Persistência de plasmídeos que codificam carbapenemases do tipo ...

Click here to load reader

  • date post

    08-Jan-2017
  • Category

    Documents

  • view

    214
  • download

    1

Embed Size (px)

Transcript of Persistência de plasmídeos que codificam carbapenemases do tipo ...

  • UNIVERSIDADE DE SO PAULO

    FACULDADE DE CINCIAS FARMACUTICAS

    Programa de Ps-Graduao em Farmcia

    rea de Anlises Clnicas

    Persistncia de plasmdeos que codificam carbapenemases do tipo New-Delhi-

    Metalo--Lactamase

    Bruna Mara Silva Seco

    Dissertao para obteno do grau de

    MESTRE

    Orientador:

    Prof. Dr. Jorge Luiz Mello Sampaio

    So Paulo

    2016

  • Bruna Mara Silva Seco

    Persistncia de plasmdeos que codificam carbapenemases do tipo New-Delhi-

    Metalo--Lactamase

    Dissertao apresentada Faculdade

    de Cincias Farmacuticas da

    Universidade de So Paulo para

    obteno do grau de MESTRE.

    Orientador:

    Prof. Dr. Jorge Luiz Mello Sampaio

    So Paulo

    2016

  • Ficha Catalogrfica

    Elaborada pela Diviso de Biblioteca e

    Documentao do Conjunto das Qumicas da USP.

    Seco, Bruna Mara Silva

    S445p Persistncia de plasmdeos que codificam carbapenemases do

    tipo New-Delhi-Metalo--Lactamase / Bruna Mara Silva Seco. --

    So Paulo, 2016.

    103p.

    Dissertao (mest rado) - Faculdade de Cincias Farmacuticas

    da Univers idade de So Paulo. Departamento de Anlises Clnicas

    e Toxicolgicas.

    Orientador: Sampaio, Jorge Luiz Mello

    1 . Droga : Resistncia em microorganismo : Microbiologia

    mdica I . T . I I . Sampaio, Jorge Luiz Mello , or ientador .

    616.01 CDD

  • FOLHA DE APROVAO

    Bruna Mara Silva Seco

    Persistncia de plasmdeos que codificam carbapenemases do tipo New-Delhi-

    Metalo--Lactamase

    Comisso Julgadora da

    Dissertao para obteno do grau de Mestre

    ____________________________________

    Prof. Dr. Jorge Luiz Mello Sampaio

    Orientador / Presidente

    ____________________________________

    1 examinador

    ____________________________________

    2 examinador

    So Paulo, ____ de _____________ de 2016.

  • DEDICO ESTE TRABALHO...

    minha me, que mesmo presente em alma, me incentivou a estudar e a lutar por

    objetivos maiores.

    Ao meu pai, que acredita em minhas aes e me incentiva a continuar.

    minha madrasta, que em momentos de dificuldade soube me ajudar a encontrar o

    equilbrio.

    minha av, que me criou e educou para a vida.

    Aos meus irmos, pelo amor infinito, mesmo durante a distncia.

    Ao meu namorado, pelo amor necessrio em momentos de dificuldade.

    Ao meu orientador, Jorge Sampaio, pela dedicao, ensinamentos e pacincia.

  • AGRADEO...

    Deus, pela sabedoria, fora e a vida.

    Aos meus familiares, pelo apoio, compreenso e incentivo em todos os momentos da

    minha vida. Sem vocs eu no teria conseguido chegar onde estou. Amo vocs!

    Ao Prof. Dr. Jorge Sampaio, uma pessoa de carter incontestvel. Agradeo pela

    oportunidade e pela confiana em meu potencial. Obrigada por acreditar em mim e por

    me ajudar em meu amadurecimento profissional. Minha eterna gratido.

    tcnica, Fabiana Teixeira, pelo auxlio no projeto, conversas diversas e amizade.

    Aos meus amigos do Laboratrio de Microbiologia Clnica, pela descontrao,

    debates cientficos e auxlio no trmino deste projeto de pesquisa. Cito-os: Juliana,

    Mayne, Flvia, Darlan, Elaine, Hadassa, Letcia.

    Ao Instituto Fleury por disponibilizar os isolados e pelo financiamento do projeto de

    pesquisa, sem os quais este estudo no seria possvel.

    Ao Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico (CNPq) pela

    bolsa oferecida.

  • The important thing is to not stop

    questioning. Curiosity has its own reason

    for existence. One cannot help but be in

    awe when he contemplates the mysteries of

    eternity, of life, of the marvelous structure of

    reality. It is enough if one tries merely to

    comprehend a little of this mystery each

    day.

    Albert Einstein

  • NORMALIZAO ADOTADA

    Esta dissertao est de acordo com as seguintes normas, em vigor no momento desta

    publicao:

    Universidade de So Paulo. Sistema Integrado de Bibliotecas. Diretrizes para

    apresentao de dissertaes e teses da USP: documento eletrnico e impresso - Parte

    I (ABNT). Elaborado por Vnia Martins Bueno de Oliveira Funaro e colaboradores. 2 ed.

    revisada e ampliada. So Paulo, 2009.

  • RESUMO

    SECO, B.M.S., 2016. Persistncia de plasmdeos que codificam carbapenemases

    do tipo New-Delhi-Metalo--Lactamase. Dissertao (Mestrado) Faculdade de

    Cincias Farmacuticas, Universidade de So Paulo, So Paulo, 2016.

    As metalo--lactamases (MBL) so capazes de hidrolisar os carbapenmicos, a classe

    de antimicrobianos com maior potncia para o tratamento de infeces graves e de maior

    uso clinico. Dentre as MBL, o grupo mais recentemente descrito e que apresentou rpida

    disseminao em todo o mundo o da New-Delhi-Metalo- -lactamases (NDM). Nas

    enterobactrias, os genes que codificam essas enzimas esto mais frequentemente

    localizados em plasmdeos. O estudo da estabilidade de plasmdeos que albergam o

    gene blaNDM-1 importante para entender a predominncia de espcies que carregam

    esses plasmdeos, desvendar mecanismos moleculares envolvidos na sua persistncia

    e para desenvolver novas drogas que possam diminuir a sua persistncia. Estudos

    recentes sobre estabilidade plasmidial evidenciaram que a maprotilina capaz de induzir

    perda plasmidial de at 90% em E. coli K12. Neste trabalho, foi estudado o efeito da

    maprotilina na induo de cura de plasmdeos, que albergam o gene blaNDM-1, em

    diferentes espcies da famlia Enterobacteriaceae. Nove isolados pertencentes a

    diferentes espcies foram includas no estudo. Os plasmdeos foram caracterizados

    quanto ao seu tamanho por eletroforese e por sequenciamento de DNA no sistema

    Illumina. A persistncia plasmidial foi determinada pelo mtodo de contagem em placa

  • em LB gar com e sem tratamento com maprotilina em concentraes sub-inibitrias

    (50mg/L). O experimento foi conduzido por 10 dias, representando aproximadamente

    100 geraes. Neste estudo evidenciou-se que o grupo das enterobactrias esto

    envolvidas na disseminao de plasmdeos com blaNDM-1, sendo que plasmdeos do

    grupo IncF esto mais relacionados a essa disperso. A maprotilina teve efeito de cura

    plasmidial em todos os isolados exceto em E. hormaechei subsp. oharae e C. freundii.

    O isolado P. rettgeri apresentou maior taxa de perda plasmidial e a anlise comparativa

    da sequncia nucleotdica do plasmdeo indicou que a presena da IS5 pode estar

    relacionada com a diminuio da persistncia plasmidial. Diferenas na persistncia

    plasmidial, quando tratados com maprotilina, entre E. hormaechei subsp. steigerwaltii

    e E. hormaechei subsp. oharae sugerem que E. hormaechei subsp. oharae pode ser

    um possvel disseminador de plasmdeos albergando blaNDM-1, devido a processos de

    adaptao co-evolutivos.

    Palavras-chaves: Enterobacteriaceae, blaNDM-1, carbapenemase, plasmdeo,

    maprotilina.

  • ABSTRACT

    SECO, B.M.S., Persistence of plasmids that encodes New-Delhi-Metalo--

    lactamase Thesis (Masters degree) School of Pharmacy, So Paulo University, So

    Paulo, 2016.

    Metallo- -lactamases (MBL) are able to hydrolase carbapenems, an antimicrobial class

    in clinical use with high potency in the treatment of severe infections. The most recently

    decribed group of MBL is the New-Delhi-Metallo--lactamases (NDM). This group is

    mostly correlated to the spread of resistance mediated by plasmid in Enterobacteriaceae.

    Understanding the plasmid persistence pattern is important in order to understand the

    predominance of a given species related to antimicrobial resistance plasmids spread, to

    unveil molecular mechanisms involved in the increase of plasmid persistence and to

    develop new drugs which could decrease its persistence. Recent studies have associated

    maprotiline to a decrease in 90% of plasmid persistence in E. coli K12. In this work, we

    evaluated the effect of maprotiline in curing plasmids carrying blaNDM-1 in different species

    of Enterobacteriaceae. Nine isolates belonging to different species were evaluated.

    Plasmids were characterized by agarose gel electrophoresis and by DNA sequencing

    with Illumina platform. The plate counting method was used to determine plasmid

    persistence, with and without sub-inhibitory (50 mg/L) concentration of maprotiline during

    10 days, representing approximately 100 generations. We found that Enterobacteriaceae

    are involved in the spread of NDM-1 plasmid-mediate resistance and the IncF group is

    the plasmid incompatibility group more frequently involved in this dissemination.

  • Maprotiline showed a plasmid-curing effect in all isolates, except against plasmids of E.

    hormaechei subsp. oharae and C. freundii. The P. rettgeri isolate had the highest

    plasmid-curing rate. Sequencing analysis revealed an IS5 in the plasmid, which could be

    associated to a decrease in plasmid persistence. The difference between plasmid

    persistence pattern of plasmids isolated from E. hormaechei subsp. steigerwaltii and E.

    hormaechei subsp. oharae, when treated with maprotiline, suggest that E. hormaechei

    subsp. oharae, could be associated to the spread of plasmids carrying blaNDM-1 due to

    co-evolution adaptation.

    Keywords: Enterobacteriacea, blaNDM-1, carbapenemase, plasmid, maprotiline

  • SUMRIO

    1 INTRODUO 13

    1.1 Importncia Clnica 13

    1.2 Antimicrobianos -lactmicos: mecanismos de ao e resistncia 14

    1.3 -lactamases 17

    1.3.1 Nova-Deli-Metalo--lactamase (NDM) 20

    1.4 Plasmdeos e a disseminao da resistncia aos antimicrobianos 25

    1.5 Persistncia plasmidial: mecanismos moleculares 28

    1.5.1 Conjugao 28

    1.5.2 Replicao plasmidial 30

    1.5.3 Segregao plasmidial 32

    1.5.4 Sistema toxina-antitoxina 34

    1.5.5 Inseres e delees gnicas 35

    1.6 Grupos de Incompatibilidade 37

    1.7 Cura plasmidial 39

    2 JUSTIFICATIVA 41

    3 OBJETIVOS 42

    3.1 Objetivos Geral 42

    3.2 Objetivos Especficos 42

    4 MATERIAL E MTODOS 43

    4.1 Amostras bacterianas 43

    4.2 Extrao de DNA genmico 43

    4.3 Identificao de espcies bacterianas 44

    4.4 Deteco do gene blaNDM-1 44

    4.5 Preparo de clulas eletrocompetentes 45

    4.6 Extrao de DNA plasmidial 46

  • 4.7 Transformao em Escherichia coli TOP10 por eletroporao 47

    4.8 Perfil plasmidial dos isolados bacterianos 47

    4.9 Sequenciamento de plasmdeos 48

    4.10 Anlise do sequenciamento 48

    4.11 Determinao de grupos de incompatibilidade 49

    4.12 Ensaios de persistncia plasmidial 49

    4.13 Anlise de dados dos ensaios de persistncia plasmidial 51

    4.14 Teste de Susceptibilidade a Maprotilina 52

    4.15 Avaliao do efeito da maprotilina no crescimento celular 52

    5 RESULTADOS 53

    5.1 Isolados bacterianos 53

    5.2 Amostras albergam o gene blaNDM-1 54

    5.3 Plasmdeos carregam o gene blaNDM-1 54

    5.4 Maprotilina no afeta parmetros do crescimento bacteriano 57

    5.5 Persistncia plasmidial 59

    5.6 Plasmdeo de menor persistncia possui uma sequncia de insero

    a mais do que plasmdeos de alta persistncia 62

    5.7 Grupos de Incompatibilidade 66

    6 DISCUSSO 68

    7 CONCLUSES 76

    REFERNCIAS 78

  • 13 Introduo SECO, B.M.S.

    1. INTRODUO

    1.1 Importncia Clnica

    As betalactamases so enzimas que conferem resistncia aos antimicrobianos -

    lactmicos e so frequentemente detectadas em espcies da famlia

    Enterobacteriaceae. Dentre as betalactamases, as de maior importncia clnica so as

    carbapenemases, por degradarem a classe mais utilizada no tratamentoemp[irico das

    infeces graves por bacilos Gram-negativos: os carbapenmicos. As espcies que

    expressam esse mecanismo de resistncia, mais frequentemente isoladas em amostras

    de origem clnica, so Klebsiella pneumoniae, Escherichia coli e Enterobacter spp.

    (CUZON et al., 2010; RUBIN et al., 2014; ZUJIC ATALIC et al., 2014a;2014b).

    Geralmente esto associadas a infeces do trato urinrio, pneumonia nosocomial e

    infeces intra-abdominais em todo o mundo (CALLEFI; MEDEIROS; FURTADO, 2013;

    NORDMANN; NAAS; POIREL, 2011).

    Isolados produtores de carbapenemases so parte de um grande grupo

    designado ERC (Enterobactrias Resistentes aos Carbapenmicos). As ERC so

    consideradas o maior problema de Unidades de Tratamento Intensivo (UTI) em todo o

    mundo, em funo da expresso simultnea de outros mecanismos de resistncia aos

    antimicrobianos (CALLEFI et al., 2013; LIVERMORE, 2012).

    A alta resistncia aos antimicrobianos est relacionada principalmente com a

    disperso e transferncia de plasmdeos que albergam genes de resistncia do tipo

    blaNDM, ou blaKPC alm de outros genes que conferem resistncia a diferentes classes de

  • 14 Introduo SECO, B.M.S.

    antimicrobianos como fluorquinolonas, aminoglicosdeos, cloranfenicol ou rifampicina.

    Isso resulta em um fentipo de multirresistncia e num grande problema quanto

    escolha do tratamento emprico das infeces causadas por esses microrganismos, j

    que os carbapenmcios so os antimicrobianos como maior espectro e potncia

    atualmente disponveis para uso clnico (CANTON et al., 2012; RUBIN et al., 2014).

    H tambm uma grande preocupao sobre o controle da disseminao da

    resistncia aos carbapenmicos no ambiente, sendo que uma mobilizao para a

    reduo da colonizao do trato digestrio de pacientes que no esto em uso de

    antimicrobiano poderia secundariamente reduzir sua disseminao no meio ambiente e

    no ambiente hospitalar (WOODFORD et al., 2014).

    1.2 Antimicrobianos -lactmicos: mecanismos de ao e resistncia

    Penicilina, cefalosporinas de 1, 2, 3 e 4 geraes, oxacilinas e carbapenmicos

    so exemplos de frmacos pertencentes classe dos antimicrobianos -lactmicos.

    So amplamente utilizados na prtica clnica em todo o mundo, pois apresentam dois

    fatores importantes: alta eficcia e baixa toxicidade (NIKAIDO, 2009; PATERSON,

    2006).

    O mecanismo de ao desta classe de antimicrobianos a inibio de

    transpeptidases (Figura 1) que desempenham um papel essencial na sntese da parede

    celular bacteriana. As transpeptidases so um importante alvo teraputico por no haver

    homlogos em eucariotos. So comumente nomeadas de protenas ligadoras de

    penicilina (PBPs), dada a importncia como alvo teraputico. Essas enzimas tem

  • 15 Introduo SECO, B.M.S.

    importante funo na transpeptidao e transglicosilao durante a sntese do

    peptidoglicano (SAMPAIO, 2007).

    Figura 1. Mecanismo de ao dos antimicrobianos -lactmicos. 1- Enzima transpeptidase (cinza) com

    seu stio ativo livre. 2- Transpeptidase realizando a sntese da parede celular. 3- Antimicrobiano -

    lactmico ligando-se no stio ativo da transpeptidase. 4- Antimicrobiano -lactmico bloqueando a entrada

    de cadeias polipeptdicas do NAM e NAG no stio ativo da enzima, interrompendo a transpeptidao da

    cadeia causando falha na produo de parede celular e posteriormente morte celular. Figura modificada

    de Wikimedia Commons: (domnio pblico).

    Para atingir o espao periplasmtico, no qual esto localizadas as PBPs, os -

    lactmicos utilizam principalmente protenas de membrana que formam canais de

    transporte: as porinas (WINN, 2001). Uma vez no espao periplasmtico, o agente -

    lactmico, o qual constitui um anlogo estereoqumico do segmento ativo das PBPs,

    liga-se ao stio ativo dessas enzimas tornando-as indisponveis para a sntese da

    camada de peptidoglicano da clula bacteriana. Como a atividade das hidrolases para

    o remodelamento da parede contnuo, h uma desestruturao da camada de

    peptidoglicano em funo da falha da atividade de sntese pelas transpeptidases

    (SAMPAIO, 2007).

    Os carbapenmicos, foco deste estudo, so produzidos por diferentes espcies

    de Streptomyces e constituem uma subclasse de antimicrobianos -lactmicos

  • 16 Introduo SECO, B.M.S.

    derivados do ncleo carbapenmico (TAVARES, 1996). Em 1979, um derivado estvel

    foi isolado e tornado disponvel comercialmente, denominado inicialmente de N-

    formimidoil-tienamicina, atualmente, conhecido como imipenem. A grande desvantagem

    deste frmaco a de sofrer hidrlise do anel -lactmico por uma enzima renal, a

    dipeptidase, o que reduz significativamente a meia-vida do frmaco. Na tentativa de

    diminuir a ao desta enzima, a cilastatina foi descoberta e resolveu esta questo pela

    sua alta afinidade com a dipeptidase, impedindo o metabolismo renal do imipenem,

    podendo o mesmo atingir alta concentrao urinria. Assim, a apresentao

    farmacolgica disponvel do imipenem associada cilastatina (TAVARES, 1996).

    Posteriormente novos frmacos deste grupo foram descobertos e apresentam

    uma vantagem sobre o imipenem: no precisam ser associados cilastatina, pois sua

    molcula possui um radical metila, associado ao carbono 1, que a protege da ao da

    dipeptidase renal. Esses antimicrobianos possuem atividade bactericida contra uma

    ampla gama de microrganismos. Seu espectro antimicrobiano abrange Enterobactrias,

    bacilos Gram-negativos no fermentadores e anaerbios, esporulados ou no

    (PFALLER; JONES, 1997).

    O aumento do uso desses antimicrobianos como primeira linha de tratamento

    contra infeces graves, particularmente aquelas causadas por enterobactrias

    produtoras de betalactamases de espectro ampliado (ESBL) contribuiu como presso

    seletiva para disseminao de bacilos Gram-negativos resistentes aos carbapenmicos.

    Esse efeito pode ser explicado pelo processo evolutivo no qual podem favorecer a

    predominncia, em uma determinada populao bacteriana, de fentipos resistentes

    aos carbapenmicos derivados de fenmenos como mutaes pontuais conjugao,

  • 17 Introduo SECO, B.M.S.

    recombinao, transposies e integrao de elementos genticos (NIKAIDO, 2009).

    Esses novos genes podem estar localizados tanto em cromossomos bacterianos como

    em plasmdeos ou transpsons.

    Basicamente existem quatro mecanismos pelos quais bactrias tornam-se

    resistentes aos antimicrobianos: (1) modificao do canal de entrada; (2) modificao

    da protena alvo; (3) aumento da expresso de bombas de efluxo; (4) produo de

    enzimas que degradam o antimicrobiano, essas conhecidas como -lactamases. O

    mecanismo de resistncia aos carbapenmicos mais frequente e mais eficiente em

    enterobactrias a produo de -lactamases. Nas enterobactrias a localizao

    dessas enzimas no espao periplasmtico aumenta sua eficincia (BUSH, 2001).

    1.3 -lactamases

    Uma vez que -lactmicos so produzidos por microrganismos no ambiente, a

    produo de -lactamases por outras bactrias representa uma vantagem competitiva

    em nichos ecolgicos. Essas enzimas so codificadas por genes presentes em

    cromossomos ou plasmdeos. A mobilidade gnica pode ainda ser aumentada por meio

    de transpsons, genes saltadores que fazem a transferncia de genes cromossmicos

    para plasmdeos, e a partir destes, so disseminados em uma populao bacteriana

    (BUSH; JACOBY, 2010).

    Diferentes enzimas j foram descritas e so atualmente classificados por

    diferentes autores de acordo com estrutura molecular ou substrato preferencial entre o

    grupo das penicilinas, oxacilinas, carbapenmicos, cefalosporinas de espectro ampliado

  • 18 Introduo SECO, B.M.S.

    e a susceptibilidade inibio por clavulanato. Segundo Ambler, as enzimas so

    classificadas nos grupos A, B, C ou D com base na estrutura molecular e homologia na

    sequncia dos aminocidos (AMBLER, 1980). Entretanto, Bush e Jacob dividem essas

    enzimas de acordo com seu grupo funcional e perfil inibitrio (BUSH, 2013).

    A classe B de Ambler engloba as enzimas que possuem zinco em seu stio ativo

    e so frequentemente isoladas de Pseudomonas aeruginosa, Acinetobacter spp. e

    Enterobactrias. As outras classes A, C ou D de Ambler apresentam um resduo de

    serina no seu stio ativo e so isoladas principalmente de enterobactrias e Acinetobacter

    spp (BUSH, 2013).

    Figura 2. Classificao das enzimas -lactamases. Classes moleculares foram baseadas na

    nomenclatura de Ambler. Grupos funcionais foram baseados na nomenclatura proposta por Bush.

    Abreviaes: AC- cido Clavulnico, EDTA- cido etilenodiamino tetra-actico. Modificado de (BUSH,

    2013).

  • 19 Introduo SECO, B.M.S.

    A classe C de Ambler (grupo 1 de Bush) corresponde ao grupo das

    cefalosporinases que hidrolisam todos os betalactmicos exceto carbapenmicos, e que

    no so inibidas pelo cido clavulnico, um inibidor de -lactamases. Como principais

    enzimas observamos a AmpCs (BUSH, 2013).

    Na classe A de Ambler (grupo 2 de Bush) foram includas uma grande variedade

    de enzimas que se dispem em vrios subgrupos de acordo com o seu perfil de

    substrato, como KPC, SME, GES e as -lactamases de espectro estendido (ESBLs). As

    ESBLs hidrolisam cefalosporinas e monobactmicos, mas no cefamicinas ou

    carbapenmicos (BUSH, 2013).

    As oxacilinases da classe D de Ambler (grupo 2 de Bush) tambm hidrolisam

    antimicrobianos carbapenmicos, porm sua prevalncia em Enterobactrias inferior

    quela observada em Acinetobacter spp. Essas enzimas frequentemente so

    codificadas por genes inseridos em plasmdeos (BUSH, 2013).

    Na classe B de Ambler (grupo 3 de Bush) esto includas as metalo--lactamases

    (MBLs), enzimas capazes de hidrolisar os carbapenmicos e por isso designadas

    tambm de carbapenemases. Ao contrrio das carbapenemases includas em outros

    grupos, as metalo-betalactamases no so inibidas pelos inibidores de betalactamases

    atualmente em uso clnico e no hidrolisam os monobactmicos; entretanto so inibidas

    por quelantes de ctions divalentes, a exemplo do EDTA ou do cido dipicolnico

    (KIMURA; ISHII; YAMAGUCHI, 2005), sendo isoladas principalmente em

    Enterobactrias e Acinetobacter spp. (BUSH, 2013).

  • 20 Introduo SECO, B.M.S.

    1.3.1 New Delhi Metalo -lactamase (NDM)

    As enzimas do tipo NDM possuem duas molculas de zinco no seu stio ativo, por

    isso so classificadas dentro do grupo B de Ambler como Metalo -lactamase (MBL)

    (AMBLER, 1980). Seu primeiro relato no mundo ocorreu na cidade de New Delhi na ndia,

    em um paciente apresentando abcesso glteo. Esse paciente retornou para Sucia, local

    de residncia, na qual uma cultura de urina evidenciou um isolado de Klebsiella

    pneumoniae resistente aos carbapenmicos e positivo para testes de MBL. Testes

    adicionais confirmaram a presena de um novo mecanismo de resistncia presente em

    um plasmdeo de aproximadamente 180 Kb (YONG et al., 2009). O nome da cidade de

    New Delhi mais a classe qual a enzima pertence deu ento origem ao seu nome: New

    Delhi Metalo -lactamase (NDM).

    A relevante importncia de patgenos produtores de NDM a de apresentar

    resistncia a mltiplos antimicrobianos, incluindo os novos inibidores de betalactamases,

    ativos contra KPC (BIEDENBACH et al., 2015; KUMARASAMY et al., 2010).

    O -lactmico aztreonam no consegue ser clivado por MBLs, pois no interage

    com o sitio ativo da enzima; desta forma pode apresentar atividade contra cepas

    produtoras de NDM se o isolado no possuir outros mecanismos de resistncia aos -

    lactmicos (LIVERMORE et al., 2011).

    Recentes estudos comparativos de modelos de susceptibilidade in vitro e in vivo

    sugerem que cafalosporinas de terceira gerao, como a ceftazidima, carbapenmicos

    e aztreonam associados ao avibactam podem ter atividade contra cepas produtoras de

  • 21 Introduo SECO, B.M.S.

    NDM no tratamento clnico, indicando uma discordncia com ensaios in vitro

    (ZMARLICKA; NAILOR; NICOLAU, 2015).

    . Aps seu primeiro isolamento, blaNDM foi identificado em diversas regies do mundo

    (Figura 3): Paquisto, Reino Unido (KUMARASAMY et al., 2010), Austrlia (POIREL et

    al., 2010), Dinamarca (HAMMERUM et al., 2010), Alemanha (GOTTIG et al., 2010),

    Cingapura (KOH et al., 2010), Taiwan (WU et al., 2010), Estados Unidos (CENTERS

    FOR DISEASE; PREVENTION, 2010), Frana (BIRGY et al., 2011), Blgica

    (BOGAERTS et al., 2011), China (CHEN, Y. et al., 2011), Itlia (D'ANDREA et al., 2011),

    frica do Sul (LOWMAN et al., 2011), Canad (PEIRANO et al., 2011), Marrocos

    (POIREL; BENOUDA; et al., 2011), Qunia (POIREL; SCHRENZEL; et al., 2011), Sua

    (POIREL; REVATHI; et al., 2011), Espanha (SOLE et al., 2011), Arglia (BOULANGER

    et al., 2012), Afeganisto (MCGANN et al., 2012), Repblica Checa (NEMEC; KRIZOVA,

    2012), Vietn (ISOZUMI et al., 2012), Crocia (MAZZARIOL et al., 2012), Irlanda

    (MCDERMOTT et al., 2012), Guatemala (PASTERAN et al., 2012),Turquia (POIREL;

    OZDAMAR; et al., 2012), Tailndia (RIMRANG et al., 2012), Rssia (BARANTSEVICH

    et al., 2013), Mxico (BARRIOS et al., 2013), Brasil (CARVALHO-ASSEF et al., 2013),

    Colmbia (ESCOBAR PEREZ et al., 2013), Israel (GEFEN-HALEVI et al., 2013), Grcia

    (GIAKKOUPI et al., 2013), Japo (NAKAZAWA et al., 2013), Romnia (SZEKELY et al.,

    2013), Imen (GHAROUT-SAIT et al., 2014), Portugal (MANAGEIRO et al., 2015), Corea

    (SUNG et al., 2015), Cuba (QUINONES et al., 2015), Egito (El-Sayed-Ahmed MA, 2015).

  • 22 Introduo SECO, B.M.S.

    O primeiro caso de NDM-1 no Brasil foi relatado no Rio Grande do Sul, sendo o

    isolado uma Providencia rettgeri, cultivado de um fragmento de tecido de um paciente

    diabtico com infeco no p (CARVALHO-ASSEF et al., 2013). Os relatos de caso de

    NDM em todo o mundo incluem isolados de pacientes que foram recentemente ndia

    ou Paquisto, mas tambm pacientes que nunca viajaram para fora de seu pas de

    origem ou tiveram contato com pessoas que previamente viajaram para o exterior. At o

    momento, 16 variantes da enzima j foram descritas (Tabela 1) e sua classificao

    baseada na composio dos aminocidos (JACOBY, 2014; YONG et al., 2009).

    Figura 3. Pases nos quais bactrias positivas para NDM foram reportadas, at o presente estudo.

  • 23 Introduo SECO, B.M.S.

    Tabela 1. Enzimas -lactamases do tipo NDM descritas at o presente estudo. Adaptado de

    (http://www.lahey.org/studies/other.asp, 2016).

    Gene

    Espcie

    N GenBank

    blaNDM-1 Klebsiella pneumoniae FN396876

    blaNDM-2 Acinetobacter baumannii JF703135

    blaNDM-3 Escherichia coli JQ734687

    blaNDM-4 Escherichia coli JQ348841

    blaNDM-5 Escherichia coli JN104597

    blaNDM-6 Escherichia coli JN967644

    blaNDM-7 Escherichia coli JX262694

    blaNDM-8 Escherichia coli AB744718

    blaNDM-9 Klebsiella pneumoniae KC999080

    blaNDM-10 Klebsiella pneumoniae KF361506

    blaNDM-11 Escherichia coli KP265939

    blaNDM-12 Escherichia coli AB926431

    blaNDM-13 Escherichia coli LC012596

    blaNDM-14 Acinetobacter lwoffii KM210087

    blaNDM-15 Escherichia coli KP735848

    blaNDM-16 Klebsiella pneumoniae KP86282

    O gene blaNDM tem sido comumente encontrado em plasmdeos da famlia IncL/M,

    IncA/C, IncF, IncHI1, IncN, IncK, IncX em Enterobactrias (CAMPOS et al., 2015;

    CARATTOLI, 2013), enquanto que em espcies de Acinetobacter baumanii o gene se

    encontra principalmente em cromossomo (CHEN, Y. et al., 2011) com apenas um caso

    relatado em plasmdeo at o momento (PILLONETTO et al., 2014). A disseminao

    deste gene por plasmdeos est associada a outras espcies deste gnero (FU et al.,

    2012; JOHNSON, A. P.; WOODFORD, 2013; YANG, J. et al., 2012).

    A caracterizao dos genes blaNDM e seu entorno mostra um quadro altamente

    complexo, pois blaNDM foi encontrado em uma grande variedade de espcies e gneros

    de bactrias Gram-negativas e em uma diversidade de clones em uma mesma espcie

    (JOHNSON, A. P.; WOODFORD, 2013). Alm disto, o gene blaNDM pode estar inserido

  • 24 Introduo SECO, B.M.S.

    entre duas repeties diretas do elemento ISAba125, formando um transpson composto

    (Tn125) (BONNIN et al., 2012; BOULANGER et al., 2012; ESPINAL et al., 2011;

    HRABAK et al., 2012; KAASE et al., 2011; KARTHIKEYAN; THIRUNARAYAN;

    KRISHNAN, 2010; PFEIFER et al., 2011; POIREL; BONNIN; et al., 2012), ou entre duas

    repeties do elemento IS3000, formando o transpson Tn3000 de aproximadamente

    11.000 pb (CAMPOS et al., 2015).

    O transpson Tn125 em isolados de A. baumannii e enterobactrias mostra a

    presena de um novo gene de resistncia denominado de bleMBL (gene ble associado

    com a metalo--lactamase NDM), que causa resistncia bleomicina. Os genes blaNDM

    e bleMBL so co-expressos pelo mesmo promotor localizado anteriormente ao gene

    blaNDM na extremidade ISAba125 (Figura 4B) (DORTET; NORDMANN; POIREL, 2012).

    O transpson Tn3000 possui duas cpias da IS3000. A primeira cpia trunca a

    poro 5 da ISAba125 acima da posio do gene blaNDM-1. O gene bleMBL est presente

    subsequente ao gene blaNDM-1 seguido dos genes que codificam a isomerase

    fosforibosilantranilato (trpF), a protena sinalizadora da translocao da twin-arginina

    (tat), o gene da protena divalente tolerante a ferro (cutA1), o gene do groEL e groES,

    que tambm fazem parte da estrutura do Tn125. Entretanto, o gene groEL encontra-se

    truncado na poro 3 da segunda cpia do IS3000 (Figura 4A) (CAMPOS et al., 2015).

    Dessa forma, evidente que elementos mveis como plasmdeos e transpsons

    esto envolvidos na disperso deste mecanismo de resistncia, e esta disperso ocorre

    entre diferentes grupos de bactrias (CAMPOS et al., 2015; DORTET et al., 2012).

  • 25 Introduo SECO, B.M.S.

    1.4 Plasmdeos e a disseminao da resistncia aos antimicrobianos

    A rpida disperso de genes de resistncia entre gneros e espcies bacterianas,

    via plasmdeos uma grande ameaa sade humana, pois limita extremamente o

    nmero de opes teraputicas. Na maioria dos pases o problema tem grande impacto

    na terapia emprica de infeces relacionadas aos cuidados com a sade, em funo

    das altas taxas de resistncia observadas em patgenos hospitalares (EGGLESTON;

    ZHANG; ZECKHAUSER, 2010; GILLINGS, 2013; NORMARK; NORMARK, 2002;

    PEREIRA et al., 2013; PERRY; WRIGHT, 2013).

    Plasmdeos so elementos genticos com sistema de controle de replicao

    independentemente do DNA cromossmico. Os plasmdeos podem ser classificados em

    dois grandes grupos principais: conjugativos e no conjugativos. Os conjugativos

    apresentam em seu arcabouo genes que codificam toda a maquinaria necessria para

    Tn125

    Tn3000

    A

    B

    pEh1A

    pNDM-BJ01

    Figura 4. Tranpsons que albergam gene blaNDM-1 (seta). A- Transpson Tn3000 do plasmdeo phE1A

    isolado de E. hormaechei do Rio de Janeiro. B- Transpson Tn125 encontrado em cromossomo de

    Acinetobacter lwoffii e que tambm faz parte de estrutura de plasmdeos que albergam o gene blaNDM-1.

    Modificado de (CAMPOS et al., 2015; SUN et al., 2015).

  • 26 Introduo SECO, B.M.S.

    sua prpria transferncia, e isso extremamente importante para a troca de genes entre

    bactrias de diferentes classes ou filogeneticamente distantes. Esse processo de

    transferncia horizontal denominado conjugao (DE LA CRUZ et al., 2010; DIONISIO

    et al., 2002; GROHMANN; MUTH; ESPINOSA, 2003; SMILLIE et al., 2010).

    A aquisio de genes de resistncia por transferncia horizontal entre bactrias

    um mecanismo que ocorre naturalmente nos diferentes microbiomas. Quando somado

    presso seletiva pelo uso de antimicrobianos, atua como uma eficiente ferramenta de

    sobrevivncia de patgenos, particularmente os bacilos Gram-negativos, na qual a

    resistncia a mltiplos antibiticos principalmente transferida por plasmdeos

    (BARLOW, 2009; MATHERS et al., 2011).

    Um dos fatores que contribuem para a disseminao de cepas resistentes a

    mltiplos antimicrobianos a estabilidade dos diferentes plasmdeos nas diferentes

    espcies bacterianas. A interferncia de condies ambientais que podem afetar a

    persistncia de plasmdeos na ausncia de antibiticos ainda no est clara entre os

    diversos grupos (SMILLIE et al., 2010). Estudos mostraram que a frequncia de

    resistncia aos antibiticos em populaes bacterianas, na ausncia de seleo com

    antibiticos, reduzida rapidamente. Entretanto outros estudos mostram que nem

    sempre essa reduo ocorre (DE GELDER et al., 2007; DE GELDER et al., 2005; DE

    GELDER et al., 2008; DIONISIO et al., 2005; PONCIANO et al., 2007).

    A persistncia plasmidial em populaes bacterianas est relacionada a trs

    fatores principais: (1) a estabilidade na transferncia do plasmdeo durante a diviso

    celular; (2) a reinfeco de indivduos atravs da conjugao de plasmdeos que so

    transferveis em segregantes que no possuem plasmdeo; (3) a competio entre

  • 27 Introduo SECO, B.M.S.

    clulas com plasmdeos e clulas sem plasmdeos, nas quais as clulas com plasmdeos

    so desfavorecidas na ausncia de seleo devido ao custo metablico da manuteno

    do plasmdeo, afetando seu estabelecimento na populao (Figura 5) (BERGSTROM;

    LIPSITCH; LEVIN, 2000; SLATER et al., 2008).

    Esses fatores so comandados por pelo menos quatro mecanismos moleculares,

    entre eles: eficincia na replicao do plasmdeo, resoluo de problemas de plasmdeos

    Figura 5. O estabelecimento plasmidial em uma populao bacteriana dependente da combinao de dois processos

    de transmisso: a- vertical b-horizontal; e processos de presso seletiva (c e d). Plasmdeos sero mantidos em uma

    populao se a taxa de perda via segregacional (a) e o efeito negativo no crescimento da clula hospedeira causado pelo

    custo metablico para manuteno do plasmdeo na ausncia de seleo (c), for igual taxa de transmisso via horizontal

    (b) e efeito positivo no crescimento de clulas hospedeiras que albergam de plasmdeo que conferem benefcio fenotpico

    na presena de seleo. Modificado de (SLATER et al., 2008).

    a) Segregao vegetativa b) Transferncia horizontal

    c) Reduo da transferncia vertical d) Aumento da transferncia vertical

    Aumento da presso seletiva seleciona plasmdeos que codificam genes de resistncia resultando em aumento do nmero de clulas albergando plasmdeos.

    Diminuio da presso seletiva leva a um custo

    para a manuteno plasmidial, resultando em diminuio do crescimento

    das clulas.

    Nmero de plasmdeos na populao

    Diminuio Aumento

  • 28 Introduo SECO, B.M.S.

    conectados, eficincia na distribuio de plasmdeos funcionantes durante diviso celular

    e eliminao ps-segregacional de plasmdeos livres (SLATER et al., 2008).

    Estudos mostram que certos plasmdeos podem apresentar diferentes padres de

    estabilidade em diferentes bactrias Gram-negativas, e at mesmo entre diferentes

    cepas de mesma espcie (DE GELDER et al., 2007; SOTA et al., 2010). Os mecanismos

    pelos quais esses fatores atuam no esto bem definidos, porm sabe-se que interao

    plasmdeo-hospedeiro necessria para a manuteno da persistncia plasmidial (DE

    GELDER et al., 2008; SOTA et al., 2010).

    1.5 Persistncia plasmidial: mecanismos moleculares

    Existem mecanismos moleculares que modulam a persistncia plasmidial. Entre

    eles: conjugao, eficincia na replicao e segregao, fatores ps-segregacionais,

    inseres e delees gnicas, so de extrema importncia para a manuteno do

    plasmdeo, pois interferem diretamente na sua perpetuao em uma populao

    bacteriana (BERGSTROM et al., 2000; SLATER et al., 2008).

    1.5.1 Conjugao

    Conjugao um processo pelo qual o material gentico transferido de uma

    clula doadora para uma clula receptora. Essa transferncia exige uma sofisticada

    maquinaria gnica para garantir a mobilizao do DNA (DE LA CRUZ et al., 2010;

    GARCILLAN-BARCIA; FRANCIA; DE LA CRUZ, 2009; KLIMKE; FROST, 1998).

  • 29 Introduo SECO, B.M.S.

    Em bactrias Gram-negativas, a conjugao depende da formao do pilus na

    clula doadora que guiada pelo sistema se secreo do tipo IV (T4SS), chamado de

    transferossomo. Este complexo expande o envelope celular e est envolvido na

    formao e retrao do pilus, na identificao da clula receptora e na sinalizao para

    o incio do processo de transferncia do DNA (DE LA CRUZ et al., 2010).

    O complexo de nucleoprotenas envolvidas no processamento do DNA e na

    formao do transferossomo chamado de relaxossomo (FURSTE et al., 1989).

    formado por relaxases (BYRD; MATSON, 1997) e protenas auxiliares que se ligam

    regio de origem de transferncia (oriT). Na regio oriT, ocorre a formao de um stio

    de nic onde a relaxase fosfodiesterase, quebra a fita de DNA em locais especficos,

    resultando na transferncia de DNA fita simples 53 para a clula receptora (KLIMKE;

    FROST, 1998).

    Outras protenas so necessrias para que a transferncia do DNA ocorra, entre

    elas a protena acopladora T4CP que conecta o relaxossomo ao T4SS, formando um

    canal, conhecido como poro conjugativo, na qual o DNA encaminhado para a clula

    receptora (GOMIS-RUTH et al., 2004).

    Esses mecanismos moleculares guiam um processo extremamente essencial na

    transferncia de plasmdeos que albergam genes de resistncia. A reinfeco de clulas

    livres de plasmdeos, atravs da conjugao, aumenta a persistncia plasmidial mesmo

    quando erros de replicao ou segregao ocorrem na clula hospedeira (SLATER et

    al., 2008).

  • 30 Introduo SECO, B.M.S.

    1.5.2 Replicao plasmidial

    Plasmdeos possuem em seu arcabouo gentico regies que regulam sua

    replicao. Essas regies possuem diferentes genes e sequncias especficas que so

    essenciais neste processo, entre elas a origem de replicao (ori), protenas

    responsveis pelo incio da replicao (Rep) e diferentes genes para o controle da

    replicao. O controle da replicao pode ocorrer via RNA anti-senso, bloqueio da

    traduo de protenas Rep, ou atenuao da transcrio dos genes essenciais (DEL

    SOLAR et al., 1998).

    A origem de replicao (ori) o local no qual a interao protena-DNA acontece

    e essencial para que a replicao se inicie. Essa mesma regio de extrema

    importncia, pois a base para a classificao de diferentes tipos de replicons. Existem

    trs mecanismos de replicao principais: replicao pelo mecanismo Teta, replicao

    por deslocamento de filamento e replicao por crculo rolante. No mecanismo teta e

    deslocamento de filamento, existe a formao de uma forquilha de replicao a partir da

    ori e a replicao ocorre bidirecionalmente; enquanto que no crculo rolante, a replicao

    ocorre unidirecionalmente (DEL SOLAR et al., 1998).

    Outro fator importante para que a replicao ocorra a forma na qual plasmdeos

    se encontram dentro das clulas bacterianas. Plasmdeos so estruturas de DNA circular

    e sua forma super-helicoidal favorece a sua replicao e segregao, pois esta

    conformao possui uma energia de toro negativa causada pelo alto enovelamento do

    DNA (KASAMATSU; VINOGRAD, 1974). Essa tenso negativa facilita a separao de

    fitas, pois este processo alivia o estresse causado pelo enovelamento do DNA, ocorrendo

  • 31 Introduo SECO, B.M.S.

    com um menor custo metablico. Desta forma, a quantidade de energia gasta para

    replicar e segregar plasmdeos super-helicoidais menor do que aquela necessria para

    o mesmo processo em plasmdeos em formas relaxadas (GELLERT et al., 1976).

    O super-enovelamento do DNA traz problemas como formao de ns entre as

    fitas de DNA bem como quebras que precisam de reparo. Desta forma, as

    topoisomerases so necessrias para reparar o DNA. O grupo mais importante no

    processo de enovelamento e reparos o grupo das topoisomerases do tipo II, pois

    conseguem quebrar ambas as fitas de DNA. Em Eubactrias esse grupo representado

    por duas enzimas: DNA girase e topoisomerase IV (MORRISON; COZZARELLI, 1981).

    Embora as topisomerases tipo II sejam eficientes, o processo altamente custoso

    devido a essas enzimas estarem acopladas a ATPases que hidrolisam o ATP para

    fornecer energia no processo de enovelamento. Para solucionar este problema, bactrias

    codificam tambm as topoisomerases do tipo I, que no necessitam da hidrlise do ATP

    para exercer sua atividade. Em bactrias existem duas enzimas deste grupo: a Topo I e

    Topo III. A ao das topoisomerases do tipo I ocorre somente em DNA super-

    enovelados, pois ela dependente de um gradiente energtico, que gerado pela

    energia negativa armazenada em plasmdeos super-enovelados (WITZ; STASIAK,

    2010).

    Outro fato importante, a reduo do gasto energtico por apresentar plasmdeos

    super-enovelados. A ao das topoisomerases do tipo IV no acontece em plasmdeos

    nesta forma, pois existe uma dificuldade da enzima em separar as duas fitas de DNA.

    Desta forma o consumo e ATP gerado em processos e reparo de DNA diminudo

    (WITZ; STASIAK, 2010).

  • 32 Introduo SECO, B.M.S.

    Qualquer interao que ocorra de forma no regulada nas regies ori, ou iniba a

    expresso de genes que codifiquem protenas Rep ou de controle de replicao, bem

    como genes da topoisomerase, podem afetar mecanismos de replicao plasmidial e

    sua distribuio para clulas filhas, diminuindo a persistncia do mesmo em uma

    populao bacteriana (BERGSTROM et al., 2000; SLATER et al., 2008).

    1.5.3 Segregao plasmidial

    Outra forma de manuteno plasmidial atravs da transmisso vertical na qual

    o plasmdeo transmitido para as clulas-filhas durante a diviso celular, processo

    conhecido como segregao plasmidial ou partio. Este processo mediado por

    mecanismos moleculares ou randomizados, baseados em nmero de cpias de

    plasmdeo por clula (MILLION-WEAVER; CAMPS, 2014).

    O sistema de partio plasmidial ocorre em plasmdeos de baixo nmero de

    cpias e normalmente carrega os genes essenciais em seu arcabouo gnico. Esses

    genes codificam protenas essenciais para a diviso fsica de plasmdeos em nmeros

    iguais para clulas filhas. Exemplos so os sistemas Par, que so encontrados em

    gamaproteobactrias (parRMC), -proteobacteria (parABC) e plasmdeos F conjugativos

    (sopABC) (SALJE, 2010; THOMAS, 2000). Este sistema conta com a formao de um

    elemento centromrico, uma protena motora que gera energia atravs da hidrlise do

    nucleotdeo trifosfato e uma protena de ligao do DNA que atua como um adaptador

    entre a protena motora e o centrmero (MILLION-WEAVER; CAMPS, 2014).

  • 33 Introduo SECO, B.M.S.

    Para que a partio ocorra, muitas protenas e genes esto envolvidos. No

    sistema parRMC do plasmdeo R1, um exemplo do sistema par tipo II, os plasmdeos se

    encontram ao acaso e comeam a se mover como uma unidade nica devido a ligao

    do ParR com o o gene parC. Monomeros de ParM so adicionados ao final do filamento

    do ParR e ocorre uma elongao bidirecional, empurrando os plasmdeos para polos

    opostos da clula. Aps essa etapa, a hidrolise do ATP causa a dissociao do filamento

    ParM e os plasmdeos acabam em polos opostos da clula em diviso celular (Figura 6)

    (GERDES et al., 1986)

    Em plasmdeos que possuem grande nmero de copias (>15 cpias/clula) o

    sistema de segregao ainda no foi bem esclarecido. Poucos estudos sugerem que a

    partio plasmidial ocorre de forma randmica, de forma que a probabilidade de

    formao de clulas livres de plasmdeo muito pequena devido ao grande nmero de

    copias de plasmdeo (REYES-LAMOTHE et al., 2014; SUMMERS, 1991). Outros

    Figura 6. Sistema de partio par tipo II. (1) Plasmdeos se encontram ao acaso. (2) Plasmdeos se movem

    como uma nica unidade devido a ligao do ParR (esfera preta) e parC (retngulo cinza). (3) Monmeros

    de ParM (retngulos brancos) so adicionados ao final do ParR. (4) A elongao da cadeia de ParM

    empurra os plasmdeos para polos opostos da clula. (5) Hidrlise do ATP quebra a cadeia de ParM. (6)

    Plasmdeos em polos opostos da clula bacteriana. Modificado de (MILLION-WEAVER; CAMPS, 2014).

  • 34 Introduo SECO, B.M.S.

    estudos sugerem que a diviso randmica de plasmdeos facilitada por mecanismos

    de resoluo de multmeros ou plasmdeos conectados, na qual so codificados

    principalmente por genes cromossmicos (MILLION-WEAVER; CAMPS, 2014).

    1.5.4 Sistemas toxina-antitoxina

    Entre os mecanismos ps-segregacionais, os sistemas toxina-antitoxina (TA) tm

    alta eficincia na eliminao de clulas livres de plasmdeos. O sistema TA garante a

    manuteno plasmidial, pois confere uma vantagem s clulas albergando plasmdeos

    porque reduz a competitividade com clulas livre de plasmdeos, garantindo sua reteno

    na populao (HAYES, 2003; PARK et al., 2013).

    O sistema TA est presente normalmente no arcabouo gentico dos plasmdeos,

    mas tambm pode ser encontrado em cromossomo. O cassete gnico normalmente

    formado pelo gene da antitoxina seguido do gene da toxina, porm existem casos na

    qual esta ordem pode estar invertida (ENGELBERG-KULKA; GLASER, 1999; GERDES,

    2000; RAWLINGS, 1999).

    O sistema funciona de uma maneira eficiente de modo a garantir apenas a

    sobrevivncia de clulas que albergam o plasmdeo. O gene da toxina codifica uma

    protena estvel, enquanto o gene da antitoxina pode codificar uma protena lbil ou um

    RNA antisenso. A toxina pode ser neutralizada pela inibio da traduo, quando a

    antitoxina um RNA (tipo I), pela ligao do RNAm da antitoxina protena da toxina

    (tipo III), ou ainda por uma ligao forte toxina-antitoxina (tipo II). Se uma clula-filha no

    recebe o plasmdeo, devido a um erro na replicao ou defeito na manuteno

  • 35 Introduo SECO, B.M.S.

    plasmidial, as clulas continuaro a herdar o complexo toxina-antitoxina, presente no

    citoplasma. A antitoxina ser degradada mais rapidamente por enzimas intrnsecas do

    que o a toxina, e a mesma no ser reposta, devido falta dos genes plasmidiais que a

    codificam. Desta forma, a toxina liberada do complexo toxina-antitoxina e interage com

    alvos essenciais da clula hospedeira causando morte celular ou restrio de

    crescimento (Figura 7) (DZIEWIT et al., 2007; HAYES, 2003).

    1.5.5 Inseres e delees gnicas

    Estudos recentes sobre evoluo de plasmdeos e hospedeiros tm indicado

    novos mecanismos que causam um aumento da sua persistncia, atravs da insero

    e/ou deleo gnica. Loftie-Eaton et al, 2015 realizando um experimento de co-evoluo

    do plasmdeo pMS0506 no hospedeiro P. moraviensis, por 1.000 geraes, demonstrou

    que ocorrem mudanas genticas no plasmdeo e no hospedeiro, em um processo co-

    Figura 7. Sistemas toxina-antitoxina. No tipo I h uma interao do RNAm da antitoxina com o RNAm da

    toxina. No tipo II existe a interao proteica da toxina com a antitoxina. No tipo III o RNAm da antitoxina

    interage com a protena da toxina. Modificado de (PARK; SON; LEE, 2013).

  • 36 Introduo SECO, B.M.S.

    evolutivo. O sequenciamento do genoma do hospedeiro, quando comparado ao seu

    ancestral, mostrou polimorfismo de nucelotideo nico (SNPs) no promotor do gene da

    helicase DNAB e em uma helicase putativa, enquanto que o sequenciamento de

    plasmdeos, que aumentaram sua persistncia, mostrou uma insero de um transpson

    de 7.1Kb (LOFTIE-EATON et al., 2015).

    Plasmdeos que se adaptam a um hospedeiro podem tambm se tornar mais

    estveis em outros hospedeiros filogeneticamente distintos, sem a necessidade de co-

    evoluo com o novo hospedeiro. Um exemplo foi este mesmo plasmdeo pMS0506 que

    foi submetido a um processo de evoluo em P. moraviensis e que adquiriu um

    transpson de 7.1Kb do plasmdeo nativo pR28. O transpson adquirido codifica um

    sistema toxina-antitoxina, que auxiliou na manuteno plasmidial no s em P

    moraviensis como tambm em E. coli, Cupriavidus necator e Pseudomonas putida

    (LOFTIE-EATON et al., 2015).

    Processos de delees tambm podem contribuir para o aumento da persistncia

    plasmidial. Pseudomonas fluorescens e o plasmdeo pQBR103, resistente a mercrio,

    foram submetidos a processos de evoluo para verificar a persistncia plasmidial em

    ambiente sem presso seletiva. O sequenciamento completo do plasmdeo revelou

    delees dos genes gacA ou gacS, responsveis por produo de metablitos

    secundrios, diminuindo o custo da manuteno plasmidial na clula hospedeira.

    Mutaes no gacA/gacS inibiram a expresso de 17% dos genes plasmidiais e

    cromossmicos, o que possivelmente reduziu o gasto metablico que plasmdeos

    exigem da clula hospedeira (HARRISON et al., 2015).

  • 37 Introduo SECO, B.M.S.

    Essas diferentes vias pelas quais plasmdeos podem aumentar sua persistncia,

    tais como interaes entre plasmideo-plasmideo, plasmdeo-hospedeiro ou ambos,

    demonstram que existem mltiplos mecanismos no processo de estabelecimento de um

    plasmdeo em uma populao bacteriana (LOFTIE-EATON et al., 2015; PENA-MILLER

    et al., 2015).

    .

    1.6. Grupos de Incompatibilidade

    Plasmdeos so classificados em grupos de incompatibilidade (Inc) baseado na

    condio de que plasmdeos de mesmo grupos de incompatibilidade no podem coexistir

    em uma nica clula, devido a mecanismos de replicao em comum (NOVICK, 1987).

    Essa classificao importante para agrupar plasmdeos que conferem resistncia aos

    antimicrobianos e para entender a disseminao de plasmdeos de importncia clnica

    (ANDERSON et al., 1977).

    Grupos de Inc podem ser detectados de trs formas distintas: (1) introduo do

    plasmdeo, do qual se desconhece o grupo de Inc, em uma clula que contenha um

    plasmdeo de grupo de Inc conhecido, por conjugao ou transformao e avaliao da

    estabilidade; (2) PCR para replicons de grupos Inc definidos; (3) Sequenciamento total

    ou parcial de plasmdeos e comparaes de replicons in silico (CARATTOLI et al., 2005;

    CARATTOLI et al., 2014; NOVICK, 1987).

    A resistncia aos -lactmicos disseminada por diferentes plasmdeos de

    diferentes grupos de incompatibilidade, tais como: IncA/C, IncF, IncFIIk, IncHI2, IncHI3,

    IncL/M, IncN, IncN2, IncX e IncX3. A disseminao de blaNDM-1, especificamente, vem

  • 38 Introduo SECO, B.M.S.

    sendo associada a plasmdeos dos grupos IncL/M, IncA/C, IncF, IncHI1, IncX, IncFIIk e

    novas variantes dos grupos IncN, IncHI1, sendo os grupos IncA/C e IncHI1 os mais

    frequentemente reportados (CAMPOS et al., 2015; CARATTOLI, 2013).

    A famlia IncA/C possui uma grande diversidade de hospedeiros pertences a

    famlia Enterobacteriaceae, Pseudomonas spp., e outras bactrias distintas tais como

    Photobacterium damselae, sendo nomeados de plasmdeos promscuos. Essa famlia

    codifica mltiplos genes de resistncia como a aminoglicosdeos, cloranfenicol,

    trimetoprim, sulfonamidas e tambm genes importantes no sistema de segregao

    responsveis pela persistncia plasmidial (COLINON et al., 2007; POOLE et al., 2009).

    Esse grupo tambm est relacionado com a disperso de genes de -lactamase do tipo

    AmpC, em particular blaCMY-2 (LINDSEY et al., 2009).

    O grupo IncHI1 um grupo especial pelo fato desses plasmdeos estarem

    frequentemente associados a Salmonella spp. e sua transferncia ocorrer

    preferencialmente entre 22C e 30C, sugerindo que a disseminao de blaNDM-1 para

    outros grupos de bactrias, ocorre preferencialmente em ambientes aquticos e solo

    (DOLEJSKA et al., 2013; WALSH et al., 2012). Plasmdeos desse grupo frequentemente

    codificam metilases ArmA (resistncia a todos os aminoglicosdeos) e resistncia a

    metais pesados. Sequncias do plasmideo IncHI1 albergando blaNDM-1 em Citrobacter

    freundii revelaram um pr-fago do tipo CP4 que alberga genes codificadores de bomba

    de efluxo RND/MDR e do sistema toxina-antitoxina do tipo YkfI-YfjZ os quais podem estar

    relacionados com o aumento da resistncia aos antimicrobianos e persistncia plasmidial

    (DOLEJSKA et al., 2013).

  • 39 Introduo SECO, B.M.S.

    1.7 Cura plasmidial

    O desenvolvimento de novos frmacos contra cepas multirresistentes

    necessrio, porm um processo muito lento quando comparado com a frequncia de

    surgimento de mecanismos de resistncia. Uma alternativa a isto tem sido o estudo da

    ao de compostos qumicos que apresentam atividade de cura plasmidial como um

    mecanismo para a conteno da disseminao da resistncia aos antimicrobianos

    (MOLNAR; AMARAL; MOLNAR, 2003; SPENGLER et al., 2006).

    Diferentes compostos que apresentam atividade de cura plasmidial foram

    reportados na literatura. Entre os compostos naturais, o extrato herbal de naftoquinonas

    apresentou atividade de cura plasmidial de 4-20% em cepas de Staphylococcus aureus

    resistentes vancomicina (JAHAGIRDAR; PATWARDHAN; DHAKEPHALKAR, 2008),

    enquanto que o agente 8-epidiosbulbina E acetato (EEA) isolado da planta Dioscorea

    bulbifera curou plasmdeos de amostras clinicas como Enterococcus

    faecalis, Escherichia coli, Shigella sonnei e Pseudomonas aeruginosa, a uma taxa de 12-

    48% (SHRIRAM et al., 2008).

    Entre os compostos intercalantes, o brometo de etdio e laranja de acridina so os

    mais utilizados em laboratrios para cura de plasmdeos em ensaio in vitro.

    Normalmente, os compostos qumicos so adicionados ao meio de cultura junto com o

    inculo bacteriano e cultivado overnight. Esses compostos induzem a cura plasmidial

    principalmente pela inibio do processo de replicao plasmidial (LETCHUMANAN;

    CHAN; LEE, 2015).

  • 40 Introduo SECO, B.M.S.

    Compostos tricclicos como as fenotiazinas e no-fenotiazinas tambm fazem

    parte da categoria de compostos intercalantes, e so frmacos conhecidos por serem

    usados no tratamento da depresso. O derivado da fenotiazina 2-Chloro-10-(2-

    dimethylaminoaethyl) fenotiazina, curou plasmdeos lacF a uma taxa de 90% em E. coli

    K12. Outro derivado tricclico, uma no-fenotiazina conhecida como maprotilina, tambm

    apresentou uma taxa de 90% de cura de plasmdeos lacF em E. coli K12. Esses frmacos

    so possveis ferramentas que podem auxiliar no processo de eliminao de plasmdeos

    que albergam resistncia a antimicrobianos devido alta taxa de eliminao plasmidial

    (MOLNAR et al., 2003).

    A eficcia destes compostos qumicos depende da estrutura qumica da molcula

    com sistemas de anel plano com substituio na regio L-molecular. A estrutura do DNA

    na qual os compostos se ligam tambm influencia sua eficincia. Plasmdeos super-

    helicoidais so mais susceptveis ligao de compostos qumicos do que as formas

    lineares ou circulares abertas. Apesar da conhecida atividade anti-plasmidial de alguns

    compostos, estudos ainda so necessrios para que os mesmos tenham elevada

    eficincia sobre plasmdeos de multirresistncia e auxiliem na reduo da disperso de

    resistncia aos antimicrobianos nos diferentes microbiomas. (SPENGLER et al., 2006).

  • Justificativa 41 SECO, B.M.S.

    2. JUSTIFICATIVA

    A disperso do gene blaNDM-1 vem acontecendo rapidamente, em bactrias

    filogeneticamente distintas, e j atinge diversas regies no mundo. Esse processo vem

    ocorrendo principalmente atravs da mobilizao de elementos genticos mveis, como

    plasmdeos e transpsons.

    Muito pouco se sabe sobre o comportamento desses plasmdeos em diferentes

    hospedeiros. O estudo da persistncia plasmidial pode mostrar quo adaptados os

    plasmdeos so em relao ao seu hospedeiro, auxiliando na busca de um possvel

    disseminador do gene blaNDM-1, bem como o estabelecimento de padres de estabilidade.

    Entender os processos genticos que auxiliam na manuteno plasmidial de

    extrema importncia para que esses mecanismos possam vir a ser utilizados no controle

    da disperso de genes de resistncia.

    Outro fator importante tentar diminuir a persistncia de plasmdeos que

    carregam o gene blaNDM-1 utilizando-se frmacos que possuem atividade de cura

    plasmidial, de modo a criar uma alternativa ao uso dos antimicrobianos. Neste trabalho

    ns investigamos, pela primeira vez na literatura, a atividade do frmaco maprotilina na

    cura de plasmideos com blaNDM-1.

  • Objetivos 42 SECO, B.M.S.

    3. OBJETIVOS

    3.1 Objetivo Geral

    Avaliar a persistncia de plasmdeos que albergam blaNDM-1 em Enterobactrias.

    3.2 Objetivos Especficos

    Estabelecer padres de persistncia plasmidial para diferentes espcies de

    Enterobactrias.

    Comparar padres de persistncia com e sem tratamento com maprotilina.

    Estabelecer valores de CIM para maprotilina

    Avaliar o efeito da maprotilina em padres celulares

    Identificar diferenas em sequncias genticas de plasmdeos que apresentam

    padres de persistncia distintos.

    Identificar grupos de Incompatibilidade

  • 43 Materiais e Mtodos SECO, B.M.S.

    4. MATERIAL E MTODOS

    4.1 Amostras bacterianas

    Swabs retal e urina fora coletados em pacientes atendidos pelo Instituto Fleury de

    Medicina e Sade de So Paulo e Hospital de Clnicas de Porto Alegre no perodo de

    agosto de 2013 a fevereiro de 2015. Bactrias apresentando resistncia aos

    carbapenmicos foram isoladas em gar MacConkey e estocadas em caldo LB com 20%

    de glicerol a -70C.

    4.2 Extrao de DNA genmico

    As extraes de DNA genmico foram realizadas atravs do mtodo de lise

    trmica. Bactrias foram inoculadas em gar LB e aps 18 a 24 horas de incubao a

    36C 1C, trs a quatro colnias isoladas foram inoculadas em 200 L gua ultrapura

    e fervidas por 10 minutos. Em seguida, foram submetidas a congelamento a -20C por

    10 minutos. Para amplificao do DNA, as extraes foram descongeladas temperatura

    ambiente, homogeneizadas e centrifugadas a 16.000xg por 2 min. O sobrenadante foi

    coletado e mantido a -80C.

  • 44 Materiais e Mtodos SECO, B.M.S.

    4.3. Identificao de espcies bacterianas

    A identificao das espcies foi realizada atravs do espectrmetro de massa

    Vitek-MS (bioMrieux) e sequenciamento do gene gyrB (BRADY et al., 2013). Para

    identificao de subespcies foi realizado o sequenciamento parcial do gene hsp60

    (HOFFMANN; ROGGENKAMP, 2003). O mtodo do BigDye Terminator verso 3.1 e

    3130xl Genetic Analyzer (Applied Biosystems) foi realizado de acordo com

    recomendaes do fabricante. Os contigs foram montados usando o programa

    DNABaser verso 3.4.5 (Heracle Biosoft) e comparado, utilizando-se o programa BLAST,

    com sequncias disponveis no GenBank.

    4.4 Deteco do gene blaNDM-1

    A PCR multiplex para deteco de genes de carbapenemases blaNDM, blaOXA-48,

    blaKPC, blaIMP, blaVIM e blaSPM, foi realizada segundo a descrio original (POIREL;

    WALSH; et al., 2011), exceto quanto ao uso da Taq Platinum (Thermo) e incluso dos

    primers 5AGAGTTTGATYMTGGCTCAG e 3GGTTACCTTGTTACGACTT (MAIWALD,

    2004) para deteco do gene 16S rRNA como controle interno.

    Para a deteco das variantes do gene blaNDM, amostras positivas no PCR

    multiplex para blaNDM tiveram o gene totalmente sequenciado utilizando-se os primers

    NDM-L-bleo-FW-5TGGGTCGAGGTCAGGATAGG e NDM-R-Aba-125-

    3GCTTTGAAACTGTCGCACCT (CAMPOS et al., 2015). Os amplicons foram

    purificados com Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare Life

  • 45 Materiais e Mtodos SECO, B.M.S.

    Sciences) e sequenciados utilizando-se o kit do BigDye Terminator verso 3.1 e 3130xl

    Genetic Analyzer (Applied Biosystems) de acordo com recomendaes do fabricante. Os

    contigs foram montados utilizando-se o programa DNABaser verso 3.4.5 (Heracle

    Biosoft) e comparado, atravs do BLAST software, com sequncias disponveis no

    GenBank.

    4.5 Preparo de clulas eletrocompetentes

    Clulas eletrocompetentes de Escherichia coli TOP10 foram preparadas

    inoculado-se 2,5 mL de uma cultura overnight da cepa em 250 mL de caldo LB. As clulas

    foram crescidas a 36C 1C a 150 rpm at atingir DO600nm de aproximadamente 0,5-

    0,7A. As clulas foram resfriadas em gelo por cerca de 20 min e quatro alquotas de 45

    mL foram centrifugadas a 4000 x g por 15 min a 4C.

    O sobrenadante foi descartado e as clulas foram ressuspensas em 45 mL de

    gua gelada contendo 10% glicerol. Uma nova centrifugao foi realizada e os pellets

    ressuspensos em 22,5 mL de gua gelada com glicerol. Os tubos foram centrifugados e

    2 mL de gua gelada com glicerol foram adicionados. Os pellets foram ressuspensos

    cuidadosamente, centrifugados e os sobrenadantes descartados. Por fim, 1 mL de gua

    gelada com glicerol foi adicionada em cada tubo para concentrar a soluo bacteriana e

    os tubos foram centrifugados.

    O pellet final foi ressuspensos em 1 mL de gua gelada com glicerol e foram

    preparadas alquotas de 50L em microtubos de 1,5 mL. As clulas foram armazenadas

    a -80C para permanecerem estveis at o momento de uso. Para verificao da

  • 46 Materiais e Mtodos SECO, B.M.S.

    eficincia das clulas eletrocompetentes, o plasmdeo pUC19 foi transformado por

    eletroporao em E. coli TOP10 (BIO-RAD).

    4.6 Extrao de DNA plasmidial

    Os isolados foram cultivados em gar LB e incubados a 36C 1C por 18 a 24

    horas. Colnias isoladas foram transferidas para tubo contendo 5 mL de caldo LB e

    incubadas a 36C 1C overnight.

    Para a extrao do DNA plasmidial o mtodo de lise alcalina descrito por Birnboim

    & Doly (BIRNBOIM; DOLY, 1979) com modificaes descritas por Sambrook e Russell

    (SAMBROOK, 2001), foi realizado. Uma alquota de 1,5 mL de cultura foi submetida

    centrifugao a 16.000 x g por 30 seg. a 4C, o sobrenadante foi cuidadosamente

    removido e o sedimento ressuspenso em 100 L de soluo I (20mg/mL lisozima, 50mM

    glicose, 10mM EDTA, 25mM Tris-HCl pH 8,0). Em seguida, adicionou-se 200 L de

    soluo II (0,2N NaOH, 1% SDS) o tubo foi homogeneizado por inverso.

    Aps exatos 5 min de incubao no gelo, 150 L de soluo III gelada (3M acetato

    de sdio pH 4,8) foi adicionada e o tubo foi homogeneizado por inverso para

    precipitao do DNA cromossmico. Incubou-se a 0C por 5 min, centrifugou-se a 16000

    x g por 5 min a 4C e 250 L do sobrenadante foi transferido para um microtubo limpo

    de 1,5 mL, onde o DNA plasmidial foi precipitado com 1 mL de etanol absoluto gelado.

    Aps uma incubao a -20C por 30 min, o precipitado foi coletado por

    centrifugao a 16000 x g por 2 min a 4C. Posteriormente, o sedimento foi ressuspenso

    em 100 L de soluo IV gelada (0,1M acetato de sdio/ 0,05M Tris-HCl - pH 8,0) e o

  • 47 Materiais e Mtodos SECO, B.M.S.

    DNA precipitado com 200 L de etanol absoluto gelado. O tubo foi incubado a -20C por

    10 min e centrifugado novamente. O sedimento foi ressuspenso em 30 L de TE buffer.

    A concentrao de DNA plasmidial foi quantificada utilizando-se um Nanodrop e as

    extraes foram armazenadas a -80C.

    4.7 Transformao em Escherichia coli TOP10 por eletroporao

    Foram adicionados 3 L do DNA plasmidial em 50 L da alquota da clula

    eletrocompetente (BIO-RAD). Homogeneizou-se cuidadosamente a suspenso e

    incubou-se em gelo por aproximadamente 1 min. Foram transferidos 40 L desta

    suspenso para a cubeta de 0,1 cm procedendo a eletroporao a 1,8 kV. Adicionou-se

    1 mL de meio SOC na cubeta, e transferiu-se a suspenso para um microtubo limpo de

    1,5mL que foi incubado a 36C 1C por 1 h a 100 rpm. Foram inoculados 50 L em trs

    placas de gar LB contendo 4 mg/L de ceftazidima. A presena do gene blaNDM nos

    transformantes foi confirmada por PCR.

    4.8 Perfil plasmidial dos isolados bacterianos

    O tamanho dos plasmdeos foi estimado atravs da eletroforese em gel de

    agarose a 0,7% utilizando-se uma curva obtida por plotagem da distncia (mm) da

    origem em papel semilogartmico dos tamanhos plasmidiais da cepa controle E. coli

    39R861 NCTC 50192 (154 kb; 66,2 kb; 37,6 kb e 7,4 kb) (MACRINA et al., 1978).

  • 48 Materiais e Mtodos SECO, B.M.S.

    4.9 Sequenciamento de plasmdeos

    A plataforma de sequenciamento MiSeq (Illumina) foi utilizada para o

    sequenciamento dos plasmdeos que foram extrados dos transformantes (Birnboim and

    Doly 1979; Sambrook and Russell 2001).

    O preparo da biblioteca foi realizado com o kit Nextera XT DNA Sample

    Preparation (Illumina) conforme as recomendaes do fabricante, com modificaes no

    input de DNA inicial 10X superior recomendada (2 ng/L). O sistema comercial MiSeq

    Reagent v2 500 cycles (Illumina) foi utilizado segundo as especificaes do fabricante

    na etapa de sequenciamento.

    4.10 Anlise do sequenciamento

    Os plasmdeos foram montados utilizando-se os programas SeqMan NGen

    (DNAStar) ou Geneious (Biomatters Limited) e a seguir submetidos a anotao

    automtica utilizando-se o programa RAST, seguido de curadoria manual utilizando-se

    o programa Artemis (Sanger Institute).

    Eventuais discrepncias foram resolvidas desenhando-se iniciadores com base

    nas sequncias conhecidas e realizando-se reaes de PCR. Os amplicons foram

    sequenciados utilizando-se o kit BigDye Terminator verso 3.1 no sequenciador 3130xl

    Genetic Analyzer (Applied Biosystems).

  • 49 Materiais e Mtodos SECO, B.M.S.

    4.11 Determinao de grupos de incompatibilidade

    Os contigs dos plasmdeos obtidos por meio do sequenciamento foram

    submetidos ao banco de dados PlasmidFinder-1.3

    (https://cge.cbs.dtu.dk//services/PlasmidFinder/) para determinao dos grupos de

    incompatibilidade. Essa ferramenta baseada em dados de replicons de plasmdeos j

    curados e depositados no GenBank e aceita dados gerados a partir de sequenciamento

    total de plasmdeo e genoma em forma de contigs, sequncias de Sanger alinhadas ou

    at mesmo sequncias sem qualquer curadoria. O PlasmidFinder determina qual o tipo

    de replicon e grupo de incompatibilidade, bem como um plasmdeo de referncia para

    cada linhagem (CARATTOLI et al., 2014).

    4.12 Ensaios de persistncia plasmidial

    Para definir padres de persistncia plasmidial, o mtodo de contagem em placa

    foi seguido (SOTA et al., 2010). Amostras bacterianas selvagens foram inoculadas em 5

    mL de caldo LB com ceftazidima (4mg/L) e incubadas a 37C em agitao (100 rpm),

    gerando uma populao homognea de bactrias albergando plasmdeos (T0). Por 10

    dias, 4.88 L do caldo bacteriano foi inoculado em um novo tubo contendo 5 mL de caldo

    LB sem ceftazidima, no mesmo intervalo de tempo. Para avaliar o efeito de cura

    plasmidial da maprotilina (Sigma), o mesmo protocolo foi seguido, exceto que

    concentraes sub-inibitrias (50 mg/L) do frmaco foram adicionadas em caldo LB a

    partir do T1.

  • 50 Materiais e Mtodos SECO, B.M.S.

    De cada ponto (T0, T1, T2...T10), uma alquota foi retirada e uma diluio em srie

    foi realizada para que pelo menos 52 colnias fossem isoladas em LB gar, aps a

    incubao a 37C por 12-18h. As 52 colnias foram semeadas em gar LB e gar LB

    com 4mg/L de ceftazidima, respectivamente, com o auxlio de palitos estreis. A razo

    entre colnias que cresceram em LB gar com ceftazidima com as que cresceram em

    LB gar, foi utilizado para montar a curva de persistncia plasmidial.

    O experimento foi feito em triplicata para cada isolado bacteriano. Uma colnia de

    cada triplicata do T10, que apresentou perda plasmidial, foi isolada e estocada em gar

    LB para verificao da perda plasmidial. Caso no tenha ocorrida perda plasmidial, uma

    colnia de cada triplicata do T10 tambm foi estocada para confirmao quanto a

    presena do plasmdeo albergando blaNDM-1.

    Teste fenotpico Blue-Carba (PIRES; NOVAIS; PEIXE, 2013) foi realizado em

    colnias isoladas do T10 do ensaio de estabilidade, para avaliar a atividade de hidrlise

    do Imipenem pela enzima NDM-1. Adicionalmente, PCR para o gene blaNDM (POIREL;

    WALSH; et al., 2011), extrao de plasmdeo (BIRNBOIM; DOLY, 1979) e gel de

    eletroforese (gel a 0.7%, 5h, 100V e 400mA) foram realizados para verificar perda

    plasmidial. Se negativo para essas trs condies, a perda plasmidial foi considerada

    verdadeira. Para averiguar contaminao, todas as colnias do T10 foram novamente

    submetidas identificao pelo sistema Vitek-MS (bioMrieux).

  • 51 Materiais e Mtodos SECO, B.M.S.

    4.13 Anlise de dados dos ensaios de persistncia plasmidial

    Para a comparao das duas curvas de persistncia plasmidial (com e sem

    maprotilina), o critrio de informao Bayesina (BIC) foi utilizado. Esse princpio permite

    a comparao de mais de dois modelos simultaneamente, trazendo vantagens por

    reduzir o erro tipo I. Os valores de BIC ponderam as evidencias nos dados em favor ou

    contra um conjunto de modelos. Nesta anlise, so comparados os valores de BIC (1)

    de um modelo que leva em considerao dois conjuntos de frao de segregao () e

    custo plasmidial (), que so necessrios para explicar a duas curvas de persistncia

    (BICsep para dinmicas separadas, com (2) um modelo que agrega apenas um

    conjunto de parmetros de e (BICjoint se a dinmica for nica). Os modelos so

    baseados em equaes matemticas que explicam que de uma gerao para outra, o

    nmero de clulas com plasmdeos duas vezes maior do que a gerao anterior menos

    a frao de perda plasmidial (), causada por erros de segregao. Clulas livres de

    plasmdeos se multiplicam em uma taxa de 21+, na qual representa vantagem evolutiva

    devido ao custo metablico plasmidial (DE GELDER et al., 2004; LOFTIE-EATON et al.,

    2015; PONCIANO et al., 2007).

    Os valores de comparao so expressos em BIC que mostram a magnitude da

    diferena entre as duas curvas. Uma dinmica de curva nica (BICjoint) caracterizada

    por valores nicos de e , enquanto que BICsep o valor de BIC assume que as curvas

    possuem dinmicas distintas e dois conjuntos de e . A diferena entre BICsep e

    BICjoint o valor de BIC. Valores mais negativos indicam uma maior diferena entre

    as dinmicas das curvas (LOFTIE-EATON et al., 2015; TAPER, 2016).

  • 52 Materiais e Mtodos SECO, B.M.S.

    4.14 Teste de Susceptibilidade a Maprotilina

    Concentrao Inibitria Mnima (CIM) da maprotilina (Sigma) foi determinada pelo

    mtodo de microdiluio, com modificaes (CLSI, 2012). O ensaio foi feito em triplicata

    para cada isolado bacteriano e o caldo LB foi utilizado como meio de cultura, pois foi o

    meio utilizado no ensaio de persistncia plasmidial.

    4.15 Avaliao do efeito da maprotilina no crescimento celular

    Para avaliar o efeito da maprotilina em clulas bacterianas, curvas de crescimento

    foram estabelecidas. Placas de 96 poos, construdas pelo mtodo de susceptibilidade,

    foram incubadas no leitor de microplacas PowerWave HT Microplate Spectrophotometer

    (BioTek) a 37C por 24h com agitao de 100 rpm, para anlise do efeito do frmaco na

    capacidade de carga (), taxa de crescimento, representada pela inclinao mxima da

    curva () e crescimento mximo celular (a).

    As leituras para a construo da curva foram estabelecidas a cada 10 min a uma

    absorbncia de OD600nm. Os dados foram obtidos atravs do PowerWave Scanning

    Spectrophotometer model RPRWI software e analisados pelo programa R (RStudio

    Version 0.98.1102). A correo de Bonferroni foi utilizada e valores de p < 0.05 foram

    considerados significativos. (MATTHIAS KAHM, 2010).

  • 53 Resultados SECO, B.M.S.

    5. RESULTADOS

    5.1 Isolados bacterianos

    Um total de nove isolados bacterianos foram includos neste trabalho. Duas

    espcies de Escherichia coli (E0083033-2 e E8162888-2), um Citrobacter freundii

    (E2143152), quatro Enterobacter spp. (E0083033-1, E214365, E6192100, E8162888-1),

    provindos do Rio de janeiro, uma Klebsiella pneumoniae (F5280088) da Bahia e uma

    Providncia rettgeri (HCPA1) do Rio Grande do Sul. Todos os isolados foram

    identificados por Vitek-MS (bioMrieux) com 99% de confiana (Tabela 2).

    Tabela 2. Isolados bacterianos investigados neste trabalho

    Amostra N isolado Espcie bacteriana Local

    NDM 2 E0083033-2 Escherichia coli Cabo-Frio-RJ

    NDM 19 E8162888-2 Escherichia coli Rio de Janeiro-RJ

    NDM 3 E2143152 Citrobacter freundii Rio de Janeiro-RJ

    NDM 1 E0083033-1 Enterobacter hormaechei subsp. steigerwaltii Cabo Frio-RJ

    NDM 4 E2143165 Enterobacter hormaechei subsp. oharae Rio de Janeiro-RJ

    NDM 15 E6192100 Enterobacter hormaechei subsp. oharae Rio de Janeiro-RJ

    NDM 18 E8162888-1 Enterobacter hormaechei subsp. oharae Rio de Janeiro-RJ

    NDM 21 F5280088 Klebsiella pneumoniae Salvador-BA

    HCPA1 HCPA-1 Providencia rettgeri Porto Alegre-RS

    Para a identificao de espcies de Enterobacter spp., sequncias parciais do

    gene gyrB (1.171 pb) foram comparadas com as cepas de referncia publicadas por

    Brady et al. (BRADY et al., 2013) e apresentaram alta similaridade (>90%) com a espcie

    bacteriana Enterobacter hormaechei. As sequncias parciais do gene hsp60 (341 pb),

  • 54 Resultados SECO, B.M.S.

    para identificao a nvel de sub-espcie, revelaram que o isolado E0083033-2 (NDM 1)

    pertence a subespcie E. hormaechei subsp. steigerwaltii, e os outros trs isolados

    (NDM 4, NDM 15 e NDM 18) subespcie E. hormaechei subsp. oharae.

    5.2 Amostras albergam o gene blaNDM-1

    O gene blaNDM foi confirmado em todas as espcies por multiplex PCR e o

    sequenciamento dos amplicons mostrou que a variante blaNDM-1 o gene presente em

    todos os isolados bacterianos.

    5.3. Plasmdeos carregam o gene blaNDM-1

    Plasmdeos foram isolados de todos as espcies e eletroporados em E. coli

    TOP10. Os transformantes foram obtidos de todas as espcies e mostraram-se positivos

    para blaNDM pela tcnica de PCR, indicando, desta forma, que o gene est presente em

    plasmdeo e no em cromossomo.

    Gis de eletroforese revelaram os tamanhos dos plasmdeos com blaNDM-1 que

    variam entre os isolados: Enterobacter spp. 100Kb (NDM1, NDM4, NDM15, NDM18),

    Citrobacter freundii 100Kb (NDM3), E. coli (NDM2) 80Kb, E. coli (NDM19) 100Kb, K.

    pneumoniae 200Kb (NDM21) e P. rettgerii 105Kb (HCPA-1) (Figura 8).

  • 55 Resultados SECO, B.M.S.

    Alm dos plasmdeos com blaNDM-1, os isolados selvagens carregam muitos outros

    plasmdeos. E. hormaechei subsp. steigerwaltii (NDM1) possui 5 plasmdeos de

    tamanhos entre 220 Kb; 100 Kb; 70 Kb; 7 Kb e 6 Kb. E. hormaechei subsp. oharae

    (NDM4, NDM15 e NDM18) possuem 7 plasmdeos um de 100 Kb e seis menores que

    7 Kb. A E. coli selvagem (NDM 2) possui apenas dois plasmdeos um de 180Kb e 80Kb

    enquanto que a E. coli (NDM 19) apresenta 6 plasmdeos distintos, sendo seis menores

    que 7Kb e um de 100Kb. C. freundii (NDM3) apresenta 3 plasmdeos sendo um de

    100 Kb e dois menores que 7 Kb. O isolado de K. pneumoniae (NDM21) apresenta dois

    Figura 8. Gel de agarose 0.7% de plasmdeo, submetido a eletroforese. Os transformantes (TF) E. coli TOP

    10 dos isolados selvagens apresentaram um nico plasmdeo albergado o gene blaNDM-1. Os

    transformantes de E. hormaechei spp. (NDM1, NDM4, NDM15 e NDM18) apresentam plasmdeos de 100

    Kb. Os transformantes de E. coli (NDM2) apresenta um plasmdeo de 80 Kb e E. coli (NDM19) e C. freundii

    de 100 Kb. O transformante de P. rettgeri (HCPA-1) apresenta plasmdeo de 105 Kb, enquanto que o de

    K. pneumoniae (NDM21) apresenta um plasmdeo de 200 Kb.

  • 56 Resultados SECO, B.M.S.

    plasmdeos sendo um de 200 Kb e outro de 150 Kb. Na cepa selvagem de P. rettgeri

    no foi possvel detectar o plasmdeo de 105 Kb confirmado em seu transformante,

    devido dificuldade de extrao de plasmdeos nesta espcie. Mesmo assim, o gel de

    eletroforese evidenciou dois plasmdeos menores que 7 Kb na cepa selvagem deste

    isolado (Figura 9).

    NDM21

    HCPA

    -1

    Figura 9. Gel de agarose 0.7% de plasmdeo, submetido a eletroforese. As cepas selvagens dos isolados

    deste estudo apresentam mais plasmdeos alm do plasmdeo albergado o gene blaNDM-1. E. hormaechei

    subsp. steigerwaltii (NDM1) possui 5 plasmdeos de tamanhos entre 220 Kb; 100 Kb; 70 Kb; 7 Kb e

    6 Kb. E. hormaechei subsp. oharae (NDM4, NDM15 e NDM18) possuem 7 plasmdeos um de 100 Kb e

    seis menores que 7 Kb. A E. coli (NDM 2) possui apenas dois plasmdeos um de 180Kb e 80Kb enquanto

    que a E. coli (NDM 19) apresenta 6 plasmdeos distintos, sendo seis menores que 7Kb e um de 100Kb. C.

    freundii (NDM3) apresenta 3 plasmdeos, um de 100 Kb e dois menores que 7 Kb. O isolado de K.

    pneumoniae (NDM21) apresenta dois plasmdeos um de 200 Kb e outro de 150 Kb. Em P. rettgeri devido

    dificuldade da extrao plasmidial, evidenciou-se apenas dois plasmdeos menores que 7 Kb e o

    plasmdeo de 105 Kb albergando o gene blaNDM-1, detectado em seu transformante, no foi isolado.

  • 57 Resultados SECO, B.M.S.

    5.4 A maprotilina no afeta parmetros do crescimento bacteriano

    A maprotilina apresentou concentraes inibitrias mnimas de 64 mg/L para

    isolados de Enterobacter spp., E. coli, C, freundii, K. pneumoniae e de 256 mg/L para P.

    rettgeri, em caldo LB. A concentrao sub-inibitria de 50mg/L de maprotilina foi

    estabelecido para avaliar a atividade de cura plasmidial do frmaco.

    O frmaco no teve efeito sobre o crescimento bacteriano em concentraes sub-

    inibitrias (Figura 10), pois no afetou significativamente a capacidade de carga (), taxa

    de crescimento () e crescimento mximo celular (a), p > 0.4, p > 0.4 e p > 0.6

    respectivamente.

    Desta forma, a maprotilina no tem efeito na persistncia plasmidial por influncia

    na diminuio do crescimento celular, o que poderia diminuir o nmero de clulas-filhas

    por gerao e causar uma falsa estabilidade plasmidial, se o mesmo for perdido

    principalmente por falha em mecanismos segregacionais.

  • 58 Resultados SECO, B.M.S.

    Taxa de crescimento ()

    Capacidade de carga ()

    Crescimento mximo celular (a)

    Figura 10. Anlise do efeito da maprotilina na capacidade de carga celular, crescimento mximo celular e taxa de

    crescimento, em Enterobacteriaceae. Maprotilina no teve efeito significativo em padres de crescimento celular (p >

    0.05). C- Tratamento controle sem o frmaco; M- Tratamento com 50 mg/L de maprotilina. Ensaio realizado em caldo

    LB.

  • 59 Resultados SECO, B.M.S.

    5.5 Persistncia plasmidial

    Os plasmdeos de todos os isolados selvagens tiveram alta persistncia aps 100

    geraes na ausncia de presso seletiva. No grupo dos Enterobacter spp. no houve

    perda plasmidial, enquanto que P. rettgeri mostrou a maior taxa de perda plasmidial

    (45%). O isolado C. freundii teve 26% de perda enquanto que E. coli e K. pneumoniae

    tiveram perda plasmidial entre 6% e 12% (Figuras 11 e 12).

    Na presena de concentraes sub-inibitrias da maprotilina (50 mg/L), a taxa de

    perda plasmidial foi significantemente maior em E. hormaechei subsp. stwigerwaltii

    (BIC = - 57.26), E. coli (NDM2) (BIC = -100.64), E. coli (NDM19) (BIC = -143.66), K

    pneumoniae (BIC = -150.12) e P. rettgeri (BIC = -1269.07). As espcies de E.

    hormaechei subsp. oharae no apresentaram perda de plasmdeo enquanto que C.

    freundii teve perda de 29%, porm no significativa (BIC = 6.20) (Figura 12).

    Figura 11. Mtodo de contagem em placa, ensaio sem maprotilina. Um total de 52 colnias foram repicadas em gar LB e

    gar LB com 4 mg/L de ceftazidima (CAZ). P rettgeri foi o isolado que apresentou maior perda de plasmdeos aps 100

    geraes (T10), enquanto que E. hormaechei subsp. steigerwaltii foi uma das espcies que no apresentou perda

    plasmidial.

    P. rettgeri T10, LB+CAZ

    P. rettgeri T10, LB gar

    E. hormaechei subsp. steigerwaltii

    T10, LB gar

    E. hormaechei subsp. steigerwaltii

    T10, LB+CAZ

  • 60 Resultados SECO, B.M.S.

    Figura 12. Ensaio de persistncia plasmidial. Controle est representado pela linha pontilhada com bolas abertas e o

    tratamento com maprotilina (50 mg/L), est representado pela linha tracejada com cruzes. Plasmdeos albergando gene

    blaNDM-1 mostraram-se estveis aps 100 geraes (10 dias) em ambiente sem seleo. P. rettgeri apresentou maior taxa de

    perda plasmidial (45%). Maprotilina teve atividade de cura plasmidial em P. rettgeri, K. pneumoniae, E. coli e E. hormaechei

    subsp. stwigerwaltii, mas no em C. freundii e E. hormaechei subsp. oharae.

  • 61 Resultados SECO, B.M.S.

    O tratamento com maprotilina foi de alta eficincia em P. rettgeri na qual, em 100

    geraes, apresentou 100% de perda plasmidial detectvel pelo mtodo de contagem

    em placa. Em E. coli, a cura plasmidial ocorreu a uma taxa de 40-47%, enquanto que K.

    pneumoniae e Enterobacter hormaechei subsp. steigerwaltii tiveram cura de 45% e

    25%, respectivamente (Figura 12).

    Todos as colnias isoladas em T10, que apresentaram perda plasmidial, foram

    negativas na PCR para o gene blaNDM, apresentaram hidrlise negativa pelo teste Blue-

    Carba, e plasmdeos no foram isolados em gel de eletroforese. A presena de

    plasmdeo em espcies Enterobacter hormaechei subsp. oharae foram confirmadas

    pelos mesmos mtodos, e foram positivos para os trs (Figura13).

    Figura 9. Gel de plasmdeo aps ensaio de persistncia plasmidial com maprotilina. A cura plasmidial foi

    comprovada por gel de eletroforese 0.7 %. Os isolados de E. hormaechei subsp. oharae (NDM4, NDM15,

    NDM18) no apresentaram perda plasmidial. Os isolados de E. hormaechei subsp. steigerwaltii (NDM1),

    E. coli (NDM2 e NDM19), C. freundii (NDM3) K. pneumoniae (NDM21) e P. rettgeri (HCPA-1) apresentaram

    perda plasmidial.

  • 62 Resultados SECO, B.M.S.

    As espcies, de todas as colnias isoladas em T10, foram reconfirmadas por

    Vitek-MS (bioMrieux) e todas foram identificadas com 99% de confiana, indicando que

    os ensaios no sofreram contaminao.

    5.6 O plasmdeo de menor persistncia possui uma sequncia de insero a mais

    do que plasmdeos de alta persistncia

    Todos os plasmdeos dos isolados transformantes foram totalmente

    sequenciados. O plasmdeo que apresentou menor persistncia, pPr249F, em isolado

    de P. rettgeri, possui 99% de similaridade com o plasmdeo pEh1A (n de acesso no

    GenBank KR822246) (CAMPOS et al., 2015), isolado de Enterobacter hormaechei

    subsp. steigerwaltii (NDM1), e com o plasmdeo pEh18A isolado Enterobacter

    hormaechei subsp. oharae (NDM18).

    Enquanto pPr249F teve menor persistncia plasmidial, pEh1A e pEh18A

    apresentaram alta persistncia plasmidial, aps 100 geraes, na ausncia de seleo,

    comportamentos totalmente discrepantes. Alinhando-se as sequncias dos plasmdeos,

    evidenciou-se a presena de 24 pares de bases em pPr249F entre a posies 2.876 pb

    a 2.900 pb e 40 pb em pEh18A entre 2.876 pb a 2.915 pb, que no esto presentes em

    pEh1A. Uma outra sequncia de 1.198 pb, entre as posies 82.022 pb e 83.220 pb,

    est presente em pPr249F e ausente em pEh1A e pEh18A (Figura 14).

    As sequencias de 24 pb e de 1.198 pb foram alinhadas a sequncias depositadas

    no banco de dados do GenBank, atravs do site BLAST. A sequncia de 24 pb no

    apresentou alta similaridade com nenhuma sequncia disponvel no banco de dados,

  • 63 Resultados SECO, B.M.S.

    enquanto que a sequncia de 1.198 pb mostrou alta similaridade (99%) a uma

    transposase de Enterobacter asburiae (n de acesso no GenBank CP011591). Essa

    sequncia foi ento submetida a base de dados do IS Finder para classificao da

    transposase e uma similaridade de 96% a IS5 de E. coli foi detectada.

    Com base na anotao da sequncia do plasmdeo pEh1A (n de acesso no

    GenBank KR822246) (CAMPOS et al., 2015), verificou-se que a sequncia de 24 pb est

    inserida entre uma protena hipottica pEh1A_0002 e um DNA no codificante, enquanto

    que a IS5 encontra-se inserida no incio de uma protena hipottica pEh1A_0077 (Figuras

    15A e 15B)

  • 64 Resultados

    Figura 14. Alinhamento das sequncias dos plasmdeos pEh1A de E. hormaechei subsp. steigerwaltii, pPr249F de P. rettgeri e pEh18A de E. hormaechei subsp.

    oharae. O plasmdeo pPr249F e pEh18A possuem 24 pb e 40 pb, respectivamente, entre as regies 2.876 pb e 2.915 pb, que esto ausentes (linha tracejada) em

    pEh1A (Figura acima). Uma IS5 de 1.198 pb entre as posies 82.022 pb e 83.220 pb est presente em pPr249F e ausente (linha tracejada) em pEh1A e pEh18A

    (Figura abaixo).

  • 65 Resultados SECO, B.M.S.

    A

    B

    Figura 15. Anotao do plasmdeo pEh1A de E. hormaechei subsp. steigerwaltii. A- Local onde as 24 pb do

    plasmdeo pPr249F est localizada em relao ao pEh1A. A sequncia se encontra (seta) entre uma protena

    hipottica pEh1A_0002 e uma DNA no codificante em amarelo. B- Local de insero da IS5. A sequncia de

    1198 pb insere-se no incio da protena hipottica pEh1A_0077 (seta).

  • 66 Resultados SECO, B.M.S.

    5.7 Grupos de Incompatibilidade

    Os plasmdeos de E. homraechei subsp. steigerwaltii e E. coli (NDM2) foram

    sequenciados e avaliados quanto a grupos de incompatibilidade em trabalho

    recentemente publicado por nosso grupo e colaboradores (CAMPOS et al., 2015).

    O plasmdeo em E. hormaechei subsp. steigerwaltii, nomeado de pEh1A, faz

    parte do grupo de incompatibilidade IncFIIk devido alta similaridade (99%) dos genes

    oriV e repA com o plasmideo pKF3-94 (GenBank accession no. FJ876826.1),

    pertencente a este grupo (ZHAO et al., 2010). Em P. rettgeri, e E. hormaechei subsp.

    oharae (NDM18) os plasmdeos possuem a mesma sequncia gnica do plasmdeo

    pEh1A, diferindo por apenas 24 pb (Figura 1