GYNECOLOGIC ONCOLOGY

Polymorphisms in the promoter region of estrogen receptor b genein endometrial cancer

Claus Lattrich • Julia Haring • Susanne Schuler •

Maciej Skrzypczak • Olaf Ortmann • Oliver Treeck

Received: 10 March 2013 / Accepted: 12 August 2013 / Published online: 24 August 2013

� Springer-Verlag Berlin Heidelberg 2013

Abstract

Introduction The development of endometrial cancer is

known to be affected by estrogens. Thus, genetic variations

like single nucleotide polymorphisms (SNPs) in genes

involved in estrogen biosynthesis, metabolism, and signal

transduction might affect risk for endometrial cancer. In

this study, we tested the hypothesis that polymorphisms in

the promoter of ESR2 gene may be associated with sus-

ceptibility to this disease.

Methods We compared the frequency of three SNPs in

the promoter region of ESR2 gene (rs2987983, rs3020450,

and rs3020449) in 135 women with endometrial cancer and

135 healthy women serving as controls by means of allele-

specific tetra-primer PCR.

Results Regarding allele frequency, allele positivity or

genotype frequencies of these SNPs we did not observe any

significant difference between healthy women and women

with endometrial cancer.

Conclusion Our data clearly suggest that the tested SNPs

in the promotor region of human ESR2 gene are not

associated with the development of endometrial cancer.

Keywords Endometrial cancer � Estrogen receptor

b � Single nucleotide polymorphism � Case–control

study

Introduction

Endometrial cancer is the most common type of uterine

cancer in the western world [1]. Although the exact cause

of endometrial cancer is unknown, increased levels of

estrogens appear to play a role in the development of this

disease [2]. Most of the action of estrogens is mediated via

ligand-dependent transcription factors, the estrogen recep-

tors (ER). Identification of the second estrogen receptor

gene ESR2 and its gene product, ERb, has led to a re-

evaluation of estrogen action in target tissues such as

endometrium [3]. ERb is expressed both in normal and

neoplastic endometrial tissue but its role in either is not

fully understood. In contrast to breast and prostate cancer,

ERb expression is not reduced in endometrial cancer, but

distinct splice variants like ERb5 were found to be over-

expressed [4–6]. Thus, this receptor seems to play no tumor

suppressor role in endometrial cancer like suggested in the

breast and prostate. This was corroborated by recent find-

ings by our group showing an association of ERb with

expression of oncogenes like HER2 and MYBL2 in

endometrial cancer [6].

Single nucleotide polymorphisms (SNPs) are the most

frequent sequence variations in the human genome. SNPs

located in exon regions may alter protein function,

whereas SNPs in the gene promoter can modify gene

expression levels [7–9]. Polymorphisms in genes involved

in estrogen biosynthesis, metabolism and signal trans-

duction have been suggested to play a role in hormone-

dependent cancers [10, 11]. In the last years, a multitude

of SNPs both in ESR1 and ESR2 gene have been iden-

tified and different genotype–phenotype association stud-

ies have been published examining the significance of

randomly chosen SNPs in different hormone-dependent

diseases [12–15].

C. Lattrich (&) � J. Haring � S. Schuler � O. Ortmann �O. Treeck

Department of Obstetrics and Gynecology, University Medical

Center Regensburg, 93053 Regensburg, Germany

e-mail: clattrich@caritasstjosef.de; claus.lattrich@klinik.uni-

regensburg.de

M. Skrzypczak

Second Department of Gynecology, Medical University of

Lublin, Lublin, Poland

123

Arch Gynecol Obstet (2014) 289:631–635

DOI 10.1007/s00404-013-3012-8

In this study, we examined three SNPs in the promoter

region of human ESR2 gene. We compared allele fre-

quencies of these SNPs in 135 healthy women and 135

women with endometrial cancer.

Patients and methods

Patients

Blood samples from 135 Caucasian women with endome-

trial cancer and such as many Caucasian women not having

any malignancy were collected between 2007 and 2012 by

the Second Department of Gynecology of the Medical

University of Lublin, Poland and by the Clinic of Obstet-

rics and Gynecology, Medical University of Regensburg,

Germany. Patients and controls were matched for gender

and age. The histopathologic characteristics of the patients

are shown in Table 1. Inclusion criterion for the control

subjects was the absence of known malignancies. All

women granted consent for the collection and use of bio-

logic material. Blood samples of patients were collected in

accordance with Polish and German regulations and in

agreement with the Ethical Committees of the University

School of Medicine in Lublin, Poland and the University

Medical Center Regensburg, Germany.

SNP analysis

Three SNPs in the 0N promoter region of ESR2 gene were

identified using the internet sites http://www.genecards.org

and http://www.ncbi.nlm.nih.gov/SNP. The basis for SNP

selection was their location in the 50 region directly adja-

cent to the transcription start site of ESR2 gene. SNP

rs2987983 (C/T) is located at position 63833406 of chro-

mosome 14, rs3020450 (A/G) is located at position

63838055 and SNP rs3020449 (A/G) (formerly rs8004842)

is located at position 63843145 of chromosome 14 (Fig. 1).

Genomic DNA was isolated from 100 ll EDTA-blood

after addition of 300 ll lysis buffer (1 % v/v TritonX,

0.32 M Sucrose, 0.01 M Tris (pH 7.5) and 5 mM MgCl2)

and twofold centrifugation (13,000g) for 30 s. Pellet was

resuspended in 50 ll PCR buffer (GoTaq buffer, Promega,

Madison, USA) containing 0.5 % Tween 20 and 10

Table 1 Characteristics of the endometrial cancer cases (n = 135)

included in this study

FIGO G1 G2 G3

IA 11 – –

IB 22 25 –

IC 13 16 –

IIA – 3 –

IIB – – 17

IIIA – – 28

Old FIGO classification of endometrial cancer (valid until 2010) was

used

Fig. 1 The single nucleotide polymorphisms analyzed in this study

are located in the 50-region of estrogen receptor b gene (ESR2),

namely in the promoter region of untranslated exon 0N

632 Arch Gynecol Obstet (2014) 289:631–635

123

mAnson units proteinase K (Merck, Darmstadt, Germany)

followed by incubation at 50 �C over night and finally heat

inactivation of the enzyme for 10 min at 95 �C. The

genomic DNA-containing lysate was subjected to a tetra-

primer ARMS PCR approach [16] allowing allele-specific

amplification using the PCR primers listed in Table 2

(synthesized at Metabion, Martinsried, Germany). For this

purpose, to 100 ng of genomic DNA, 2 ll of 5 9 GoTaq

buffer, 0.2 ll of dNTP Mix (10 mM) (Fermentas, St. Leon-

Rot, Germany), 0.2 ll of each PCR primer (10 lM) and

0.5 U GoTaq polymerase (Promega, Madison, USA) were

added and PCR was carried out using a T1 thermocycler

(Biometra, Germany). PCR program was 10 min 94 �C

followed by 38 PCR cycles of 94 �C (30 s), 56 �C (30 s)

and 72 �C (60 s), followed by a final extension for 5 min

step at 72 �C. PCR products were analyzed by 1.5 %

agarose gel electrophoresis. Allele-specific PCR product

sizes for SNP rs2987983 were 180/258 bp (C/T),

156/212 bp (A/G) for rs3020450 and 231/193 bp (A/G) for

SNP rs3020449. As a quality control for genotyping, in

each PCR run three previously characterized DNA samples

representing the heterozygous and the two homozygous

genotypes were analyzed in addition to the unknown

samples.

Statistical analysis

Deviation from the Hardy–Weinberg equilibrium was

estimated by the Fisher’s exact test and the v2 test, and all

values were subjected to one-way ANOVA to achieve

homogeneity of variance. Statistical tests for association

(CI: 95 % confidence interval) and for significance were

carried out using SPSS for Windows 8.0 (SPSS, Inc.,

Chicago, IL, USA). P \ 0.05 was considered statistically

significant. After tests for deviation from Hardy–Weinberg

equilibrium were conducted, allele frequency, allele posi-

tivity and genotype frequencies were determined. Odds

ratio (OR) was calculated using the more frequent homo-

zygous genotypes as reference group.

Results

After genotyping of 135 women with endometrial cancer

and such as many women without any malignancy for

ESR2 SNPs rs2987983, rs3020450, and rs3020449 by

means of allele-specific tetra-primer PCR, we first per-

formed the test for deviation from Hardy–Weinberg equi-

librium, which showed negative results. The following tests

for association did not reveal any significant difference

between both groups with regard to genotype frequency,

allele frequency, or allele positivity of the three ERb SNPs

tested (Table 3).

Discussion

SNPs in genes of the steroid hormone metabolism or sig-

naling are potential factors that could affect cancer risk in

hormone-dependent tissues [17]. Since discovery of ESR2

gene and its product ERb in 1996, several groups have

characterized its unique expression profile, but few have

examined possible associations of ESR2 polymorphisms

with cancer risk. In previous studies, ESR2 SNPs were

demonstrated to be weakly associated with breast cancer,

prostate cancer, anorexia nervosa, bulimia, ovulatory dys-

function and bone mineral density [18–22].

Up to the present there are only two studies examining

the association of randomly chosen ESR2 SNPs and

endometrial cancer risk. In a recent report including 191

endometrial cancer patients, two ESR2 polymorphisms

(rs1255998 and rs944050) were found to be associated with

an increased risk of endometrial cancer [23]. In contrast,

another study examining the ESR2 SNPs rs1256049 and

Table 2 Primer sequences used

for allele-specific tetra primer

PCR

ERb SNP Primer Sequence

rs2987983 IP1 TCACAATTCAGGTAGAATTGGAATAATAAC

IP2 CCTGGTTTAATGCAGAGTGGAGATGA

OP1 ATTGTAGGATATTTTGGAGACAGGCAG

OP2 TTATTATACAAGGAAACCTCACTGCAGG

rs3020449 IP1 GCATTGTCCTTTTTACATATTGTTAGGGTA

IP2 AATTCTCAAGGAAATTTTAGCAAAGCC

OP1 TAGATTTTGTCAAACACTTTTGGTGGAT

OP2 CCAAATGATTAAGGAGAAATAACAGCAG

rs3020450 IP1 TAGTTTCCTTGTGTTCTCTGTTCTCTACG

IP2 GGGAGAAGAGAGCCCAGGATTTCGAT

OP1 CAACTAGGAAGTGTTTGTGCTGAAAACC

OP2 GTCTCTTCTGAATTACACAGGTGCATGG

Arch Gynecol Obstet (2014) 289:631–635 633

123

rs1271572 reported no association with endometrial cancer

risk [24].

Given that in ESR2 gene, no non-synonymous exon

SNPs exist which would lead to an altered amino acid

sequence of ERb protein; in this study, we decided to

specifically focus on a second type of polymorphisms

with potential functional significance, SNPs in the pro-

moter region of ESR2 gene (Fig. 1). The promoter region

of ESR2 gene is complex and consists of several tissue-

specific promoters and different 50-untranslated exons

[25]. One is at the beginning and thus we hypothesized

that SNPs located in this region could be able to affect

binding of enhancer or repressor proteins regulating

ESR2 gene transcription. Altered ERb protein levels

could then modulate estrogen effects on breast cancer

development. SNPs in the promoter regions of various

genes previously have been associated to the risk for

several diseases [26–29].

To the best of our knowledge, this report is the first one

analyzing the association of ESR2 promoter SNPs

rs2987983, rs3020449, and rs3020450 with endometrial

cancer risk. In contrast to the negative results of this study,

we previously found the CC genotype of SNP rs2987983 to

be weakly associated with breast cancer risk (OR 1.99)

[18]. The same polymorphism previously also was descri-

bed to be a risk factor for prostate cancer development

[22]. The observed lack of association in our endometrial

cancer collective might result from the smaller sample size

or could be explained by the fact that ERb is suggested to

play different roles in pathogenesis of breast and endo-

metrial cancer [6, 30].

In conclusion, our data clearly suggest that the tested

SNPs in the promotor region of human ESR2 gene are not

associated with the development of endometrial cancer.

Acknowledgments We would like to thank Helena Lowack for

excellent technical assistance.

Conflict of interest We declare that we have no conflict of interest.

References

1. Sorosky JI (2008) Endometrial cancer. Obstet Gynecol 111(2 Pt

1):436–447. doi:10.1097/AOG.0b013e318162f690

2. Ito K, Utsunomiya H, Yaegashi N, Sasano H (2007) Biological

roles of estrogen and progesterone in human endometrial carci-

noma—new developments in potential endocrine therapy for

endometrial cancer. Endocr J 54(5):667–679

3. Gustafsson JA (1997) Estrogen receptor beta—getting in on the

action? Nat Med 3(5):493–494

4. Skrzypczak M, Bieche I, Szymczak S, Tozlu S, Lewandowski S,

Girault I, Radwanska K, Szczylik C, Jakowicki JA, Lidereau R,

Kaczmarek L (2004) Evaluation of mRNA expression of estrogen

receptor beta and its isoforms in human normal and neoplastic

endometrium. Int J Cancer 110(6):783–787. doi:10.1002/ijc.20224

5. Collins F, MacPherson S, Brown P, Bombail V, Williams AR,

Anderson RA, Jabbour HN, Saunders PT (2009) Expression of

oestrogen receptors, ERalpha, ERbeta, and ERbeta variants, in

endometrial cancers and evidence that prostaglandin F may play a

role in regulating expression of ERalpha. BMC Cancer 9:330

6. Haring J, Skrzypczak M, Stegerer A, Lattrich C, Weber F, Gorse

R, Ortmann O, Treeck O (2012) Estrogen receptor beta transcript

variants associate with oncogene expression in endometrial can-

cer. Int J Mol Med 29(6):1127–1136. doi:10.3892/ijmm.2012.929

7. Erfani N, Razmkhah M, Talei AR, Pezeshki AM, Doroudchi M,

Monabati A, Ghaderi A (2006) Cytotoxic T lymphocyte antigen-

4 promoter variants in breast cancer. Cancer Genet Cytogenet

165(2):114–120. doi:10.1016/j.cancergencyto.2005.07.020

8. Harendza S, Lovett DH, Panzer U, Lukacs Z, Kuhnl P, Stahl RA

(2003) Linked common polymorphisms in the gelatinase a pro-

moter are associated with diminished transcriptional response to

estrogen and genetic fitness. J Biol Chem 278(23):20490–20499.

doi:10.1074/jbc.M211536200

9. Yang Q, Nakamura M, Nakamura Y, Yoshimura G, Suzuma T,

Umemura T, Tamaki T, Mori I, Sakurai T, Kakudo K (2002)

Correlation of prostate-specific antigen promoter polymorphisms

with clinicopathological characteristics in breast cancer. Anti-

cancer Res 22(3):1825–1828

10. Greenlee H, Chen Y, Kabat GC, Wang Q, Kibriya MG, Gurvich

I, Sepkovic DW, Bradlow HL, Senie RT, Santella RM, Ahsan H

(2007) Variants in estrogen metabolism and biosynthesis genes

and urinary estrogen metabolites in women with a family history

of breast cancer. Breast Cancer Res Treat 102(1):111–117.

doi:10.1007/s10549-006-9308-7

11. Crooke PS, Ritchie MD, Hachey DL, Dawling S, Roodi N, Parl

FF (2006) Estrogens, enzyme variants, and breast cancer: a risk

model. Cancer Epidemiol Biomark Prev 15(9):1620–1629.

doi:10.1158/1055-9965.EPI-06-0198 (A publication of the

American Association for Cancer Research, cosponsored by the

American Society of Preventive Oncology)

12. Zheng SL, Zheng W, Chang BL, Shu XO, Cai Q, Yu H, Dai Q,

Xu J, Gao YT (2003) Joint effect of estrogen receptor beta

sequence variants and endogenous estrogen exposure on breast

cancer risk in Chinese women. Cancer Res 63(22):7624–7629

Table 3 Test for phenotype–genotype association

SNP Allele

frequency

Allele

positivity

Genotype

frequency

rs2987983 T C T C TT CC CT

Controls 0.63 0.37 0.88 0.59 0.44 0.13 0.43

Cases 0.59 0.41 0.85 0.63 0.45 0.15 0.40

P NS NS NS

rs3020449 A G A G AA GG AG

Controls 0.57 0.43 0.81 0.81 0.34 0.19 0.47

Cases 0.57 0.43 0.67 0.67 0.35 0.20 0.45

P NS NS NS

rs3020450 A G A G AA GG AG

Controls 0.34 0.66 0.54 0.88 0.11 0.42 0.47

Cases 0.33 0.67 0.55 0.89 0.09 0.43 0.48

P NS NS NS

After tests for deviation from Hardy–Weinberg equilibrium were

conducted, allele frequency, allele positivity and genotype frequen-

cies were determined and v2 test was performed (controls: n = 135;

cases: n = 135)

634 Arch Gynecol Obstet (2014) 289:631–635

123

13. Schuit SC, de Jong FH, Stolk L, Koek WN, van Meurs JB,

Schoofs MW, Zillikens MC, Hofman A, van Leeuwen JP, Pols

HA, Uitterlinden AG (2005) Estrogen receptor alpha gene poly-

morphisms are associated with estradiol levels in postmenopausal

women. Eur J Endocrinol 153(2):327–334. doi:10.1530/eje.1.

01973

14. Tempfer CB, Schneeberger C, Huber JC (2004) Applications of

polymorphisms and pharmacogenomics in obstetrics and gyne-

cology. Pharmacogenomics 5(1):57–65. doi:10.1517/phgs.5.1.57.

25687

15. Gold B, Kalush F, Bergeron J, Scott K, Mitra N, Wilson K, Ellis

N, Huang H, Chen M, Lippert R, Halldorsson BV, Woodworth B,

White T, Clark AG, Parl FF, Broder S, Dean M, Offit K (2004)

Estrogen receptor genotypes and haplotypes associated with

breast cancer risk. Cancer Res 64(24):8891–8900. doi:10.1158/

0008-5472.CAN-04-1256

16. Ye S, Dhillon S, Ke X, Collins AR, Day IN (2001) An efficient

procedure for genotyping single nucleotide polymorphisms.

Nucleic Acids Res 29(17):E88

17. Cribb AE, Knight MJ, Dryer D, Guernsey J, Hender K, Tesch M,

Saleh TM (2006) Role of polymorphic human cytochrome P450

enzymes in estrone oxidation. Cancer Epidemiol Biomark Prev

15(3):551–558. doi:10.1158/1055-9965.EPI-05-0801 (A publica-

tion of the American Association for Cancer Research, cospon-

sored by the American Society of Preventive Oncology)

18. Treeck O, Elemenler E, Kriener C, Horn F, Springwald A,

Hartmann A, Ortmann O (2009) Polymorphisms in the promoter

region of ESR2 gene and breast cancer susceptibility. J Steroid

Biochem Mol Biol 114(3–5):207–211. doi:10.1016/j.jsbmb.2009.

02.012

19. Ogawa S, Hosoi T, Shiraki M, Orimo H, Emi M, Muramatsu M,

Ouchi Y, Inoue S (2000) Association of estrogen receptor beta

gene polymorphism with bone mineral density. Biochem Biophys

Res Commun 269(2):537–541. doi:10.1006/bbrc.2000.2285

20. Forsti A, Zhao C, Israelsson E, Dahlman-Wright K, Gustafsson

JA, Hemminki K (2003) Polymorphisms in the estrogen receptor

beta gene and risk of breast cancer: no association. Breast Cancer

Res Treat 79(3):409–413

21. Maguire P, Margolin S, Skoglund J, Sun XF, Gustafsson JA,

Borresen-Dale AL, Lindblom A (2005) Estrogen receptor beta

(ESR2) polymorphisms in familial and sporadic breast cancer.

Breast Cancer Res Treat 94(2):145–152. doi:10.1007/s10549-

005-7697-7

22. Thellenberg-Karlsson C, Lindstrom S, Malmer B, Wiklund F,

Augustsson-Balter K, Adami HO, Stattin P, Nilsson M, Dahlman-

Wright K, Gustafsson JA, Gronberg H (2006) Estrogen receptor

beta polymorphism is associated with prostate cancer risk. Clin

Cancer Res 12(6):1936–1941. doi:10.1158/1078-0432.CCR-05-

0269 (An official journal of the American Association for Cancer

Research)

23. Ashton KA, Proietto A, Otton G, Symonds I, McEvoy M, Attia J,

Gilbert M, Hamann U, Scott RJ (2009) Estrogen receptor poly-

morphisms and the risk of endometrial cancer. BJOG Int J Obstet

Gynaecol 116(8):1053–1061. doi:10.1111/j.1471-0528.2009.

02185.x

24. Setiawan VW, Hankinson SE, Colditz GA, Hunter DJ, De Vivo I

(2004) Estrogen receptor beta (ESR2) polymorphisms and

endometrial cancer (United States). Cancer Causes Control

15(6):627–633. doi:10.1023/B:CACO.0000036170.28502.5f

25. Li LC, Yeh CC, Nojima D, Dahiya R (2000) Cloning and char-

acterization of human estrogen receptor beta promoter. Biochem

Biophys Res Commun 275(2):682–689. doi:10.1006/bbrc.2000.

3363

26. Lee JH, Kim Y, Choi JW, Kim YS (2013) Clinicopathological

significance of plasminogen activator inhibitor-1 promoter 4G/5G

polymorphism in breast cancer: a meta-analysis. Arch Med Res.

doi:10.1016/j.arcmed.2012.12.002

27. Chen J, Liu RY, Yang L, Zhao J, Zhao X, Lu D, Yi N, Han B,

Chen XF, Zhang K, He J, Lei Z, Zhou Y, Pasche B, Li X, Zhang

HT (2012) A two-SNP IL-6 promoter haplotype is associated

with increased lung cancer risk. J Cancer Res Clin Oncol

139(2):231–242. doi:10.1007/s00432-012-1314-z

28. Braunagel D, Schaich M, Kramer M, Dransfeld CL, Ehninger G,

Mahlknech U (2011) A NME1 promoter SNP predicts Ara-C

associated neurotoxicity in AML patients. Leuk Lymphoma.

doi:10.3109/10428194.2011.610015

29. Nicodemus KK, Law AJ, Luna A, Vakkalanka R, Straub RE,

Kleinman JE, Weinberger DR (2009) A 50 promoter region SNP

in NRG1 is associated with schizophrenia risk and type III iso-

form expression. Mol Psychiatry 14(8):741–743. doi:10.1038/mp.

2008.150

30. Haring J, Schuler S, Lattrich C, Ortmann O, Treeck O (2012)

Role of estrogen receptor beta in gynecological cancer. Gynecol

Oncol 127(3):673–676. doi:10.1016/j.ygyno.2012.09.006

Arch Gynecol Obstet (2014) 289:631–635 635

123