Regulation of γ fibrinogen chain expression by hnRNP A1 and Allen Research Institute, CA) and Dr....

download Regulation of γ fibrinogen chain expression by hnRNP A1 and Allen Research Institute, CA) and Dr. Amy S. Lee (University of Southern California, CA). Transient Transfection and Luciferase

of 19

  • date post

    27-Apr-2018
  • Category

    Documents

  • view

    214
  • download

    0

Embed Size (px)

Transcript of Regulation of γ fibrinogen chain expression by hnRNP A1 and Allen Research Institute, CA) and Dr....

  • Regulation of fibrinogen chain expression by hnRNP A1 Hui Xia From Lindsley F, Kimball Research Institute of the New York Blood Center, 310 East 67 Street New York, NY 10021 Running Title: Fibrinogen and hnRNP A1 Address correspondence to: Hui Xia, The New York Blood Center, 310East 67 Street New York, NY 10021, Tel. 212 570-3342; Fax. 212 879-0243; Email: hxia@nybloodcenter.org Earlier studies showed that HepG2 cells stably transfected with any one fibrinogen chain cDNA enhance the expression of the other two fibrinogen chains. In this report, a regulatory element TGCTCTC in the fibrinogen promoter region, -322 to -316, is identified which is involved in increased expression of chain in HepG2 cells that are transfected with B fibrinogen cDNA. By electrophoretic mobility shift assay, three DNA-protein complexes were found to form with the regulatory element. The amount of the protein complexes that bind with the regulatory element was much reduced in HepG2 cells transfected with B cDNA. By DNA-affinity chromatography, mass spectrometry and supershift assay, human heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) was identified as a component of the complexes. Overexpression of hnRNP A1 suppressed basal fibrinogen transcription. These results indicate that the basal expression of fibrinogen is regulated by a constitutive transcriptional repressor protein, hnRNP A1, and the decreased binding activity of hnRNP A1 leads to the overexpression of chain in HepG2 cells that over-express B chain. Fibrinogen (340kDa) is a dimer with each half-molecule composed of three different polypeptide chains: A, 67kDa; B, 56kDa; and , 47kDa. Two of the chains, B and are glycoproteins with N-linked sugars (1;2). Each chain is encoded by a distinct gene, and these genes are clustered in a region of approximately 50 kilobases located on chromosome 4q23-q32 (3-6). The three chains

    of fibrinogen are mainly synthesized in liver hepatic parenchymal cells and the nascent chains are then processed, glycosylated, and assembled in the endoplasmic reticulum in a stepwise manner, and eventually secreted into the circulating plasma (7-10). Fibrinogen is an acute-phase protein and its biosynthesis may increase 2-10 folds during the acute phase reaction (11). Interleukin 6 (IL-6) and glucocorticoids are two key factors that are involved in the increased expression and synthesis of fibrinogen in the acute phase response (12-14). A transcription factor, STAT-3, can be activated by IL-6 which acts on the Jak-STAT signaling pathway. The consensus binding sequences for STAT-3 have been identified in the promoter region of all three fibrinogen genes (15:16). Thus at least two phenomena control expression of the fibrinogen genes: liver-specific constitutive regulation and modulation during the acute phase response. At the basal level, there appears to be different levels of gene regulation. For example, there is an excess of A and and smaller amounts of B chains in HepG2 cells, a human hepatocellular carcinoma cell line, partly due to reduced synthesis of B chain, suggesting that B is rate limiting for the assembly and secretion of mature fibrinogen. The different amounts of intracellular fibrinogen chains, however, can also be due to a combination of different rates of expression and intracellular degradation (17-21). In HepG2 cells, over-expression of any one fibrinogen gene, elicited by transfection, leads to the concurrent up-regulation of the other two genes, suggesting coordinate gene expression (22-24). The up-regulation of fibrinogen genes is due to the increased RNA biosynthesis (22). However,

    1

    JBC Papers in Press. Published on January 27, 2005 as Manuscript M414120200

    Copyright 2005 by The American Society for Biochemistry and Molecular Biology, Inc.

    by guest on June 10, 2018http://w

    ww

    .jbc.org/D

    ownloaded from

    http://www.jbc.org/

  • the process that coordinates the basal expression of the three fibrinogen chains is not understood. In this study, a regulatory element involved in this coordinated expression is identified in the gene promoter region and heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is shown to be a component of this regulatory element binding complex. There are over 20 heterogeneous nuclear ribonucleoproteins (hnRNPs), designated A-U, in human cells (25). These proteins contribute to the complex around nascent pre-mRNA and thus are able to modulate RNA processing (26;27). HnRNP A1 is the best-characterized protein from this family. It has a role in pre-mRNA processing, mRNA transport and participates in telomeric length maintenance (28-32). Recently an additional role for hnRNP A1 in RNA biogenesis has been reported since it could be a regulator of gene expression through direct DNA binding or interaction with other proteins (33-37). For examples, hnRNP A1 has been described to suppress human thymidine kinase gene transcriptional activity by binding to its promoter (34). HnRNP A1 can also modulate ApoE promoter activity by interacting with the -219T allelic form (37). The interaction of hnRNP A1 with hormone response elements of vitamin D receptor can cause vitamin D resistance (35;36). In this work, human hnRNP A1 is identified as a constitutive transcriptional repressor protein that regulates fibrinogen chain gene transcription. EXPERIMENTAL PROCEDURES Materials. The rabbit polyclonal antibodies to human hnRNP A/B and hnRNP C1/C2 were purchased from Santa Cruz Biotechnology Inc (Santa Cruz, CA). Also purchased from Santa Cruz Biotechnology Inc. were goat polyclonal antibodies to human hnRNP A3 and hnRNP A0. Polyclonal rabbit antibody to AUF1 (hnRNP D) was obtained from Upstate ( Lake Placid, NY) and a mouse monoclonal antibody to hnRNP A2B1 was from Abcam, Inc (Cambridge, MA). The mouse monoclonal antibody to hnRNP A1 was a generous gift from Dr. G. Dreyfuss (University of Pennsylvania, PA).

    Cell Culture. HepG2 cells were maintained in Eagles minimal essential medium containing 10% fetal calf serum and penicillin/streptomycin. The stable cell lines B-HepG2 cells that were transfected with B cDNA expression vector and overexpress B chains and the control cells, Neo-HepG2, transfected with control vector were maintained in DEME medium with 0.6 mg/ml Geneticin as previously described (22-24). Plasmid Constructs and Mutagenesis. A series of DNA fragments containing different lengths of promoter regions were obtained from genomic DNA of HepG2 cells by PCR and cloned into the polylinker region of a luciferase reporter gene vector pGL3 (Promega). Site-directed mutagenesis in the promoter region in the pGL 3 vector was performed according to the protocol supplied by the manufacturer (Stratagene). The expression vectors for human hnRNP A1 were generous gifts from Dr. John S. Adams ( Burns and Allen Research Institute, CA) and Dr. Amy S. Lee (University of Southern California, CA). Transient Transfection and Luciferase Activity Assay. Aliquots (20103 cells ) of Neo- and B- HepG2 cells were plated in 24-wells plates and cultured as described in the previous section to 80% confluence. After 24 h of culture, cells were transfected with 0.4 g of various luciferase plasmids and site-directed mutant constructs using LipofectAMINE Plus (Invitrogen). To determine transfection efficiency, 0.1 g of RSV -gal plasmid was cotransfected with each test plasmid. After transfection, Neo- and B- HepG2 cells were maintained in DMEM medium with 10% fetal calf serum for 48 h and then lysed using 1report lysis buffer (Promega) and processed for luciferase assay (Promega). For transfections analyzing the effect of hnRNP A1, normal HepG2 cells were cotransfected with reporter plasmids, -gal plasmid, and hnRNP A1 expression plasmid, or the control plasmid. After incubation for 48h with the appropriate medium, the cells

    2

    by guest on June 10, 2018http://w

    ww

    .jbc.org/D

    ownloaded from

    http://www.jbc.org/

  • were harvested, and extracts were assayed for luciferase and -galactosidase activities. Electrophoretic Mobility-Shift (EMSA). Nuclear extracts from normal HepG2 cell, or Neo- and B-HepG2 cells were prepared using NE-PER nuclear and cytoplasmic extraction reagent (Pierce) according to the manufacturers protocol. Protein concentration was quantified by spectrophotometry using the Bio-Rad protein assay. Double-stranded oligonucleotide probes were synthesized as complementary single strands (Invitrogen) and annealed at 92C for 10 min, followed by slow cooling to room temperature. Sequences of the various oligonucleotides used were as follows: fibrinogen wild-type probe I (WTPI), -357 AGACTAGGTTTGCT TAGTTCGAGGTCATAT -328; fibrinogen wild-type probe II (WTPII), -328 TCTGTTTGCTCTCAGCCATG -309; mutant probe 1 (MP1), -328 TCTGTTTGCGATCAGCCATG -309; mutant probe 2 (MP2), -328 TCTGTTTGATATTAGCCATG -309. Probes were prepared by end labeling the double-stranded oligonucleotides with [32P] ATP using T4 polynucleotide kinase, followed by G-50 column purification. The nuclear extracts were preincubated for 10 min at room temperature with 2 g of poly (dI-dC) in the binding buffer (20mM Tris-HCl, pH 8.0, 60mM KCl, 1mM EDTA, 12% glycerol , 1.5mM DTT, and 1 mg/ml BSA). Then labeled probe was added to each reaction for a 20 min incubation at room temperature, and the DNA-protein complexes that formed were analyzed on a 6% polyacrylamide gel. For competition assays, unlabeled probes were used at 30 molar excess to radio-labeled probes. For supershift assays, the nuclear extracts were preincubated overnight with antibody at 4C prior to performing the EMSA procedures. DNA Affinity Chromatog