RESULTS AND DISCUSSIONS 1. Cloning and AND DISCUSSIONS 1. Cloning and Sequencing ... 1997...

download RESULTS AND DISCUSSIONS 1. Cloning and AND DISCUSSIONS 1. Cloning and Sequencing ... 1997 AF227742Magifera ... AF243474Vitis CAAATAAATGGTAAATTAACATATTGTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAA

of 23

  • date post

    08-Feb-2018
  • Category

    Documents

  • view

    213
  • download

    0

Embed Size (px)

Transcript of RESULTS AND DISCUSSIONS 1. Cloning and AND DISCUSSIONS 1. Cloning and Sequencing ... 1997...

  • RESULTS AND DISCUSSIONS

    1. Cloning and Sequencing The papaya genomic DNA was used as material for amplification with degenerate primers ETR1 amd ETR2. There are various of PCR product but the size that was estimated at 835 bp in ETR1 and 379 bp in ETR2 were selected to cloning into pDrive and transformation into E. coli DH5- . The recombinant DNA was detected with PCR technique by ETR1 and ETR2 primers (Figure 4).

    M 1 2 3 4 5 6

    Figure 2 Ethidium bromide stained 1% agarose gel of PCR product with ETR1 primer following the electrophoresis at 60 volt for 1 hour. Molecular weight marker is shown on the left. Lane 1 papaya DNA amplified with ETR1F1 (forward) R1 (reverse), lane 2 amplified

    with ETR1F1R2, lane 3 amplified with ETR1F1R3, lane 4 amplified with ETR1F2R1, lane 5 amplified with ETR1F2R2, lane 6 amplified with ETR1F2R3.

    1000 bp 750 bp 500 bp 250 bp

    ~ 800 bp

    21

  • M 1 2 3 4 5 6 7 8 9

    Figure 3 Ethidium bromide stained 1% agarose gel of PCR product with ETR2 primer following the electrophoresis at 60 volt for 1 hour. Molecular weight marker is on shown on the

    left. Lane 1 papaya DNA amplified with ETR2F1R1, lane 2 amplified with ETR2F1R2, lane

    3 amplified with ETR2F1R3, lane 4 amplified with ETR2F2R1, lane 5 amplified with ETR2F2R2, lane 6 amplified with ETR2F2R3.

    1000 bp 750 bp 500 bp

    250 bp ~ 400 bp

    22

  • M C 1 2 3 4 5 6 7 8 9 10

    Figure 4 Ethidium bromide stained 1% agarose gel of PCR product of recombinant Plasmid.

    Molecular weight marker is on shown on the left. Lane 1-15 recombinant plasmid

    DNA clone#3 amplified with ETR1 size 835 base pairs, lane 16-17 clone #4

    amplified with ETR2 size 376 base pairs.

    M 11 12 13 14 15 16 17

    835 bp

    835 bp 379 bp

    23

  • 2. Sequence comparison ETR1 sequence (835 bp) from papaya was compared to ethylene receptor genes of other plant including passion fruit (Passiflora edulis, AB015496, 21.8% identity), apple (Malus domestica, AF032448, 21.7% identity), geranium (Pelagonium x hortorum, AF141928, 23.4% identity), mango (Mangifera indica, AF227742, 23.0% identity), grape (Vitis vinifera, AF243474, 22.5% identity), papaya (Carica papaya, AF311942, 20.8% identity), rose (Rosa hybrida, AF380127, 22.0% identity), pear (Pyrus communis, AF38652, 22.45% identity), peach (Prunus persica, AF376830, 24.2% identity) and european beach (Fagus sylvalica, FS4420143, 22.8% identity). The results of sequence distance were shown in Table 5. Sequence distance revealed low similarity between CP-ETR1 and other plants. ETR2 sequence (376 bp) from papaya was compared to ethylene receptor genes of other plants including cucumber (Cucumis sativas, AB026500, 76.3% identity), rose (Rosa hybrida, AF154119, 76.6% identity), snapdragon (Antirrhinum majus, AY159363, 48.7% identity), tomato (Lycopersicon esculentum, AY600438, 70.6% percent identity) and strawberry (Fragaria x ananassa, FRX297513, 77.1% identity). The results of sequence distance were shown in Table 6. Sequence distance revealed high similarity. These results were used to design specific primers to CP-ETR1 and CP-ETR2, according to the conservative regions. In this study, partial sequences of two ethylene receptor gene, CP-ETR1 and CP-ETR2 were compared to other ethylene receptors. The sequence comparison between CP-ETR1 to other plants was shown low similarity while sequence distance between CP-ETR2 with other was shown high similarity. Although, the sequence of CP-ETR1 was divergence to other ethylene receptors but this is the partial sequence of CP-ETR1. The distance between CP-ETR1 and other plant could be change when complete cDNA sequences are used. Nevertheless, the partial sequences were sufficient for designing specific primers of CP-ETR1 and CP-ETR2.

    24

  • CP-ETR 1 Sequence comparison Partial sequence of papaya ETR1 (CP-ETR1) was cloned and sequenced. Percentage of

    identity between plant ETR1 sequences was showed in Table 5. Sequence comparison between CP-ETR1 and other plant ETR1 genes was shown in Figure 8. Figure 5 ClustalW comparison between CP-ETR1 and other plant ETR1 genes. F227742Magifera CCAGCTGATGAATTGTTGATGAAGTATCAATATATTTCGGATTTCTTCATTGCACTTGCT 297 CPETR1F1R3 ------------------------------------------------------------ FSY420193Fagus ------------------------------------------------------------ AF243474Vitis TATTTTTCCATCCCTCTAGAGCTGATCTACTTTGTTAAGAAATCTGCAGTGTTTCCCTAT 332 AF227742Magifera TATTTTTCGATTCCTCTAGAGCTGATCTACTTTGTGAAGAAATCTGCTGTGTTTCCATAT 357 CPETR1F1R3 ------------------------------------------------------------ FSY420193Fagus ------------------------------------------------------------ AF243474Vitis AGATGGGTGCTTGTGCAGTTTGGTGCTTTTATTGTCCTATGTGGAGCAACGCATCTTATT 392 AF227742Magifera AGATGGGTCCTTGTGCAGTTTGGTGCTTTCATAGTTTTGTGTGGGGCAACACATCTTATT 417 CPETR1F1R3 ------------------------------------------------------------ FSY420193Fagus ------------------------------------------------------------ AF243474Vitis AACTTGTGGACTTTTGGAATGCATTCGAGAAATGTTGAAGTAGTTATGACCACTGCAAAG 452 AF227742Magifera AACTTGTGGACTTTTAGTATGCATTCAAGAACTGTGGCAATAGTAATGACCACTGCCAAG 477 CPETR1F1R3 ------------------------------------------------------------ FSY420193Fagus ------------------------------------------------------------

    AF243474Vitis GTTTTGACTGCTGTGGTGTCTTGTGTAACTGCCCTAATGCTGGTTCACATTATTCCTGAT 512 AF227742Magifera GTTTTCACTGCTGCTGTGTCTTGTGCGACGGCCCTTATGCTCGTGCATATAATTCCTGAT 537 CPETR1F1R3 ------------------------------GCATCAAAACCA--TCAGAGCATACC-GTT 27 FSY420193Fagus ------------------------------GCATCAAAACCA--TCAGAGCATACC-GTT 27 ** * * ** * ** ** * * AF243474Vitis CTACTGAGTGTGAAGACTAGAGAACTATTTTTGAAAAACAAAGCTGCTGAGCTTGATCGA 572 AF227742Magifera CTGTTAAGTGTTAAAACAAGAGAACTATTTTTGAAAAACAAGGCTGCAGAACTTGATAGA 597 CPETR1F1R3 TTGTCGAAAGTTCAGGCCAATCATTAATTTGGAAATTGGAGAGATGCAGAAGCGGAACAC 87 FSY420193Fagus TTGTCGAAAGTTCAGGCCAATCATTAATTTGGAAATTGGAGAGATGCAGAAGCGGAACAC 87 * * ** * * * * **** ** * * *** ** ** AF243474Vitis GAAATGGGTCTGA-TTCGTACGCAGGAAGAAACAGGGAGGCATGTTAGAATGCTGACTCA 631 AF227742Magifera GAAATGGGCCTGA-TCCGCACACACGAAGAAACCGGTCGGCATGTTAGGATGTTGACGCA 656 CPETR1F1R3 GAACCGCAACAACCTCCCCAGGCATGTAGTTTCCTGCAAG-AGGCCGTAATCTTGCCACA 146 FSY420193Fagus GAACCGCAACAACCTCCCCAGGCATGTAGTTTCCTGCAAG-AGGCCGTAATCTTGCCACA 146 *** * * * * * ** * ** * * * * * ** ** * ** AF243474Vitis TGAGA--TCAGAAGCACTCTTGATAGGCATACTATACTAAAGACCACGCTTATAGAGTTA 689 AF227742Magifera TGAGA--TCAGAAGCACTTTGGATAGACATACCATACTAAAGACCACTCTTGTCGAATTG 714 CPETR1F1R3 GGACAATTTGGTGATATTTTTACTGCACGACTACTACTGAAGACTTGATTGATCA----- 201 FSY420193Fagus GGACAATTTGGTGATATTTTTACTGCACGACTACTACTGAAGACTTGATTGATCA----- 201 ** * * * * * * * * **** ***** * *

    25

  • AF243474Vitis GGTAGAACTTTGTCTCTGGAAGAGTGTGCATTGTGGA----TGCCAACACGTACTGGCTT 745 AF227742Magifera GGAAGAACTTTGGCACTGGAAGAGTGTGCCTTATGGA----TGCCGACGCAAACTGGTTT 770 CPETR1F1R3 --CAGGATGTTGA-ATAGGTACCGTATACCCAATGGGGTTCTGCTGACGGAGAGTGTAAG 258 FSY420193Fagus --CAGGATGTTGA-ATAGGTACCGTATACCCAATGGGGTTCTGCTGACGGAGAGTGTAAG 258 ** * *** ** * ** * * *** *** ** * ** AF243474Vitis AGAGCTTCAACTTTCCTACACTCTGCGTCAACAGAATCCTGTTGGCTTTACCATACCCAT 805 AF227742Magifera AGAGCTTCAACTCTCATACACACTTCATCAACAGAATCCTGTTGGGTATACTGTGCCCAT 830 CPETR1F1R3 AAAGTTGTAAGTCTAACCCAATACGTGTTGGCA----TCCACAAGGCACACTCTTCCAGT 314 FSY420193Fagus AAAGTTGTAAGTCTAACCCAATACGTGTTGGCA----TCCACAAGGCACACTCTTCCAGT 314 * ** * ** * * ** * ** * * ** * ** * AF243474Vitis -TCAGCATCCTGTTATTAATCAAGTCTTCAGTAGCAATCGTGCAGTTAAGATATCACCAA 864 AF227742Magifera -CCAACTTCCTGTGATCAGTCAAGTATTCACCAGCAATCATGCGGTAAAGATATCACCAA 889 CPETR1F1R3 GCCAATGTTCTAC--CTAGTTCAACTAGAGTGGTCTTTAAAATAGTATGTCTATCAAGAG 372 FSY420193Fagus GCCAATGTTCTAC--CTAGTTCAACTAGAGTGGTCTTTAAAATAGTATGTCTATCAAGAG 372 ** * ** * * * * * ** ***** * AF243474Vitis ATTGCCCAGTGGCAAGATTGCGGCCTCTTGCAGGAAAATACATGCCTGGGGAGGTTGTTG 924 AF227742Magifera ATTGTCCAGTGGCTAGGTTAAGGCCTCTTGCAGGAAAATATATGCCTGGCGAGGTGGTTG 949 CPETR1F1R3 TGCTTCTAATCTCATGAGTCAACATCCTAACATGCCGGCCTGTTTCTTCCTGTGTGCGGA 432 FSY420193Fagus TGCTTCTAATCTCATGAGTCAACATCCTAACATGCCGGCCTGTTTCTTCCTGTGTGCGGA 432 * * * * * * ** ** * * ** ** AF243474Vitis CTGTGCGTGTACCACTTCTACATCTCTC