Proteini uvod - .•asimetrični α ogljikov atom ... masa aminokislin podenot Melitin...

download Proteini uvod - .•asimetrični α ogljikov atom ... masa aminokislin podenot Melitin (peptid-čebela)

of 42

  • date post

    19-Jul-2019
  • Category

    Documents

  • view

    214
  • download

    0

Embed Size (px)

Transcript of Proteini uvod - .•asimetrični α ogljikov atom ... masa aminokislin podenot Melitin...

  • 1

    Doc. Dr. Gregor AnderluhUniverza v LjubljaniOddelek za biologijo, Biotehnika fakultetaKatedra za biokemijo

    http://www.bf.uni-lj.si/bi/biokemija/

    gregor.anderluh@bf.uni-lj.si

    AMINOKISLINE, PEPTIDI, PROTEINI,DELO S PROTEINI

    AMINOKISLINE- ZGRADBALASTNOSTI

    DisociacijaPolarnostReaktivnostSpektroskopske lastnosti

    PEPTIDNA VEZPEPTIDI, PROTEINILASTNOSTI PROTEINOVNIVOJI PROTEINSKE ZGRADBEPRIMARNA ZGRADBADOLOEVANJE PRIMARNE ZGRADBEZAKAJ JE POMEMBNO POZNAVANJE PRIMARNE ZGRADBE

  • 2

    The proteins are among the most complicated and enigmatic substances in Nature and appear to be particularly closely related to all that we call Life.

    Presentation speech, Nobel prize for Chemistry 1958

    The central dogma states that once information has passed into protein it cannot get out again. The transfer of information form nucleic acid to nucleic acid, or from nucleic acid to protein, may be possible, but transfer from protein to protein, or from protein to nucleic acid, is impossible. Information means here the precise determination of sequence, either of basis in the nucleic acid or of amino acid residues in the protein.Francis Crick, 1958

    DNA

    reverznatranskripcija

    RNA

    protein

    TRANSLACIJA

    TRANSKRIPCIJA

    REPLIKACIJA

  • 3

    DNA

    Protein

    AdeninGvaninCitozinTimin

    >gi|37047698|gb|CF601391.1|CF601391 tac36g08.y1 Hydra EST -IV Hydramagnipapillata cDNA 5' similar to TR:Q9Y1U9 Q9Y1U9 EQUINATOXIN IVPRECURSOR. ;, mRNA sequenceAACTAGCAAAGCAGACGCTGGAGGAGGCGCTGGAATAGCAATTTTAGGAGTATTAGCAAAAGTCGGCGTAGAAGCTGCGTTACAGCAAATTGATAATATTTGGAAAGGAGATGTAGTGAGGTATTGGAAATGCGCTGTAGAAAACAGATCCGATAAAACACTTTATGCTTACGGAACAACTACGGAATCGGGAAGTATGGGTACAGTTTTTGCCGATATTCCCCCTGGAAGCACAGGAATTTTTGTGTGGGAAAAATCTAGAGGAGCTGCAACTGGAGCAAGTGGTGTAGTTCATTATCGTTATGGAGACAAGATACTTAATTTAATGGCATCCATTCCATATGATTGGAACTTGTATCAATCTTGGGCTAATGCACGAGTTTCGAATGAAAAGGAAAGCTTTTACAACTTGTATAACGGGTTAAATGGTGCGAAACCTGCTACAAGAGGAGGAAACTGGGGCGACGTTGATGGTGCAAAATTTTTTCTTACTGAAAAAAGTCACGCAGAGTTTAAAGTTATTTTTTCTGGTTAACCAAATGTTGTCAAAAAAATTGTTCTTTTTCTGTAAA

    Osnovni gradniki soAMINOKISLINE

    Osnovni gradniki soNUKLEOTIDI

    >SLIT_DROME (P24014)MAAPSRTTLMPPPFRLQLRLLILPILLLLRHDAVHAEPYSGGFGSSAVSSGGLGSVGIHIPGGGVGVITEARCPRVCSCTGLNVDCSHRGLTSVPRKISADVERLELQGNNLTVIYETDFQRLTKLRMLQLTDNQIHTIERNSFQDLVSLERLDISNNVITTVGRRVFKGAQSLRSLQLDNNQITCLDEHAFKGLVELEILTLNNNNLTSLPHNIFGGLGRLRALRLSDNPFACDCHLSWLSRFLRSATRLAPYTRCQSPSQLKGQNVADLHDQEFKCSGLTEHA

    AMINOKISLINEOrganske molekule z vsaj eno amino in eno karboksilno skupinoBeljakovinskega izvora (20): nemodificirane, postranslacijsko spremenjene (neobiajne)Nebeljakovinskega izvora (ve 100 razlinih)

    ogljik

    aminoskupina

    karboksiskupina

    tetraedralnanamestitev

    aminokisline

    radikal, , ... C atom

  • 4

    asimetrini ogljikov atom optino aktivne stereoizomere vse razen Gly so kiralne L-aminokisline prevladujejo v naravi D,L-nomenklatura zasnovana na D- in

    L-gliceraldehidu

    L-serine D-serine

    enorkovna koda, trirkovna kodapodobnosti v lastnostih stranskih skupin, zdruevanje v skupinedelitev glede na polarnost stranske skupine

    hidrofobne polarne, nenabite polarne, nabiteGly G Ser S Asp DAla A Thr T Glu EVal V Cys C Lys KLeu L Tyr Y Arg RIle I Asn N His HPro P Gln QMet MPhe FTrp W

    20 NARAVNIH AMINOKISLIN

  • 5

    Skupina 1- nepolarne stranske skupineGly, Ala, Val, Leu, Ile, Pro, Met, Phe, Trpalifatske ali aromatske stranske skupine- hidrofoben karakter. Nizka kemijska reaktivnost stranskih skupin. V notranjosti proteina, stran od vodne faze.

    Skupina 2- polarne, nenabiteSer, Thr, Cys, Tyr, Asn, GlnRazline funkcionalne skupine z enim heteroatomom (O, S ali N), ki ima elektronski par. Lahko tvori H-vezi z vodo ali drugimi skupinami. Cys- disulfidna kovalentna vez, pomembna za 3D zgradbo proteinov. Na povrini proteinov.

    Skupina 3- polarne, nabite pri fiziolokem pHAsp, Glu, Lys, Arg, HisKisle ali bazine stranske skupine. Neto naboj Asp in Glu pri pH7.4 je 1, neto naboj Lys, Arg in His pa +1. Imidazolna skupina His ima pKa pri fiziolokih pogojih, zato ima lahko neto naboj +2. Na povrini proteinov.

  • 6

    Delitev na tri skupine do neke mere arbitrarna:

    G, A, W lahko tudi polarne

    Y,C lahko tudi nabite pri vijih pH

    NEOBIAJNE AMINOKISLINE-kemijsko spremenjene

    po translaciji, pomembno za funkcijo proteina

    4-hidroksiprolin, 5-hidroksilizin v kolagenuhistoni veliko metiliranih, acetiliranih,

    fosforiliranihN-formilmetionin pri biosintezi prokariontskih

    proteinov- karboksiglutaminska kislina pri proteinih,

    ki sodelujejo pri strjevanju krviD-aminokisline komponente bakterijskih

    celinih sten, antibiotikov (gramicidin A)

    5-hidroksilizin 4-hidroksiprolin

    sladkorjitetrapeptidipentapeptidnimostiki

  • 7

    DERIVATI AMINOKISLIN Z BIOLOKO FUNKCIJO

    -aminobutirina kislin (GABA) nevrotransmiterdopamin nevrotransmiterhistamin (dekarboksiliran histidin) lokalni mediator alergijskih reakcijtiroksin tiroidni hormon, ki vsebuje jodINTERMEDIATI V METABOLIZMUcitrulin, ornitin v metabolizmu ureehomocistein v metabolizmu aminokislinS-adenozilmetionin donor metilne skupine

    DISOCIACIJA AMINOKISLIN

    Netopne v organskih topilih (aceton, eter), dobro topne v vodi.Pri fiziolokem pH (7.4) obstajajo kot ioni dvojki. Amfoterne.Pomembno poznavanje naboja, ker doloa lastnosti proteinov!

    pH 1 neto naboj +1 pH 7 neto naboj 0 pH 13 neto naboj -1

    kation "zwitterion" (nevtralen)izoelektrina toka pI

    anion

  • 8

    TITRACIJA GLICINA

    izoelektrina toka

    TITRACIJA GLUTAMINSKE KISLINE

    izoelektrina toka

  • 9

    -karboksilna skupina (-COOH): pKa = 2-amino skupina (NH3+): pKa = 9Kisle aminokislineAspartat, Asp, D pKa3 = 3.9Glutamat, Glu, E pKa3 = 4.3BazineArginin, Arg, R pKa3 = 12.5Histidin, His, H pKa3 = 6.0Lizin, Lys, K pKa = 10.5Cistein, Cys, C (-SH) pKa3 = 8.3Serin, Ser, S (-OH) pKa = 13Treonin, Thr, T (-OH) pKa = 13Tirozin, Tyr, Y (fenolna) pKa = 10.1

    vrednosti so pribline in odvisne od neposredne okolice stranske skupine

    pKa vrednosti aminokislin

    TITRACIJA Ribonukleaze AAla (A) 4 3,12 %Arg (R) 10 7,81 %Asn (N) 9 7,03 %Asp (D) 6 4,69 %Cys (C) 8 6,25 %Gln (Q) 7 5,47 %Glu (E) 6 4,69 %Gly (G) 5 3,91 %His (H) 5 3,91 %Ile (I) 3 2,34 %Leu (L) 2 1,56 %Lys (K) 8 6,25 %Met (M) 5 3,91 %Phe (F) 4 3,12 %Pro (P) 7 5,47 %Ser (S) 16 12,50 %Thr (T) 8 6,25 %Trp (W) 0 0,00 %Tyr (Y) 5 3,91 %Val (V) 10 7,81 %

    alpha-NH3 : 9,69 Asp : 3,86alpha-COOH : 2,34 Glu : 4,25Arg : 12,40 Cys : 8,33Lys : 10,50 Tyr : 10,00His : 6,00

    titracijska krivulja "zabrisana"veliko tevilo ionizabilnih aminokislin3D struktura pK se lahko premaknejo

    do nekaj enot

  • 10

    REAKTIVNOST AMINOKISLIN

    Karboksilne skupine pretvorbe v estre, amideAmino skupine pretvorbe v amide, Schiffove bazeHidroksilne skupine pretvorbe v estre

    Kemijske spremembe po translacijiImajo pomembno vlogo za strukturo in delovanje proteinaFosforilacija tirozina, serinaCys- disulfidna vez, alkilacija, tvorba merkaptidovHidroksilirana oblika prolina in lizina v kolagenu

    Kemijske reakcije za detekcije aminokislin in pri analizi proteinovNinhidrinska reakcija vijolina barvaSangerjeva reakcija rumena barva

    amid

    substituiranamid

    ester

    polimer

    Schiffova baza

    substituiranamid

    KARBOKSILNA SKUPINA

    AMINO SKUPINA

    sintezaaminoacil tRNA

    sintezaproteinov

  • 11

    O

    OHOH

    HH

    H

    CH2

    H

    OPOPOPO

    O

    O O

    O O

    OR

    HC C

    NH3+

    OO

    O

    OHOH

    HH

    H

    CH2

    H

    OPOC

    O

    O

    HCR

    NH2

    O

    Adenin

    Adenin

    ATPAminokislina

    Aminoacil -AMP

    + PPi

    1. korak

    O

    OHOH

    HH

    H

    CH2

    H

    OPOC

    O

    O

    HCR

    NH2

    O

    Adenin

    O

    OHO

    HH

    H

    CH2

    H

    OPO

    O

    O

    Adenin

    tRNA

    C

    HC

    O

    NH3+

    R

    tRNAAMP

    Aminoacil -AMP

    Aminoacil -tRNA

    (terminalni 3 nukleotid tRNA)

    3 2

    2

    2. korak

  • 12

    CCA 3 KONEC

    Estrska vez- lahko na 2' ali 3' hidroksilni skupini

    Aminokislina

    ONCP

    H. Shi and P.B.Moore, RNA6: pp. 1091, 2000

    kvasna fenilalanin tRNA

    cistein cistin

    N-etilmaleimid

    iodoacetat

    5,5'-ditiobis (2-nitrobenzojska kislina)DTNB

    "Ellmanov reagent"

    tiolni anionmax=412 nm

    TIOLNA SKUPINA (Cys)

    disulfidna vez

  • 13

    ninhidrin

    ninhidrin

    dve resonanni obliki Ruhemann

    vijolinega

    NINHIDRINSKA REAKCIJA

    SPEKTROSKOPSKE LASTNOSTI AMINOKISLIN

    Vse absorbirajo svetlobo v infrardeem obmoju Phe, Tyr in Trp absorbirajo UV Absorbcija pri valovni dolini 280 nm - pomo za

    zasleditev aromatinih aminokislin (Phe, Tyr in Trp) in doloanje koncentracije proteinov

    NMR spektri znailni za vsako aminokislino Asimetrine - sukajo ravnino polarizirane svetlobe

    (CD-spektroskopija) Oznaene aminokisline lahko loujemo s HPLC

    (tekoinska kromatografija z visoko loljivostjo)-pomembno pri doloanju primarne zgradbe proteinov

  • 14

    Valovna dolina (nm)

    Mol

    arna

    abs

    orbc

    ija,

    ABSORPCIJSKI SPEKTRI AROMATSKIH AMINOKISLIN

    aminokisline se lahko povezujejo s peptidno vezjo

    dve aminokislini

    odstranitev vode

    nastanek -CO-NH-

    amino konec karboksilni k