling the chemistry and biology of reactive oxygen species. Nat Chem Biol 4: 278-286.

Wong, S.M., Alugupalli, K.R., Ram, S., and Akerley, B.J. (2007) The ArcA regulon and oxidative stress resistance in Haemophilus influenzae. Mol Microbiol 64: 1375-1390.

Wösten, M.M. (1998) Eubacterial sigma-factors. FEMS Microbiol Rev 22: 127-150. Wouters, M.A., Iismaa, S., Fan, S.W., and Haworth, N.L. (2011) Thiol-based redox

signalling: rust never sleeps. Int J Biochem Cell Biol 43: 1079-1085. Wright, A., Hawkins, C.L., and Davies, M.J. (2000) Singlet oxygen-mediated protein

oxidation: evidence for the formation of reactive peroxides. Redox Rep 5: 159-161. Wright, A., Bubb, W.A., Hawkins, C.L., and Davies, M.J. (2002) Singlet oxygen-mediated

protein oxidation: evidence for the formation of reactive side chain peroxides on tyrosine residues. Photochem Photobiol 76: 35-46.

Wu, H.J., Seib, K.L., Srikhanta, Y.N., Kidd, S.P., Edwards, J.L., Maguire, T.L. et al. (2006) PerR controls Mn-dependent resistance to oxidative stress in Neisseria gonorrhoeae. Mol Microbiol 60: 401-416.

Wu, H.J., Seib, K.L., Srikhanta, Y.N., Edwards, J., Kidd, S.P., Maguire, T.L. et al. (2010) Manganese regulation of virulence factors and oxidative stress resistance in Neisseria gonorrhoeae. J Proteomics 73: 899-916.

Wu, J., and Weiss, B. (1991) Two divergently transcribed genes, soxR and soxS, control a superoxide response regulon of Escherichia coli. J Bacteriol 173: 2864-2871.

Yeh, A.P., Hu, Y., Jenney, F.E., Jr., Adams, M.W., and Rees, D.C. (2000) Structures of the superoxide reductase from Pyrococcus furiosus in the oxidized and reduced states. Biochemistry 39: 2499-2508.

Yeoman, K.H., Mitelheiser, S., Sawers, G., and Johnston, A.W. (2003) The ECF factor RpoI of R. leguminosarum initiates transcription of the vbsGSO and vbsADL siderophore biosynthetic genes in vitro. FEMS Microbiol Lett 223: 239-244.

Yeoman, K.H., May, A.G., deLuca, N.G., Stuckey, D.B., and Johnston, A.W. (1999) A putative ECF factor gene, rpol, regulates siderophore production in Rhizobium leguminosarum. Mol Plant Microbe Interact 12: 994-999.

Zellmeier, S., Schumann, W., and Wiegert, T. (2006) Involvement of Clp protease activity in modulating the Bacillus subtilis W stress response. Mol Microbiol 61: 1569-1582.

References

 163 

Zeng, J., Zhang, X., Wang, Y., Ai, C., Liu, Q., and Qiu, G. (2008) Glu43 is an essential residue for coordinating the [Fe2S2] cluster of IscR from Acidithiobacillus ferrooxidans. FEBS Lett 582: 3889-3892.

Zhang, X.H., and Weissbach, H. (2008) Origin and evolution of the protein-repairing enzymes methionine sulphoxide reductases. Biol Rev Camb Philos Soc 83: 249-257.

Zhao, C., Hartke, A., Sorda, M.L., Posteraro, B., Laplace, J.M., Auffray, Y., and Sanguinetti, M. (2010) Role of methionine sulfoxide reductases A and B of Enterococcus faecalis in oxidative stress and virulence. Infect Immun 78: 3889-3897.

Zheng, M., Aslund, F., and Storz, G. (1998) Activation of the OxyR transcription factor by reversible disulfide bond formation. Science 279: 1718-1721.

Zheng, M., Doan, B., Schneider, T.D., and Storz, G. (1999) OxyR and SoxRS regulation of fur. J Bacteriol 181: 4639-4643.

Zheng, M., Wang, X., Templeton, L.J., Smulski, D.R., LaRossa, R.A., and Storz, G. (2001) DNA microarray-mediated transcriptional profiling of the Escherichia coli response to hydrogen peroxide. J Bacteriol 183: 4562-4570.

Zhu, Y., Graham, J.E., Ludwig, M., Xiong, W., Alvey, R.M., Shen, G., and Bryant, D.A. (2010) Roles of xanthophyll carotenoids in protection against photoinhibition and oxidative stress in the cyanobacterium Synechococcus sp. strain PCC 7002. Arch Biochem Biophys 504: 86-99.

Ziegelhoffer, E.C., and Donohue, T.J. (2009) Bacterial responses to photo-oxidative stress. Nat Rev Microbiol 7: 856-863.

Zuber, P. (2004) Spx-RNA polymerase interaction and global transcriptional control during oxidative stress. J Bacteriol 186: 1911-1918.

 

 

  

 

 165 

CURRICULUM VITAE & PUBLICATIONS

Nadezda Masloboeva

Born on October 23rd, 1985 in Novosibirsk, Russian Federation

Citizen of the Russian Federation

2009-2012 Research assistant at the Institute of Microbiology, Swiss Federal Institute of Technology (ETH) Zürich; PhD thesis

2008-2009 Research assistant at the Institute for Chemical and Bioengineering, Swiss Federal Institute of Technology (ETH) Zürich

2007-2008 Research assistant at the Institute of General Genetics, Moscow, Russian Federation

2002-2007 Student of biology, Novosibirsk State University, Novosibirsk, Russian Federation

2000-2002 High-School, Specialized scientific education center of Novosibirsk State University, Novosibirsk, Russian Federation

Masloboeva N., Reutimann L., Stiefel P., Follador R., Leimer N., Hennecke H., Mesa S., Fischer H.-M. Reactive oxygen species-inducible ECF sigma factors of Bradyrhizobium japonicum. PLoS ONE (2012), 7(8): e43421.

Ponomarev A., Tatarinova T., Bubyakina V., Masloboeva N., Alekseev V., Kashentseva T., Morozov I. Assessment of the current state of the inter- and intrapopulational divergence of the Siberian White crane (Grus leucogeranus Pallas) populations based on the phylogenetic network of mitochondrial DNA haplotypes. Sib J Ecol (2007), 4:629-634.

 

  

 

 167 

ACKNOWLEDGEMENTS

 

It is my great pleasure to thank all the people who made this work possible. First, I would like to express my deepest appreciation to Prof. Dr. Hauke Hennecke for giving me the great opportunity to do this project in his research group. His extensive knowledge of the field and constant encouragement are highly acknowledged. I am extremely grateful to my direct supervisor Prof. Dr. Hans-Martin Fischer. Without his guidance, persistent help and patience this dissertation would not have been possible. I would like to thank my committee members, Prof. Dr. Julia Vorholt and Prof. Dr. Justine Collier for their academic interest in this work, scientific expertise and valuable advices. I truly appreciate the scientific suggestions of Dr. Anne Francez-Charlot during this project. I am thankful to Nadja Leimer for her contribution to this work. Special thanks to all the current and former members of the Hennecke group for the great time we spend together in and outside of the lab. Finally, I would like to express my deep appreciation to my family and friends who always provide so much encouragement and support.