J. Microbiol. Biotechnol. (2009), 19(12), 1547–1556doi: 10.4014/jmb.0905.05006First published online 24 August 2009

Recombinant Expression and Characterization of Thermoanaerobactertengcongensis Thermostable α-Glucosidase with Regioselectivity for High-Yield Isomaltooligosaccharides Synthesis

Zhou, Cheng1,2

, Yanfen Xue1, Yueling Zhang

3, Yan Zeng

1, and Yanhe Ma

1*

1State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China2The Graduate School, Chinese Academy of Sciences, Beijing 100049, China3Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, China

Received: May 6, 2009 / Revised: June 16, 2009 / Accepted: July 1, 2009

A novel thermostable α-glucosidase (TtGluA) from

Thermoanaerobacter tengcongensis MB4 was successfully

expressed in E. coli and characterized. The TtgluA gene

contained 2,253 bp, which encodes 750 amino acids. The

native TtGluA was a trimer with monomer molecular mass

of 89 kDa shown by SDS-PAGE. The purified recombinant

enzyme showed hydrolytic activity on maltooligosaccharides,

p-nitrophenyl-α-D-glucopyranide, and dextrin with an exo-

type cleavage manner. TtGluA showed preference for short-

chain maltooligosaccharides and the highest specific activity

for maltose of 3.26 units/mg. Maximal activity was observed

at 60ºC and pH 5.5. The half-life was 2 h at 60ºC. The

enzyme showed good tolerance to urea and SDS but was

inhibited by Tris. When maltose with the concentration

over 50 mM was used as substrate, TtGluA was also capable

of catalyzing transglycosylation to produce α-1,4-linked

maltotriose and α-1,6-linked isomaltooligosaccharides. More

importantly, TtGluA showed exclusive regiospecificity with

high yield to produce α-1,6-linked isomaltooligosaccharides

when the reaction time extended to more than 10 h.

Keywords: Thermostable α-glucosidase, Thermoanaerobacter

tengcongensis, maltooligosaccharides hydrolysis,

isomaltooligosaccharides synthesis

The amylolytic enzyme system (amylases, debranching

enzymes, and α-glucosidases) can hydrolyze starch to

produce fermentable sugars that typically are used in food

processing, fermentation, and alcohol production in industry.

These enzymes from thermophilic microorganisms drew

much attention in the past years because of their good

stability and high efficiency in the industrial processes that

mostly take place at high temperature [17, 31]. In this

enzyme system, α-glucosidases (E.C. 3.2.1.20) hydrolyze

terminal glycosidic bonds and release α-glucose from the

nonreducing end of the substrate chain [16]. They are

involved in the last step of starch degradation and are the

second most important enzymes during the early stages of

raw starch hydrolysis [17]. Thermostable α-glucosidases,

isolated from a variety of thermophiles or hyperthermophiles,

are potential candidates for the improvements of industrial

starch processing into glucose syrup.

Thermophilic anaerobic Clostridium bacteria [2] have

been proven to convert a wide range of carbohydrate

substrates, which resulted in application in the processing

and recycling of surplus agricultural crops and industrial

waste [3]. Thermoanaerobacter and Thermoanaerobacterium

are two important genera of this group. Some amylolytic

enzymes of several bacterial strains closely related to

these two genera have been analyzed in detail [1, 11,

19, 28]. However, α-glucosidases have only been isolated

and characterized from two strains of these genera:

Thermoanaerobacter thermohydrosulfuricus DSM 567 [3] and

Thermoanaerobacterium thermosaccharolyticum DSM 571

[8]. However, there is no sequence information available

and the knowledge about them is limited.

Some α-glucosidases also catalyze transglycosylation

reactions [11, 13, 20] that are exploited in biotechnology to

produce food oligosaccharides [5, 7] or to conjugate sugars

with biologically useful materials [27]. Thermostable α-

glucosidases with transglycosylation activity have been

reported in past years [3, 4, 23, 26]. However, the

transglycosylation products of most reported α-glucosidases

are generally the mixtures of oligosaccharides with various

linkages, and the yields are always low [4, 9, 11, 13, 15,

23, 30].

*Corresponding authorPhone: +86-10-64807590; Fax: +86-10-64807616;E-mail: mayanhe@im.ac.cn

1548 Zhou et al.

In this paper, we describe the expression, purification,

and biochemical characterization of a thermostable α-

glucosidase from another Thermoanaerobacter strain,

Thermoanaerobacter tengcongensis MB4, and present

evidence that this enzyme possesses some physical and

hydrolyzing properties different from the other two characterized

Thermoanaerobacter α-glucosidases. More attractively,

this enzyme presents transglycosylation regiospecificity

and high yield for α-1,6-linked isomaltooligosaccharides

synthesi which differs from other characterized α-glucosidases.

MATERIALS AND METHODS

Bacterial Strains, Plasmids, Restriction Enzymes, and Chemicals

The genomic DNA of Thermoanaerobacter tengcongensis MB4

was extracted with a bacteria genomic DNA extraction kit (Tiangen,

China). The expression vector pET-28a was from Novagen (U.S.A.).

E. coli DH5α and BL21 (DE3) strains were from Stratagene (U.S.A.).

The restriction enzymes were from TaKaRa (Japan). The oligosaccharides

were from Sigma (U.S.A.). The isopropyl-β-D-thiogalactopyranoside

(IPTG), kanamycin, imidazole, protein denaturants, and acetonitrile

were from Merck (U.S.A.). All the other chemicals used were of

reagent grade.

Construction of TtgluA Expression System

The α-glucosidase gene TtgluA (GenBank Accessions No. AAM23323)

was amplified from the genomic DNA of Thermoanaerobacter

tengcongensis MB4 by PCR with a primer pair of the forward

(GCTAGCTAGCATGCTTCAAAGAAC, where the underline indicates

the NheI site) and the reverse (CCGGAATTCCTATTTCACTACAATC,

the underline indicates the EcoRI site) and pfu DNA polymerase.

The PCR product was purified with the Gel Extraction Kit

(OMEGA Bio-tek, U.S.A.) and then digested with NheI and EcoRI

to insert the digested pET28a vector. The resultant recombinant

plasmid, pET28a-TtgluA, was transformed into E. coli DH5α for

cloning. DNA sequencing was performed by SinoGenoMax Co.,

Ltd, China. The purified pET28a-TtgluA was then transformed into

E. coli BL21(DE3) for gene expression.

Gene Expression and Protein Purification

E. coli BL21 (DE3) harboring the pET28a-TtgluA plasmid was

cultured in 0.5 l of LB medium containing kanamycin (60 µg/ml) until

the OD600 reached to 0.6. IPTG was added at a final concentration

of 1 mM, and the cells were continuously cultivated for 5 h at 37oC.

Cells were harvested by centrifugation at 6,000 ×g at 4oC for

15 min, washed with binding buffer (20 mM sodium phosphate buffer

containing 500 mM NaCl and 5 mM imidazole, pH 7.9), and then

suspended in 50 ml of the same buffer. The suspended cells were

disrupted by sonication and the supernatant was obtained by centrifugation

at 12,000 ×g for 20 min at 4oC. The supernatant was incubated at

65oC for 30 min to denature the thermolabile proteins and then

centrifuged at 12,000 ×g for 30 min at 4oC. The second supernatant

was loaded onto a His·Bind column (5PKG) (Novogen, Germany). The

column was washed with 10 ml of binding buffer and subsequently with

15 ml of washing buffer (20 mM sodium phosphate buffer containing

500 mM NaCl and 60 mM imidazole, pH 7.9). Finally, the protein was

eluted with 3 ml of elution buffer (20 mM phosphate buffer containing

500 mM NaCl and 1 M imidazole, pH 7.9). The obtained protein

solution was desalted on a desalting column (GE Healthcare, U.S.A.)

with 20 mM sodium phosphate buffer (pH 7.5) and then loaded onto

a Superdex 10/300 column (GE Healthcare, U.S.A.) equilibrated with

20 mM phosphate buffer containing 150 mM NaCl (pH 7.5). Elution was

performed with the equilibration buffer at a flow rate of 0.6 ml/min

and the desired protein fractions were collected. The eluted protein

was desalted again with 20 mM sodium phosphate buffer (pH 7.5).

The protein concentration was defined with the Bio-Rad Protein

Assay Reagent (Bio-Rad, U.S.A.) using bovine serum albumin as a

standard. The purity of the protein was examined by SDS-PAGE.

Molecular Mass Determination and Circular Dichroism Spectra

The apparent molecular mass of the recombinant enzyme was

determined by both gel filtration chromatography and Superdex 10/300

column using cytochrome c (12.4 kDa), carbonic anhydrase (29 kDa),

bovine serum albumin (66 kDa), alcohol dehydrogenase (150 kDa),

and β-amylase (200 kDa) (Sigma, St. Louis, U.S.A.) as molecular

mass standards and DynaPro dynamic light scattering systems (Wyatt

Technology, U.S.A.) with 0.1 mg/ml enzyme in 20 mM phosphate

buffer (pH 7.5) at 25oC. The monomer molecular mass was calculated

from the putative amino acid sequence and estimated by SDS-PAGE.

Circular dichroism (CD) spectra of pure recombinant TtGluA were

measured using the Jasco J-810 spectropolarimeter (Jasco, Japan) over

a wavelength ranging from 190 to 260 nm under constant nitrogen

flush. The bandwidth was set to 1 nm. The secondary structure content

of the enzyme was estimated using the program JASCOW32. All

spectra were recorded at room temperature, and three scans were

averaged and blank-subtracted to give the spectra.

Effects of pH, Temperature, and Chemicals on Enzyme Activity

and Stability

The optimal pH was assayed at 60oC for 10 min in 50 mM citric acid-

sodium phosphate buffer (pH 4.0-8.0) with 0.5 mM p-nitrophenyl-

α-D-glucopyranoside (pNPG; Sigma). The effect of pH on enzyme

stability was analyzed with enzyme being incubated in buffer from

pH 2-11 at 50oC for 30 min. The optimal temperature was assayed

at 30-80oC for 10 min with standard reaction buffer (50 mM citric

acid-sodium phosphate buffer, pH 6.0). Thermal stability was analyzed

by assessing enzyme activity after incubation at various temperatures

for the indicated time. To determine the effects of chemicals, the

enzyme (0.4 mg/ml) was incubated with various metal ions and

EDTA (final concentration of 5 mM), and protein denaturants of

different concentration at 50oC for 30 min. The residual activity was

measured under the standard hydrolytic assay condition.

Standard Hydrolytic Activity Assays

α-Glucosidase hydrolytic activity was determined by measuring the

release of p-nitrophenol from pNPG at 60oC for 10 min with standard

reaction buffer. The reaction was terminated by addition of an equal

volume of 1 M Na2CO3 solution. The absorbance of the liberated

p-nitrophenol was measured at 410 nm. One unit of α-glucosidase

activity was defined as the amount of enzyme liberating 1 µmole of

p-nitrophenol in 1 minute.

The activity on maltooligosaccharide, soluble starch, dextrin, and

other oligosaccharides was determined by measuring the release of

glucose at 60oC for 15 min with 0.5% (w/v) substrates in standard

reaction buffer. Reactions were terminated by incubation for 10 min

in a boiling water bath. Glucose was assayed with the glucose

T. TENGCONGENSIS THERMOSTABLE α-GLUCOSIDASE 1549

oxidase reagent from a glucose assay kit (Sigma Diagnostics No.

510). One unit of activity was defined as the amount of the enzyme

liberating 1 µmole of glucose in 1 minute. All values are expressed

as the averages of three experiments.

Transglycosylation Activity Analysis

The transglycosylation activity was performed with 5 µg of purified

enzyme and different concentrations of maltose ranging from 20 mM

to 300 mM in the standard reaction buffer at 45oC. After different

time intervals, the reaction mixture was terminated in a boiling

water bath for 10 min. After centrifugation (10,000 ×g, 10 min), 1-µl

samples were spotted on Silica Gel 60 plates (Merck, Germany) and

thin-layer chromatography (TLC) analysis was performed as described

previously by Kanda et al. [12]. Transglycosylation products analyses

were carried out by HPLC using a 4.6 mm ID×150 mm Zorbax

carbohydrate analysis column (Agilent Technology, U.S.A.), with

acetonitrile/water (75/25, v/v) as the mobile phase at 2 ml/min, and

a refractive index detector. The column was kept constant at 30oC.

Integration was carried out using the Agilent ChemStation software.

RESULTS AND DISCUSSION

Sequence Analysis of TtGluA

The α-glucosidase gene TtgluA cloned from T. tengcongensis

MB4 contains 2,253 bp, which encodes 750 amino acids

with a predicted molecular mass of 88.6 kDa. The deduced

protein sequences showed the highest homology to

microbial annotated α-glucosidases from several other

Fig. 1. Multiple alignment of the amino acid sequences of α-glucosidases from Thermoanaerobacter tengcongensis MB4 (GenBankNo. AAM23323), Thermoanaerobacter sp. X514 (GenBank No. ABY91330), Thermoanaerobacter pseudethanolicus ATCC 33223(GenBank No. ABY93679), Thermoanaerobacter ethanolicus (GenBank No. ABR26230), Bacillus thermoamyloliquefaciens (GenBank No.BAA76396), and Dictyoglomus thermophilum (GenBank No. ACI19412). Identical residues are shaded black. The characteristic consensus motif of family II α-glucosidase is highlighted by a dotted black line.

1550 Zhou et al.

Thermoanaerobacter strains: Thermoanaerobacter sp. X514,

T. pseudethanolicus, and T. ethanolicus with 79%, 79%,

and 78% identities, respectively. However, the functions of

these three proteins are yet to be investigated. Fig. 1 shows

a multiple sequence alignment of the deduced amino

acid sequences of TtGluA and several other microbial α-

glucosidases of which sequence identities were more than

43%. The characteristic consensus motifs of α-glucosidase

([GFY]-[LIVMF]-W-x-D-M-[NSA]-E-[VP] and G-[AV]-D-

[TIV]-[CG]-G-F) were found to exist in this protein ([G]-[I]-

W-N-D-M-[N]-E-[P] from G373 to P381, and G-[A]-D-[V]-

[G]-G-F from G482 to F488). This indicated that TtGluA

belongs to family II α-glucosidase [16] and glycoside

hydrolase family 31 (http://www.cazy.org/fam/GH31.html).

Purification and Properties of the Recombinant TtGluA

The TtgluA gene was successfully expressed in E. coli

BL21(DE3) and purified to homogeneity by a three-step

process including heating treatment, and His-tag affinity

column and gel-filtration chromatographies. The purification

results using pNPG substrate are summarized in Table 1.

The final preparation showed an approximate 44.8-fold

increase in purity with a recovery of 12.8% relative to the

amount of the crude enzyme. The specific activity of the

purified enzyme was 362.2 mU/mg protein using pNPG as

substrate. As expected for protein from a thermophilic

bacterium, TtGluA did not have much activity loss (less

than 20%) after heating at 65oC for 30 min, under which

65% of E. coli total protein was denatured. As shown in

Fig. 2, the recombinant TtGluA was finally purified to

homogeneity with a molecular mass of approximately

89 kDa, in accordance with the calculated mass of 88.6 kDa

deduced from the amino acid sequence. This was smaller

than the α-glucosidase from T. thermohydrosulfuricus

(160 kDa) [3] but larger than the enzyme from T.

thermosaccharolyticum (60 kDa) [8]. On the other side,

primary gel-filtration chromatography showed that the

molecular mass of the native TtGluA was beyond the

detection range of 200 kDa, which indicated that the native

TtGluA was an oligomer. In order to measure the accurate

molecular mass of the native TtGluA, we performed

dynamic light scattering analysis. A peak with a hydrodynamic

radius of 6.7 nm was observed (Fig. 3), corresponding to a

molecular mass of about 285 kDa. This clearly suggested

that the dominant form of native TtGluA is a trimer in

Table 1. Purification of recombinant α-glucosidase (TtGluA) from Thermoanaerobacter tengcongensis MB4.

PreparationTotal protein

(mg)Total activity

(mU)Yield(%)

Specific activity(mU/mg)

Purificationfold

Supernatant of crude extract after sonication 378.2 3,060.2 100 8.1 1.0

Supernatant after heating treatment 137.8 2,400.3 78.4 17.4 2.1

Affinity (His-tag column) 2.42 507.6 16.6 209.7 25.9

Gel-filtration (Superdex10/300) 1.08 391.2 12.8 362.2 44.7

Fig. 2. SDS-PAGE analysis of the recombinant TtGluA atdifferent stages of purification. Lane 1, supernatant of crude extract from BL21(DE3) with pET28a; lane 2,

Supernatant of crude extract from BL21(DE3) with pET28a-TtgluA; lane 3,

Supernatant after heating treatment from BL21(DE3) with pET28a-TtgluA;

lane 4, Affinity (His-tag column) chromatography of heating supernatant;

lane 5, Gel-filtration (Superdex10/300) chromatography-purified enzyme;

lane M, molecular mass marker.

Fig. 3. The regularization graph of the native recombinantTtGluA in the dynamic light scattering experiment. The Rayleigh Spheres model was used. The x-axis indicates the

hydrodynamic radius.

T. TENGCONGENSIS THERMOSTABLE α-GLUCOSIDASE 1551

solution. The secondary structural information was obtained

by the “far-UV” CD spectra (Fig. 4). Based on the program

JASCOW32 in the Jasco J-810 spectropolarimeter (Jasco,

Japan), TtGluA contained 50.0% α-helix, 12.2% β-sheet,

14.5% β-turn, and 23.3% random coil. Like all spectroscopic

techniques, the CD signal reflects an average of the entire

molecular population. Thus, although CD can determine

that a protein contains about 50% α-helix, it cannot

determine which specific residues are involved in the α-

helical portion. Hence, from this CD spectra data, we

cannot know the details about the α-helix of TtGluA.

Physical Properties of the Recombinant TtGluA

The effects of pH and temperature on the catalytic activity

of TtGluA were determined using pNPG as substrate, and

the results are shown in Fig. 5. TtGluA exhibited the

maximum activity at pH 5.5 and 60oC (Fig. 5A and 5B).

Around 50% activity was retained at pH 4.5-7, whereas

rapid activity decline happened at higher or lower pH

values. The data also showed that TtGluA was stable over

a wide range of pH 3-9 at 50oC (Fig. 5C). In this pH

range, more than 80% of its original activity was retained

after 30-min incubation. TtGluA was also stable for more

than 10 h up to 40oC and had the half-life of 5 h, 2 h, and

50 min at 50oC, 60oC, and 65oC, respectively (Fig. 5D).

Fig. 4. Far-UV CD spectra of TtGluA in 20 mM sodium phosphatebuffer (pH 7.5). Each spectrum is the mean of three independent acquisitions.

Fig. 5. The effects of pH and temperature on TtGluA activity and stability. A. pH optimum. B. Temperature optimum. C. pH stability. D. Thermal stability (■ : 40

oC; ○: 50

oC; ▲ : 60

oC; ▽: 65

oC). All the residual hydrolytic

activities were measured at 60oC in 50 mM citric acid-Na2HPO4 buffer (pH 6.0) with pNPG as substrate. Values are expressed as the averages of three

experiments.

1552 Zhou et al.

However, the enzyme activity decreased rapidly when the

preincubation temperature reached to 75oC. Only about

17% activity was retained after 20-min incubation. The α-

glucosidase from T. thermohydrosulfuricus DSM 567

showed maximal activity at pH 5 and 75oC and was stable

at least for 7 h at this temperature [3]. These indicated that

TtGluA was a moderate thermostable enzyme, which was

similar to the α-glucosidase from T. thermosaccharolyticum

with optimal activity at 65oC and pH 5.5 [8] but more

thermolabile than the enzyme from T. thermohydrosulfuricus.

The effects of various metal ions and chemicals on the

activity of TtGluA was studied at 50oC in 50 mM citric

acid-sodium phosphate buffer, pH 6.0. Only Ag+, Hg2+,

and Pb2+ evidently inhibited the activity of TtGluA,

whereas EDTA and other metal ions did not. As we know,

these heavy metals have strong affinities for sulfhydral (-

SH) groups [21]. The amino acid sequence analysis of

TtGluA shows that there are four cysteines (Cys109,

Cys261, Cys346, and Cys492). So this means that there are

some -SH groups close to the catalytic region of TtGluA.

The activity loss is because these heavy metal ions bind to

the -SH groups and act as an irreversible inhibitor. No

evident inhibition or activation of other metal ions suggests

that none of them is a cofactor of TtGluA. TtGluA showed

good tolerance to SDS and urea, with about 50% and

76.5% activities retained after treatment with 6 M urea and

1% SDS at 50oC for 30 min, respectively (Fig. 6A and 6B),

but was sensitive to guanidine hydrochloride, with only

18.6% activity retained by incubation in 1 M guanidine

hydrochloride (Fig. 6C). It was observed that TtGluA

showed much less activity in Tris-HCl buffer than in other

buffers with the same pH. Further studies on the effects of

Tris concentration (the pH of all the buffers with different

concentration of Tris was 6.0) on the activity of TtGluA

showed that about 80% activity was lost when the Tris

concentration was increased from 5 mM to 100 mM (Fig. 6D).

Since Tris is a well-known saccharide analog, the activity

loss was most possibly due to the competitive inhibition.

Similar results were also reported for the α-glucosidases

from Aspergillus niger and Bacillus thermoamyloliquefaciens

[14, 26].

Substrate Specificity of TtGluA

The hydrolytic activity of TtGluA towards various substrates

was studied at 60oC. Like the α-glucosidase from T.

thermohydrosulfuricus, TtGluA was capable of cleaving

Fig. 6. The effects of protein denaturants and Tris on TtGluA stability and activity. A, B, and C show the effects of SDS, urea, and guanidine hydrochloride, respectively, on the stability of TtGluA. The purified enzyme of 0.4 mg/ml

was

incubated with protein denaturants of different concentrations for 30 min at 50oC. D shows the effect of Tris on TtGluA activity. The activity was assayed in

Tris-HCl buffer (pH 6.0) with different concentrations of Tris. Values are expressed as the averages of three experiments.

T. TENGCONGENSIS THERMOSTABLE α-GLUCOSIDASE 1553

maltose, maltooligosaccharides, and aryl-substrate pNPG, with

the highest specific activity for maltose of 3.26 units/mg

(Table 2). This was different from the α-glucosidase from

T. thermosaccharolyticum, which had no activity on maltose

[8]. TLC analysis of the hydrolytic products from

maltopentaose and maltohexaose showed that TtGluA

released glucose from maltooligosaccharides one by one

from the nonreducing end (data not shown). This indicated

that TtGluA cleaved substrate maltooligosaccharides by an

exo-type manner. The kinetic parameters of TtGluA for

various substrates were calculated. As shown in Table 2,

the substrate preferences of TtGluA were maltotriose>

maltopentaose>maltose>maltotetraose>pNPG (kcat/Km values

of 47.43, 47.01, 40.17, 19.95, and 18.45 s−1·mM−1, respectively).

Under optimal conditions, the activity of pNPG cleavage

was approximately 11% of maltose hydrolysis, suggesting

that TtGluA belongs to the type II α-glucosidase [6]. The

less hydrolytic activity on pNPG than maltose or other

maltooligosaccharides indicated that TtGluA has no

preference on glycosyl moieties in disaccharide substrates

for hydrolysis. However, the Km of pNPG was 1.08 mM,

which was lower than other substrates. This indicated that

TtGluA bound pNPG more easily than other maltosaccharides.

No activity was detected towards polymeric substrates

starch and pullulan. Only low activity was detected towards

dextrin. This is possibly due to the inaccessibility of

TtGluA to the linkages in the crystal structures of these

polysaccharides. These were different from the other two

characterized Thermoanaerobacter α-glucosidases. The α-

glucosidase from Thermoanaerobacter thermohydrosulfuricus

can hydrolyze not only maltooligosaccharides and pNPG

but also polysaccharides such as starch and pullulan [3].

However, the α-glucosidase of Thermoanaerobacterium

thermosaccharolyticum can hydrolyze pNPG and isomaltose

but has no activity on maltose, and the highest activity

is shown towards pNPG [8]. These differences indicate

probably different catalytic mechanisms of TtGluA and the

two Thermoanaerobacter α-glucosidases. This enzyme

also showed no activity on sucrose, trehalose, raffinose,

melizitose, isomaltooligsaccharides, and p-nitrophenyl-β-

D-glucopyranoside. Thus, it was concluded that TtGluA

was a typical α-1,4-glucosidic maltooligosaccharides-

hydrolyzing enzyme, more like a maltase, which preferred

similar to the enzyme from Sulfolobus solfataricus [25].

This property, in combination with the thermostability,

makes T. tengcongensis α-glucosidase potentially useful in

the amylose saccharification process in industry.

Transglycosylation Activity

To assess whether TtGluA could perform transglycosylation,

TtGluA was incubated with maltose of different concentrations

(20-300 mM) for 5 h. As shown in Fig. 7A, TLC analysis

of the products revealed that a strong transglycosylation

activity was presented when the maltose concentration reached

50 mM, producing more oligosaccharides with higher degree

of polymerization than the substrates, whereas only hydrolytic

product was released with 20 mM maltose. This indicated

that TtGluA possessed transglycosylation activity, which

showed dependence on the substrate concentration. From

Fig. 7A, a concomitant increase of transglycosylation

products and maltose substrate concentration was observed.

Table 2. Kinetic parameters of α-glucosidase from T. tengcongensisMB4 for hydrolysis of various substrates.

SubstrateSpecific activity

(units/mg)

Km

(mM)kcat (s

−1)

kcat/Km

(s−1mM−1)

Maltose 3.26 6.31 253.53 40.17

Maltotriose 2.85 4.58 217.17 47.43

Maltotetraose 1.09 16.55 330.09 19.95

Maltopentaose 2.38 6.72 315.96 47.01

pNPG 0.36 1.08 19.92 18.45

Dextrin 0.73 n.d. n.d. n.d.

n.d.: not determined.

Fig. 7. TLC analysis of transglycosylation products. Left: 5 h incubation with different concentrations of maltose. Lane 1, 20 mM; lane 2, 50 mM; lane 3, 100 mM; lane 4, 150 mM; lane 5, 200 mM; lane 6, 300

mM; lane M, marker. Right: Different reaction times with 200 mM maltose. Lane 1, 0 h; lane 2, 2 h; lane 3, 5 h; lane 4, 10 h; lane 5, 16 h; lane 6, 20 h; lane

M, marker. G1, glucose; G2, maltose; G3, maltotriose; G4, maltotetraose; G5, maltopentaose.

1554 Zhou et al.

To further investigate the constituents of the transglycosylation

products, HPLC was used to detect the products from

200 mM maltose for reaction at different times (2 h, 5 h,

10 h, 16 h, and 20 h). As shown in Fig. 7B, the yield of

transglycosylation products increased when the incubation

time was extended. The HPLC results in Fig. 8 showed

that the transglycosylation products were a mixtures of

maltotriose (α-1,4-linkage), isomaltotriose, and isomaltetraose

(α-1,6-linkage) after 2 h reaction (Fig. 8A). Isomaltose was

present after 5 h of incubation (Fig. 8B). This indicated that

not only maltose but also glucose was used as acceptors for

glycosyl transfer. When the incubation time was extended

to 10 h and 16 h, isomaltose replaced maltotriose and

isomaltooligosaccharides were the main transglycosylation

products (Fig. 8C and 8D). These properties are significantly

different from the α-glucosidase of T. thermohydrosulfuricus,

which only uses maltose as the acceptor and the final

transglycosylation products are only α-1,4-linked

maltooligosaccharides [3]. In addition, the yield of glucose

increased concomitantly with the decrease of the maltose

when the incubation time increased (Fig. 8).

Although previously characterized glycosidases are being

applied for oligosaccharide synthesis, their applications are

often limited by low yields and poor regioselectivity [22,

24]. The low yield was because of the inevitable drawback

of glycosidase reactions, in which the products of

transglycosylation were also the substrates for the enzymes

and undergo hydrolysis [18]. Applications of α-glucosidases

for synthesis of oligosaccharides by transglycosylation

reactions using maltose as the sugar acceptor/donor have

been extensively explored. However, the synthetic products

produced by most reported α-glucosidases were mixtures

of oligosaccharides consisting of α-1,2, α-1,3, α-1,4, or α-

1,6 linkages [9, 11, 13, 15], or only products of α-1,4-

linked maltooligosaccharides [3]. As revealed by HPLC

analysis, TtGluA showed exclusive regiospecificity for

producing α-1,6-linked oligosaccharides with a long

reaction time (more than 10 h). The quantitative HPLC

analysis showed that the ratio of isomaltose, isomaltotriose,

and isomaltetraose of the products was 2.3: 1:2.1 after 16 h

reaction. About 53% of maltose was transformed to

isomaltooligosaccharides, whereas about 36% was hydrolyzed

Fig. 8. HPLC chromatogram of the reaction mixture in the transglycosylation assay.A. After 2 h incubation; B. After 5 h incubation; C. After 10 h incubation; D. After 16 h incubation. For the reaction at 45

oC, 200 mM maltose in 50 mM

citric acid-Na2HPO4 buffer (pH 6.0) was used with 5 µg of purified recombinant TthGluA. G, glucose; G2, maltose; G3, maltotriose; IG2, isomaltose; IG3,

isomaltotriose; IG4, isomaltotetraose. The integral area ratio of each peak in the chromatogram of 16 h reaction products was 4.9 (G): 1.2 (G2): 2.0 (IG2):

1.0 (IG3): 1.4 (IG4), which corresponded to the concentration of 144.9 mM (G), 22.7 mM (G2), 30.1 mM (IG2), 13.0 mM (IG3), and 26.7 mM (IG4),

respectively.

T. TENGCONGENSIS THERMOSTABLE α-GLUCOSIDASE 1555

to glucose after 16 h reaction, with only 11% of maltose

left in the reaction mixture. At the same time, the

transglycosylation products of TtGluA were mainly

isomaltooligosaccharides, which cannot be further degraded

by TtGluA, leading to a high yield. These make TtGluA a

superior enzyme to synthesize isomaltooligosaccharides,

which is a promising dietary constituent and functional

food supplement in industry.

In conclusion, the moderate thermostable α-glucosidase

(TtGluA) from T. tengcongensis MB4 is successfully

expressed in E. coli and purified. The biochemical properties

of TtGluA showed much difference with reported α-

glucosidases. Since T. tengcongensis MB4 is a saccharolytic

bacterium, TtGluA with maltooligosaccharides hydrolytic

activity probably plays an important function in the

saccharometabolism of this obligately anaerobic strain

[29]. The regiospecificity and high yield for α-1,6-linked

oligosaccharides synthesis make TtGluA appear to be an

excellent candidate for application in the industrial production

of isomaltooligosaccharides.

Acknowledgments

This work was supported by NSFC Grant 30621005 and

Ministry of Sciences and Technology of China (863

programs) Grants 2006AA020201 and 2007AA021306.

REFERENCES

1. Antranikian, G., C. Herzberg, and G. Gottschalk. 1987. Production

of thermostable α-amylase, pullulanase, and α-glucosidase in

continuous culture by a new Clostridium isolate. Appl. Environ.

Microbiol. 53: 1668-1673.

2. Antranikian, G. 1990. Physiology and enzymology of thermophilic

bacteria degrading starch. FEMS Microbiol. Rev. 75: 201-218.

3. Bernhard, W., L. Friedrich, R. Johannes, and B. Karin. 1997. A

novel type of thermostable α-glucosidase from Thermoanaerobacter

thermohydrosulfuricus exhibiting maltodextrinohydrolase activity.

Biochem. J. 328: 581-586.

4. Broek, L. A. M., K. Struijs, J. C. Verdoes, G. Beldman, and A.

G. J. Voragen. 2003. Cloning and characterization of two α-

glucosidases from Bifidobacterium adolescentis DSM20080.

Appl. Microbiol. Biotechnol. 61: 55-60.

5. Buchholz, K. and J. Seibel. 2003. Isomaltooligosaccharides, pp.

63-74. In G. Eggleston and G. L. Cote (eds.). Oligosaccharides

in Food and Agriculture. ACS Symposium Series, Vol. 849.

American Chemical Society, Washington, DC.

6. Chiba, S. 1997. molecular mechanism in α-glucosidase and

glucoamylase. Biosci. Biotech. Biochem. 61: 1233-1239.

7. Crittenden, R. G. and M. J. Playne. 1996. Production, properties

and applications of food-grade oligosaccharides. Trends Food

Sci. Technol. 7: 353-361.

8. Ganghofner, D., J. Kellermann, W. L. Staudenbauer, and

K. Bronnenmeier. 1998. Purification and properties of an

amylopullulanase, a glucoamylase and α-glucosidase in the

amylolytic enzyme system of Thermoanaerobacterium

thermosaccharolyticum. Biosci. Biotechnol. Biochem. 62: 302-308.

9. Giuseppina, A., G. Assunta, T. Annabella, M. Ernesto, and T.

Antonio. 2006. Hydrolyses and transglycosylations performed

by purified α-D-glucosidase of the marine mollusk Aplysia

fasciata. J. Biotechnol. 122: 274-284.

10. Hannes, M. 1988. Purification and some properties of the

extracelluar α-amylase-pullulanase produced by Clostridium

thermohydrosulfuricum. Biochem. J. 250: 813-818.

11. Hung, V. S., Y. Hatada, S. Goda, J. Lu, Y. Hidaka, Z. Li, et al.

2005. α-Glucosidase from a strain of deep-sea Geobacillus: A

potential enzyme for the biosynthesis of complex carbohydrates.

Appl. Microbiol. Biotechnol. 68: 757-767.

12. Kanda, T., H. Yatomi, S. Makishima, Y. Amano, and K. Nisizawa.

1989. Substrate specificities of exo- and endo-type cellulases in

the hydrolysis of β-1,3- and α-1,4-mixed D-glucans. J. Biochem.

150: 127-132.

13. Kato, N., S. Suyama, M. Shirokane, M. Kato, T. Kobayashi,

and N. Tsukagoshi. 2002. Novel α-glucosidase from Aspergillus

nidulans with strong transglucosylation activity. Appl. Environ.

Microbiol. 68: 1250-1256.

14. Kimura, A., M. Takata, Y. Fukushi, H. Mori, H. Matsui, and S.

Chiba. 1997. A catalytic amino acid and primary structure of

active site in Aspergillus niger α-glucosidase. Biosci. Biotech.

Biochem. 61: 1091-1098.

15. Kobayashi, I., M. Tokuda, H. Hashimoto, T. Konda, H. Nakano,

and S. Kitahata. 2003. Purification and characterization of a

new type of α-glucosidase from Paecilomyces lilacinus that has

transglucosylation activity to produce α-1,3- and α-1,2-linked

oligosaccharides. Biosci. Biotechnol. Biochem. 67: 29-35.

16. Krasikov, V. V., D. V. Karelov, and L. M. Firsov. 2001. α-

Glucosidase. Biochemistry (Moscow) 66: 267-281.

17. Leveque, E., S. Janecek, B. Haye, and A. Belarbi. 2000.

Thermophilic archaeal amylolytic enzymes. Enz. Microb. Technol.

26: 3-14.

18. Lu, L., M. Xiao, X. Xu, Z. Li, and Y. Li. 2007. A novel beta-

galactosidase capable of glycosyl transfer from Enterobacter

agglomerans B1. Biochem. Biophys. Res. Commun. 356: 78-84.

19. Madi, E., G. Antranikian, K. Ohmiya, and G. Gottschalk. 1987.

Thermostable amylolytic enzymes from a new Clostridium

isolate. Appl. Environ. Microbiol. 53: 1661-1667.

20. Mala, S., H. Dvorakova, R. Hrabal, and B. Kralova. 1999.

Towards regioselective synthesis of oligosaccharides by use of

alpha-glucosidases with different substrate specificity. Carbohydr.

Res. 322: 209-218.

21. Mizrahi, L. and Y. Achituv. 1989. Effect of heavy metals ions

on enzyme activity in the Mediterranean mussel, Donax

trunculus. Bull. Environ. Contam. Toxicol. 42: 854-859.

22. Monsan, P. and F. Paul. 1995. Enzymatic synthesis of

oligosaccharides. FEMS Microbiol. Rev. 16: 187-192.

23. Nakao, M., T. Nakayama, M. Harada, A. Kakudo, H. Ikemoto,

S. Kobayashi, and Y. Shibano. 1994. Purification and

characterization of a Bacillus sp. SAM1606 thermostable α-

glucosidase with transglucosylation activity. Appl. Microbiol.

Biotechnol. 41: 337-343.

24. Plou, F. J., M. T. Martin, S. Gomez, M. Alcalde, and A. Ballesteros.

2002. Glucosyltransferases acting on starch or sucrose for the

synthesis of oligosaccharides. Can. J. Chem. 80: 743-752.

1556 Zhou et al.

25. Rolfsmeier, M. and P. Blum. 1995. Purification and characterization

of a maltase from the extremely thermophilic Crenarchaeote

Sulfolobus solfataricus. J. Bacteriol. 177: 482-485.

26. Suzuki, Y., M. Nobiki, M. Matsuda, and T. Sawa. 1997. Bacillus

thermoamyloliquefaciens KP1071 α-glucosidase I1 is a thermostable

M, 540 000 homohexameric α-glucosidase with both exo-α-1,4-

glucosidase and oligo-1,6-glucosidase activities. Eur. J. Biochem.

245: 129-136.

27. Takenaka, F. and H. Uchiyama. 2000. Synthesis of alpha-D-

glucosylglycerol by alpha-glucosidase and some of its characteristics.

Biosci. Biotechnol. Biochem. 64: 1821-1826.

28. Ulrike, S., M. Frank, and A. Garabed. 1991. Purification and

properties of a thermoactive glucoamylase from Clostridium

thermosaccharolyticum. Appl. Environ. Microbiol. 57: 2317-2323.

29. Xue, Y., Y. Xu, Y. Liu, Y. Ma, and P. Zhou. 2001.

Thermoanaerobacter tengcongensis sp. nov., a novel anaerobic,

saccharolytic, thermophilicbacterium isolated from a hot spring

in Tengcong, China. Int. J. Syst. Evol. Microbiol. 51: 1335-

1341.

30. Yamamoto, T., T. Unno, Y. Watanabe, M. Yamamoto, M.

Okuyama, H. Mori, S. Chiba, and A. Kimura. 2004. Purification

and characterization of Acremonium implicatum α-glucosidase

having regioselectivity for α-1,3-glucosidic linkage. Biochim.

Biophys. Acta 1700: 189-198.

31. Zdzieblo, A. and Synowiecki. 2002. New source of the thermostable

α-glucosidase suitable for single step starch processing. Food

Chem. 79: 485-491.