Original article 369

[Downloaded free from http://www.bmfj.eg.net on Monday, January 7, 2019, IP: 156.218.76.38]

Protective effect of obestatin on indomethacin-induced acutegastric ulcer in rats: role of VEGF and TNF-αReham M. Ibrahim, Mona M. Allam, Ola A. El-Gohary, Alaa E.A. El-Talees,Mohamed S. El-Hamady

Department of Physiology, Benha Faculty of

Medicine, Benha University, Benha, Egypt

Correspondence to Reham M. Ibrahim, MSc,

Department of Physiology, Faculty of Medicine,

Benha University, Benha, 13511, Egypt.

Tel: 0122349445;

e-mail: dr_reham_13@yahoo.com

Received 29 April 2018Accepted 26 July 2018

Benha Medical Journal 2018, 35:369–377

© 2019 Benha Medical Journal | Published by Wolters K

BackgroundGastric ulcer (GU) is one of the most common disorders that affect thegastrointestinal tract. Obestatin, a ghrelin-related peptide, has been shown toexhibit some protective and therapeutic effects in the gut.AimThis study aimed at investigating the protective effect of obestatin on acuteindomethacin (IND)-induced GU, clarifying the role of vascular endothelialgrowth factor (VEGF) and tumor necrosis factor-α (TNF-α).Materials and methodsA total of 32 adultWistar albinomale rats were divided into four main groups: controlgroup, obestatin group, GU group, and obestatin+GU group. Obestatin was givenby a single intraperotineal injection (30 μg/kg) 1 h before induction of GU by a singleoral dose of IND (40mg/kg). Pyloric ligation was carried out in all animals beforeIND or distilled water administration. Four hours later after IND treatment, gastriculcer index, preventive index, gastric juice volume, and free and total acidity wereassessed. Nitric oxide, VEGF mRNA, and TNF-α mRNA were measured in gastrictissue, as well as histopathological study of gastric injury.ResultsIND caused a significant increase in ulcer index, gastric juice volume, free and totalacidity, and TNF-α mRNA, with a significant decrease in nitric oxide and VEGFmRNA. Pretreatment with obestatin reversed these effects.ConclusionObestatin pretreatment showed a gastroprotective effect against the IND-inducedGU that can be explained by the anti-inflammatory and angiogenic effects ofobestatin treatment and reduction of gastric juice volume, free acidity, and totalacidity.

Keywords:anti-inflammatory, gastric ulcer, indomethacin, obestatin, vascular endothelial growth factor

Benha Med J 35:369–377

© 2019 Benha Medical Journal2357-0016

This is an open access journal, and articles are distributed under the terms

of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0

License, which allows others to remix, tweak, and build upon the work

non-commercially, as long as appropriate credit is given and the new

creations are licensed under the identical terms.

IntroductionGastric ulcer (GU) is a major health hazard in terms ofboth morbidity and mortality [1];∼14.5 million peopleworldwide are affected by GU, with a mortality rate of4.08 million per year [2].

The pathogenesis of GU has been considered mainlyowing to imbalance between defensive factors [mucussecretion, gastroprotective prostaglandins (PGs)synthesis, bicarbonate production, and normal tissuemicrocirculation] and aggressive factors (excessivesecretion of gastric acid, alcohol intake, bile salts,abnormal motility, infection with Helicobacter pylori,and NSAIDs) [3].

NSAIDs-induced GUs are the second most commonetiology of GUs [4]. According to previous reports, theoral administration of indomethacin (IND), a well-known NSAID, in rats causes ulcerative lesions in thegastric mucosa [5]. IND induces its gastrointestinal

luwer - Medknow

tract (GIT) toxicity via several mechanisms such as anincrease in gastric acid secretion, interfere withmucosalcell regeneration via inhibition of PGE2 synthesis,production of free radicals, reduction of gastric nitricoxide (NO) level, and invasion of activated neutrophilsas well as induction of gastric cells apoptosis [6]. Inaddition, it causes oxidative damage of the stomach andthe generation of proinflammatory mediators [7].Furthermore, NSAIDs were reported to inhibitangiogenesis through downregulation of the pro-angiogenic factors such as vascular endothelialgrowth factor (VEGF) and upregulation of anti-angiogenic proteins such as endostatin leading todelayed ulcer healing [8].

DOI: 10.4103/bmfj.bmfj_86_18

mailto:dr_reham_13@yahoo.com

370 Benha Medical Journal, Vol. 35 No. 3, September-December 2018

[Downloaded free from http://www.bmfj.eg.net on Monday, January 7, 2019, IP: 156.218.76.38]

Obestatin is a ghrelin-related peptide. It is composedof 23 amino acids [9]. It is expressed in many tissuesalong the GIT, most notably the stomach, pancreas,duodenum, jejunum, and colon [10]. However, mostcells that produce obestatin appear to be concentratedin the oxyntic mucosa of the stomach, and the stomachis considered the major source of circulating obestatin[11].

Obestatin has been reported to be an anorexigenichormone, decreasing food intake and body weight.Interestingly, obestatin has been reported to havecertain effects on GIT, including decrease in gastricemptying time and jejunal motility, and it exhibitssome protective and therapeutic effects in the gut[12]. Moreover, it was reported that obestatin hasanti-inflammatory [13–15], anti-oxidative stress[16], and antiapoptotic effects [17].

Materials and methodsAnimalsThis study was conducted on 32 adult Wistar albinomale rats, 6–8 weeks old, weighing between 180 and220 g. They were obtained from the ExperimentalAnimal Unit of Moshtohor Faculty of Agriculture,Benha University. The study was approved by ourIRB. The animals were acclimatized to thelaboratory conditions for 10 days before theinitiation of the experiment. They had free access towater and diet. Experimental rats were under completehealthy conditions all over the experiment and undercare of a professional technician. No rats diedthroughout the experiment. At the end of the study,the rats were incinerated at Benha university hospitalincinerator.

Experimental designThe rats were deprived of food for 24 h before theexperiment in mesh-bottomed cages to minimizecoprophagia but allowed free access to water exceptthe last hour before the experiments [18]. Allexperiments were performed during the same timeof the day between 8 a.m. and 12 p.m. to avoidvariations owing to diurnal rhythms of putativeregulators of gastric functions [19].

The animals of the experiment were divided into fourgroups, and each group consisted of eight rats. In groupI ‘control group’, animals received singleintraperitoneal (i.p.) injection of saline and thenafter 1 h, a single oral dose of distilled water (thesolvent of IND). In group II ‘obestatin group’,animals received a single i.p. injection of obestatin in

a dose of 30 μg/kg [20], and then after 1 h a single oraldose of distilled water. In group III ‘GU group’,animals received single i.p. injection of saline andthen after 1 h gastric ulceration was induced by asingle oral dose of IND (40mg/kg) by orogastricgavage [21]. In group IV ‘obestatin+GU group’,animals were pretreated with a single i.p. injectionof obestatin (30 μg/kg) 1 h before induction of GUby a single oral dose of IND (40mg/kg) by orogastricgavage.

Pyloric ligationPyloric ligation was carried out in each animal beforeoral administration of distilled water or IND to collectgastric juice under light di-ethyl ether anesthesia. Amid-line abdominal incision was performed; thepyloric portion of the stomach was gently mobilizedand carefully ligated with a silk ligature around thepyloric sphincter taking care not to interfere withgastric blood supply. The abdominal incision wassutured, and the animals were allowed to recoverfrom anesthesia [22].

Gastric juice was allowed to accumulate for a period ofnext 4 h [23]. The animals were anesthetized with di-ethyl ether before cervical dislocation. Their stomachswere rapidly removed after clamping the esophagus,opened by an incision along the greater curvature, andthe gastric juice was collected and then assessed forvolume, free and total acidity. Gastric tissues werewashed with ice-cold saline to remove gastriccontent remnants and blood clots and then assessedmacroscopically. Finally, a part of each stomach wasimmediately kept in formaldehyde to be prepared forhistopathological examination with hematoxylin andeosin for detection of the histopathological changes,and the other part was immediately frozen in liquidnitrogen and stored at −80°C for biochemicalestimations of tissue NO, tumor necrosis factor-α(TNF-α) mRNA, and VEGF mRNA.

Assessment of gastric mucosal lesionsGastric tissues were pinned out flat on a cork board andphotographed for lesion assessment. The stomachswere examined for macroscopical mucosal lesionswith the aid of a magnifier by a pathologist unawareof the treatment protocol. The gastric mucosal lesionswere expressed in terms of ulcer index (UI) according toPeskar et al. [24] which depends on the calculation ofthe severity of each lesion by using a 0–3 scoringsystem. The severity factor was defined according tothe length of the lesions, where severity factor 0= nolesions; severity factor 1= lesions less than 1mmlength, severity factor 2= lesions 2–4mm in length,

Effect of obestatin on gastric ulcer Ibrahim et al. 371

[Downloaded free from http://www.bmfj.eg.net on Monday, January 7, 2019, IP: 156.218.76.38]

and severity factor 3= lesions greater than 4mm inlength. The lesion score for each rat was calculated asthe number of lesions in the rat multiplied by theirrespective severity factor. The UI for each group wastaken as the mean lesion score of all the rats in thatgroup. The preventive index (PI) of a given drug(obestatin) was calculated by the equation of Hanoet al. [25]:

PI ¼ UIofINDgroup�UIofpretreatedgroupUIofINDgroup

× 100:

Analysis of gastric juiceDetermination of volume

Gastric juice from each animal was centrifuged at1000g for 10min to remove any solid debris, andthe volume of the supernatant was measured andexpressed in ml.

Determination of free and total acidityA volume 1ml gastric juice diluted with 10ml ofdistilled water was taken into a conical flask, and2–3 drops of Topfer’s reagent as an indicator wasadded to it and titrated with 0.01N NaOH until acanary yellow color was observed. The volume ofNaOH consumed corresponding to free acidity wasnoted. Then, 2–3 drops of phenolphthalein solutionwere added, and the titration was continued until apermanent pink color was observed. Again, the totalvolume of NaOH corresponding to total acidity wasnoted. The acidity was calculated by using thefollowing formula [26]:

Acidity ¼ Volume ofNaOH×N× 1000:1

mEq=l:

Biochemical analysisMeasurement of tissue NO

It was done by Nitric oxide assay kit (catalog no.: no 253; Biodiagnostic, Giza, Egypt) according to themanufacturers’ instructions. The NO content in thestomach tissue was determined by measuring its nitrite(an indicator of original NO present). This methoddepends on reduction of nitrate to nitrite by vanadiumtrichloride (VCl3), which was followed by addition ofGriess reagent [27].

Table 1 Primer sequences used for real-time PCR

Forward

VEGF ATCATGCGGATCAAACCTCACC

TNFα TGCACCACCACCTGCTTAGCGAPDH AAATGGGCTCCCTCTGATCAGT

TNF-α, tumor necrosis factor-α.

Assessment of mRNA expression of VEGF and TNFα byreal-time RT-PCR

Total RNA extraction: total RNA was extracted usingRNeasy mini kit (Qiagen, GmbH, Hilden, Germany)according to the manufacturer’s protocol, and theproduct of extraction was stored at −80°C. Theconcentration and purity of RNA were determinedspectrophotometrically by the 260/280 nm ratio,which ranged between 1.8 and 2.1.

Reverse transcription reaction: the isolated total RNAwas reverse-transcribed into complementary DNA(cDNA) using the high-capacity cDNA ReverseTranscription Kit (Applied Biosystems, Foster City,California, USA) according to the manufacturer’sinstructions, and all products were stored at −20°C.

Real-time quantitative qPCR: the expression levels ofVEGF and TNF-α genes were analyzed by qPCRusing the SYBR Green PCR Master MIX (AppliedBiosystems), and the expressions of VEGF and TNF-αwere performed in Applied Biosystems 7500 Real-Time PCR. The sequences of the primers used arelisted in Table 1. Glyceraldehyde-3-phosphatedehydrogenase (GAPDH) was used as thehousekeeping gene. As a relative quantitation, foldchanges were calculated following the 2−ΔΔCt

method. For each sample, the Ct value of targetgene mRNA was normalized against the GAPDHendogenous control as ΔCt (ΔCt=Cttargetgene–CtGAPDH). The fold change of the target genemRNA in the experimental sample relative to controlsample was determined by 2−ΔΔCt, whereΔΔCt=ΔCtExperimental−ΔCtControl.

Histopathological examinationFor histological evaluation, stomach samples were fixedin 10% formalin solution where they remained for 24 h.After fixation, the samples were transferred to asolution of 70% alcohol and processed for paraffinwax embedding. Sections (4 μm thick) weredeparaffinized, stained with hematoxylin and eosin,and then examined under a light microscope by anexperienced pathologist who was blinded to thetreatment.

5′–3′ sequences

Reverse

GGTCTGCATTCACATCTGCTATGC

GGCATGGACTGTGGTCATGAC

T TCTGCTTGGTGGTTTGCTACCAC

Table 2 Effect of obestatin pretreatment on ulcer index andpreventive index in different experimental groups (n=8)

UI PI

Group I 0.00±0.00 –

Group II 0.00±0.00 –

Group III 27±2.98*,+ –

Group IV 3.25±1.67*,+,# 87.96%

Data are represented as mean±SD. Group I: control group; groupII: obestatin group; group III: gastric ulcer group; group IV:obestatin (30 μg/kg)+gastric ulcer; PI, preventive index; UI, ulcer

372 Benha Medical Journal, Vol. 35 No. 3, September-December 2018

[Downloaded free from http://www.bmfj.eg.net on Monday, January 7, 2019, IP: 156.218.76.38]

Chemicals usedIndomethacin (Liometacen) (The NILE Co. forPharm. and Chemical Ind., Cairo, Egypt), obestatin(mouse, rat) (O0266-.5MG) (Lot No.: 020M4807;Sigma Aldrich, St. Louis, Missouri, USA), TopferReagent (Lot No.: 0000245747; HiMediaLaboratories Pvt. Ltd, Mumbai, India), and Di-ethyl ether (38132 L05; Sd Fine-Chem Limited,India) were used for the experiment.

index. P

Table 3 Effect of obestatin pretreatment on gastric juicevolume and gastric juice free and total acidity in differentexperimental groups (n=8)

Gastric juice volume(ml)

Free acidity(mEq/l)

Total acidity(mEq/l)

Group I 2.04±0.35 11.50±2.45 23.88±2.75

GroupII

1.76±0.27 8.44±1.72 23.00±2.27

GroupIII

5.85±0.48*,+ 61.75±5.28*,+ 87.63±5.95*,+

GroupIV

3.01±0.62*,+,# 19.75±5.78*,+,# 37±8.14*,+,#

Data are represented as mean±SD. Group I: control group; groupII: obestatin group; group III: gastric ulcer group; group IV:obestatin (30 μg/kg)+gastric ulcer. P

Figure 2

Histological evaluation (H&E) of gastric mucosa in different experi-mental groups. (a) Light microscopy of control group (group I)revealed normal histopathologic structure of stomach (H&E, ×100).(b) Light microscopy of obestatin group (group II) revealed normalhistopathologic structure of stomach (H&E, ×100). (c) Light micros-copy of indomethacin group (group III) revealed epithelial cells loss(long arrow), marked inflammatory cells infiltration (arrow head),congested blood vessels (*), and submucosal edema (short arrow)(H&E, ×100). (d) Light microscopy of obestatin pretreated group(group IV) showed nearly normal histopathologic structure of thestomach, and intact mucosa with mild inflammatory cellular infiltration(arrow) (H&E, ×100). H&E, hematoxylin and eosin.

374 Benha Medical Journal, Vol. 35 No. 3, September-December 2018

[Downloaded free from http://www.bmfj.eg.net on Monday, January 7, 2019, IP: 156.218.76.38]

between aggressive factors and decreased gastricresistance. IND induces its gastrointestinal toxicityvia several mechanisms such as an increase in gastricacid secretion, interference with mucosal cellregeneration via inhibition of PGE2 synthesis,production of free radicals, reduction of gastric NOlevel, and invasion of activated neutrophils as well asinduction of gastric cells apoptosis [6].

Obestatin is a novel 23-amino acid peptide hormonefirst identified in the rat stomach as a ghrelin-accompanying peptide [9]. It was reported thatobestatin has anti-inflammatory [13–15],antioxidative stress [16], and antiapoptotic effects [17].

In spite of the accumulating data about the effects ofobestatin on GIT, the role of obestatin in themanagement of the GIT diseases needs to beestablished. Hence, this study was designed toinvestigate the protective effect of obestatin on acuteGU induced by IND administration with explorationof the possible underlying mechanisms.

Parameters chosen to assess the GU and the protectiveeffect of obestatin included gastric juice volume andacidity, NO, VEGF mRNA, inflammatory markerssuch as TNF-α mRNA, with measurement of UI and

obestatin PI, and finally histopathological evaluation ofthe gastric mucosa.

The results of the present study showed thatadministration of IND at a single dose (40mg/kgp.o.) resulted in multiple hemorrhagic lesions bygross examination along with a significant increase(P

Effect of obestatin on gastric ulcer Ibrahim et al. 375

[Downloaded free from http://www.bmfj.eg.net on Monday, January 7, 2019, IP: 156.218.76.38]

excess acid secretion decreases the process of restitutionand ulcer healing via altering angiogenesis [34].

The results of our study also indicated that there was asignificant decrease (P

376 Benha Medical Journal, Vol. 35 No. 3, September-December 2018

[Downloaded free from http://www.bmfj.eg.net on Monday, January 7, 2019, IP: 156.218.76.38]

The results of our study also indicated thatpretreatment with obestatin resulted in a significantincrease (P

Effect of obestatin on gastric ulcer Ibrahim et al. 377

[Downloaded free from http://www.bmfj.eg.net on Monday, January 7, 2019, IP: 156.218.76.38]

18 Yamasaki K, Ishiyama H, Imaizumi T, Kanbe T, Yabuuchi Y. Effect of OPC-12759, a novel antiulcer agent, on chronic and acute experimental gastriculcer, and gastric secretion in rats. Jpn J Pharmacol 1989; 49:441–448.

19 Noriyoshi S, Masaru Y, Takemi G, Yoshimitsu A. Stimulation ofprostaglandin E2 and interleukin-1ß production from periodontal ligamentcells of old rat subjected to mechanical stress. J Gerontol 2000; 55:B489–B495.

20 Konturek PC, Konturek S, Koziel J, Brzozowski T. W1717 Effect ofObestatin on Stress-Induced Gastric Lesions in Rat. Gastroenterology2010; 138:S–725.

21 Rainsford KD, Whitehouse MW. Biochemical gastroprotection from acuteulceration induced by aspirin and related drugs. Biochem Pharmacol 1980;29:1281–1289.

22 Alumets J, Ekelund M, Håkanson R, Hedenbro J, Rehfeld JF, Sundler F, etal. Gastric acid response to pylorus ligation in rats: is gastrin or histamineinvolved?. J Physiol 1982; 323:145–156.

23 Tarique M, Siddiqui HH, Khushtar M, Rahman MA. Protective effect ofhydro-alcoholic extract of Ruta graveolens Linn. leaves on indomethacinand pylorus ligation-induced gastric ulcer in rats. J Ayurveda Integr Med2016; 7:38–43.

24 Peskar BM, Ehrlich K, Peskar BA. Role of ATP-sensitive potassiumchannels in prostaglandin-mediated gastroprotection in the rat. JPharmacol Exp Ther 2002; 301:969–974.

25 Hano J, Bugajski J, Danek L. Effect of adrenergic blockade on gastricsecretion altered by catecholamines in rats. Arch Immunol Ther Exp(Warsz) 1976; 24:507–524.

26 Hawk PB, Oser BL, Summerson WH. Folin-Wu modified method. Practicalphysiological chemistry. 12th ed. Philadelphia: The Blakiston Co; 1947. 506.

27 Miranda KM, Espey MG, Wink DA. A rapid, simple spectrophotometricmethod for simultaneous detection of nitrate and nitrite. Nitric Oxide 2001;5:62–71.

28 Suleyman B, Halici Z, Odabasoglu F, Gocer F. The effect of lacidipine onindomethacin induced ulcers in rats. Int J Pharmacol 2012; 8:115–121.

29 Abbas AM, Sakr HF. Effect of selenium and grape seed extract onindomethacin-induced gastric ulcers in rats. J Physiol Biochem 2013;69:527–537.

30 Abdallah IZA, Khattab HAH, Heeba GH. Gastroprotective effect of Cordiamyxa L. fruit extract against indomethacin-induced gastric ulceration in rats.Life Sci J 2011; 8:433–445.

31 Sabina EP, Rasool M. Therapeutic efficacy of Indian Ayurvedic HerbalFormulation Triphala on Lipid Peroxidation, Antioxidant Status andInflammatory Mediator TNF-Ot in Adjuvant-induced Arthritic Mice. Int JBiol Chem 2007; 1:149–155.

32 El-Moselhy MA, Abdel-Hamid NM, Abdel-Raheim SR. Gastroprotectiveeffect of nicorandil in indomethacin and alcohol-induced acute ulcers.Appl Biochem Biotechnol 2009; 152: 449–459.

33 Valcheva-Kuzmanova S, Krasnaliev I, Galunska B, Belcheva A. Influenceof dl-alpha-tocopherol acetate on indomethacin-induced gastric mucosalinjury in rats. Auton Autacoid Pharmacol 2007; 27:131–136.

34 Musumba C, Pritchard DM, Pirmohamed M. cellular and molecularmechanisms of NSAID-induced peptic ulcers. Aliment Pharmacol Ther2009; 30:517–531.

35 Oluwabunmi IJ, Abiola T. Gastroprotective effect of methanolic extract ofGomphrena celosioides on indomethacin induced gastric ulcer in Wistaralbino rats. Int J Appl Basic Med Res 2015; 5:41.

36 Sabiu S, Garuba T, Sunmonu TO, Sulyman AO, Ismail NO. Indomethacin-induced gastric ulceration in rats: ameliorative roles of Spondias mombinand Ficus exasperata. Pharm Biol 2016; 54:180–186.

37 El-Ashmawy NE, Khedr EG, El-Bahrawy HA, Selim HM. Gastroprotectiveeffect of garlic in indomethacin induced gastric ulcer in rats. Nutrition 2016;32:849–854.

38 Adhikary B, Yadav SK, Chand S, Bandyopadhyay SK, Chattopadhyay S.Black tea and theaflavins suppress various inflammatory modulators and i-NOS mediated nitric oxide synthesis during gastric ulcer healing. FreeRadic Res 2011; 45:767–778.

39 Zhang Z, Zou YY, Li FJ, Hu CP. Asymmetric dimethylarginine: a novelbiomarker of gastric mucosal injury? World J Gastroenterol 2011; 17:2178.

40 Abdel-Raheem IT. Gastroprotective Effect of Rutin against Indomethacin-Induced Ulcers in Rats. Basic Clin Pharmacol Toxicol 2010; 107:742–750.

41 Antonisamy P, Kannan P, Aravinthan A, Duraipandiyan V, Valan Arasu M,Ignacimuthu S, et al. Gastroprotective activity of violacein isolated fromChromobacterium violaceum on indomethacin-induced gastric lesions inrats: investigation of potential mechanisms of action.ScientificWorldJournal 2014; 2014:616432.

42 George MY, Esmat A, Tadros MG, El-Demerdash E. In vivo cellular andmolecular gastroprotective mechanisms of chrysin; Emphasis on oxidativestress, inflammation and angiogenesis. Eur J Pharmacol 2018; 818:486–498.

43 Ghosh AK. Regulation by prostaglandin E2 and histamine of angiogenesisin inflammatory granulation tissue. Yakugaku Zasshi 2003; 123:295–303.

44 Choi YJ, KimN, Lee JY, NamRH, ChangH, Seo JH, et al.Protective effectsof garlic extract, PMK-S005, against nonsteroidal anti-inflammatory drugs-induced acute gastric damage in rats. Dig Dis Sci 2014; 59:2927–2934.

45 Takahashi S, Fujita T, Yamamoto A. Role of nuclear factor-κB in gastriculcer healing in rats. Am J Physiol Gastrointest Liver Physiol 2001; 280:G1296–G1304.

46 Yadav SK, Adhikary B, Chand S, Maity B, Bandyopadhyay SK,Chattopadhyay S. Molecular mechanism of indomethacin-inducedgastropathy. Free Radic Biol Med 2012; 52:1175–1187.

47 AboodWN, Abdulla MA, Ismail S. Involvement of inflammatory mediators inthe gastroprotective action of Phaleriamacrocarpa against ethanol-inducedgastric ulcer. World Appl Sci J 2014; 30:344–350.

48 Konturek PC, Koziel J, Konturek S, Brzozowski T. Sa1735 Obestatin ProtectsGastric Mucosa Against Ethanol-Induced Injury. Gastroenterology 2011; 140:S–316.

49 Brzozowski T, Szlachcic A, Pajdo R, Sliwowski Z, Drozdowicz D,Majka J, etal. (2011). Role of New Appetite Hormones Ghrelin, Orexin-A andObestatin in the Mechanism of Healing of Chronic Gastric Ulcers. InPeptic Ulcer Disease. InTech

50 Agnew AJ, Robinson E, McVicar CM, Harvey AP, Ali IH, Lindsay JE, et al.The gastrointestinal peptide obestatin induces vascular relaxation viaspecific activation of endothelium-dependent NO signalling. Br JPharmacol 2012; 166:327–338.

51 Ku JM, Andrews ZB, Barsby T, Reichenbach A, LemusMB, DrummondGR,et al. Ghrelin-related peptides exert protective effects in the cerebralcirculation of male mice through a nonclassical ghrelin receptor (s).Endocrinology 2015; 156:280–290.

52 Schinzari F, Iantorno M, Campia U, Mores N, Rovella V, Tesauro M, et al.Vasodilator responses and endothelin-dependent vasoconstriction inmetabolically healthy obesity and the metabolic syndrome. Am J PhysiolEndocrinol Metab 2015; 309:E787–E792.

53 Rahim NA, Hassandarvish P, Golbabapour S, Ismail S, Tayyab S, AbdullaMA. Gastroprotective effect of ethanolic extract of Curcuma xanthorrhizaleaf against ethanol-induced gastric mucosal lesions in Sprague-Dawleyrats. Biomed Res Int 2014; 2014:416409.

54 Penna C, Tullio F, Femminò S, Rocca C, Angelone T, Cerra MC, et al.Obestatin regulates cardiovascular function and promotes cardioprotectionthrough the nitric oxide pathway. J Cell Mol Med 2017; 21:3670–3678.

55 Azlina MFN, Qodriyah HMS, Chua KH, Kamisah Y. Comparison betweentocotrienol and omeprazole on gastric growth factors in stress-exposedrats. World J Enterol 2017; 23:5887.

56 Milani S, Calabrò A. Role of growth factors and their receptors in gastriculcer healing. Microsc Res Tech 2001; 53:360–371.

57 Luizon MR, Sandrim VC. Hypertension and vascular endothelial growthfactors. In: Pathophysiology and pharmacotherapy of cardiovasculardisease. Adis, Cham. 2015; pp. 695–707.

58 Neagoe PE, Lemieux C, Sirois MG. Vascular endothelial growth factor(VEGF)-A165-induced prostacyclin synthesis requires the activation ofVEGF receptor-1 and-2 heterodimer. J Biol Chem 2005; 280:9904–9912.

59 Gurriarán-Rodríguez U, Santos-Zas I, González-Sánchez J, Beiroa D,Moresi V, Mosteiro CS, et al. Action of obestatin in skeletal musclerepair: stem cell expansion, muscle growth, and microenvironmentremodeling. Mol Ther 2015; 23:1003–1021.

60 Dembiński A, Warzecha Z, Ceranowicz P, Cieszkowski J, Dembin ́ski M,Ptak-Belowska A, et al. Administration of obestatin accelerates the healingof chronic gastric ulcers in rats. Med Sci Monit 2011; 17:BR196.

61 Tornatore L, Thotakura AK, Bennett J, Moretti M, Franzoso G. The nuclearfactor kappa B signaling pathway: integrating metabolism withinflammation. Trends Cell Biol 2012; 22:557–566.