Original Article Myeloid-derived suppressor cells promote the ...5824 Int J Clin Exp Med...

Int J Clin Exp Med 2020;13(8):5823-5830www.ijcem.com /ISSN:1940-5901/IJCEM0111447

Original ArticleMyeloid-derived suppressor cells promote the stem cell-like acquisition of lung adenocarcinoma through the Wnt/β-catenin pathway

Yongshu Xu1, Qiong Feng4, Jinyan Chen2, Wenjun Xu2, Jian Sun2, Huan Deng3,5

Departments of 1General Practice, 2Respiration, 3Pathology, The Fourth Affiliated Hospital of Nanchang University, Nanchang, China; 4Department of Pathology, The Second Affiliated Hospital of Nanchang University, Nanchang, China; 5Tumor Immunology Institute, Nanchang University, Nanchang, China

Received March 26, 2020; Accepted June 2, 2020; Epub August 15, 2020; Published August 30, 2020

Abstract: Heterogeneity remains the biggest obstacle in deepening the understanding of lung adenocarcinoma (LAC) biology. The phenotype and functions of cancer cells may change to counteract the threat from the host. However, the exact mechanisms by which myeloid-derived suppressor cells (MDSCs) contribute to the acquisition of stem cell-like properties in lung adenocarcinoma are largely unknown. Pathological archives of 256 patients with lung adenocarcinoma at early stages were collected and evaluated by immunohistochemistry and FACS to explore the infiltration of MDSCs and the expression of stem cell marker p63. To further provide insights into the molecular mechanisms and interactions between MDSCs and p63-expressing cancer cells, we established early LAC models using histidine decarboxylase (Hdc)-CreERT2; eGFP; LSL-KrasG12D transgenic mice. MDSC-derived Wnts were blocked by porcupineflox/flox and diphtheria toxin receptor (DTR). Patients with a distinct population of LAC cells at early stages, indicated by p63 immunopositivity, exhibited a significantly poorer prognosis than their p63- negative counterparts. The percentage of Hdc+ polymorphonuclear (PMN) MDSCs increased in direct proportion to the p63+ rate. Hdc+ PMN-MDSCs secreted high levels of Wnt1, 2, 3, and 8a to aberrantly activate Wnt/β-catenin in the majority of p63+ cancer cells but not p63- cells. Blockade of Hdc+ PMN-MDSC-derived Wnts, or ablation of Hdc+ PMN-MDSCs in transgenic mouse models decreased the LAC tumor burden and the p63+ rate. In the microenvironment of LAC, PMN-MDSCs infiltrate and expand to promote p63 expression in cancer cells through upregulating Wnts. Thus, the tailored immunotherapies targeting Hdc+ PMN-MDSCs might be of therapeutic benefit for LAC patients.

Keywords: Lung adenocarcinoma, p63, cancer stem cell, myeloid-derived suppressor cell, histamine decarboxyl-ase

Introduction

Lung cancer (LC) is the leading cause of cancer-related mortality worldwide [1, 2]. Up to 46% of adenocarcinoma patients develop recurrence or distant metastasis within five years [3]. Ac- cumulating evidence provides more insights into the heterogeneity of cancer and suggests that different gene expression signatures of prognosis can be observed in separate regions of the same tumor. However, the exact identity of cancer stem cells (CSCs) is still controversial, mainly because of the lack of unique markers.

P63, a member of the p53 protein family, is consistently expressed by basal/somatic stem cells. The role of p63 in tumorigenesis and dis-

ease progression is still debated. Upregulated p63 contributes to cell cycle arrest and apoptosis [4, 5]. Genomic sequencing of p63 is amplified in the majority of lung squamous cell carcinomas (SCCs) and endows patients with prolonged survival [6]. Substantial evidence also supports that p63 can function as an oncogene. The dysregulation of p63 is involved in the progression of preneoplastic lesions and lung adenocarcinoma (LAC) [7, 8]. Thus, it seems that the crosstalk between p63 and other risk factors can influence neoplastic progression.

Several pathways have been linked to stem cell phenotypes in which p63 is involved. Ac- tivation of canonical Wnt signaling promoted

MDSCs and stem cell-like acquisition of lung adenocarcinoma

5824 Int J Clin Exp Med 2020;13(8):5823-5830

the expansion of bronchioalveolar stem cells [9]. The downregulation of endogenous p63 enhanced the expression of Wnt-related genes [10]. However, cellular sources of Wnt ligands are still unclear. An increased number of poly-morphonuclear MDSCs (PMN-MDSCs) were observed in patients with NSCLC compared with the general population [11]. The expansion of PMN-MDSCs has been linked to a relatively poor outcome in NSCLC patients at late stages, suggesting their pro-cancerous effects [12]. They may serve as the cellular source of tumor-associated immature myeloid cells in the context of aging or tumors. Previous study suggests that Myeloid-derived Wnts play pivot-al roles in the regeneration and differentiation of intestinal stem cells [13].

In the current study, we explored the prognos- tic role and regulatory mechanisms of p63. Clinical data showed that a minority of patients with early LAC displayed immunopositivity for p63 and exhibited a tendency towards recurrence or metastasis. Hdc+ PMN-MDSCs were recruited and infiltrated around p63+ can-cer cells. The upregulation of canonical Wnts in Hdc+ PMN-MDSCs aberrantly activated Wnt/β-catenin signaling in cancer cells and promoted p63 expression. Our data further unveil interactions between Hdc+ PMN-MDSCs and LAC cells, raising the possibility that the inhibi-tion or depletion of these cells with targeted strategies might facilitate anti-lung cancer treatment.

Materials and methods

Study cohort

This study included 256 patients with well-dif-ferentiated LAC. Lymph node or secondary site metastasis was excluded by computed tomog-raphy (CT) or ultrasonographic scanning. Achi- eves of tumor tissues were collected and evaluated. All patients gave written informed con-sent to participate in the study in accordance with the Helsinki Declaration, and this study was approved by the Medical Ethics Commit- tee of The Second and Fourth Affiliated Hospi- tal of Nanchang University.

Mouse models

All animal experiment protocols were approved by the Nanchang University Institutional Animal Care and Use Committee. Hdc-CreERT2;

eGFP mice were purchased from EMMA. LSL-KrasG12D, porcupineflox/flox, and iDTR mice were obtained from the Jackson Laboratory. LSL-KrasG12D mice were crossed to Hdc-CreERT2; eGFP followed by the administration of high doses (5 × 108 PFU) of AdenoCre (Cell Biolabs, USA) by intranasal instillation at 6 weeks of age as previously described, establishing early LAC models [14]. To explore the role of Hdc+ PMN-MDSC-derived Wnts, Hdc-CreERT2; eGFP; LSL-KrasG12D mice were crossed with porcu-pineflox/flox and iDTR, respectively. All mice were backcrossed and maintained on the C57BL/6 background and housed in the special patho-gen-free animal facilities.

Histopathological and immunohistochemical staining

Formalin-fixed and paraffin embedded blocks were embedded by the tissue arrayer TMAjr (Pathology Devices). Serial sections were cut into 3- to 4-μm slides followed by H&E and immunohistochemical staining. The histopath-ological evaluation of all sections was per-formed by two independent pathologists (L Zhou and J Hu), who were blinded regarding details. Primary antibodies for p63 (1:200; ab53039, Abcam), CD15 (1:150; clone Carb-1, Novocastra, Leica), anti-GFP (1:200; ab13970, Abcam), and β-catenin (1:200; ab32572, Ab- cam) were used (Autostainer 360, Lab Vision, Thermo Fisher). A microscope (80i, Nikon) with a CCD camera (DS-Ri2, Nikon) acquired the images. Counting of positive cells was con- ducted in nonoverlapping fields using the 40 × objective. The average number of positive cells in each square centimeter was calculated for each specimen.

In vivo treatment

At 6 weeks of age, tamoxifen (Harlan Labo- ratories) chow was fed to the mice in order to delete porpupine in Hdc+ myeloid cells, result-ing in Wnts secretion blockade. To further exclude other influencing factors, intraperito-neal diphtheria toxin (DT, Sigma) injections combined with a tamoxifen chow were used to abolish Hdc+ myeloid cell-derived Wnts in Hdc-CreERT2; eGFP; LSL-KrasG12D; iDTR and Hdc-CreERT2; eGFP; LSL-KrasG12D; porcupineflox/flox; iDTR mice.


5825 Int J Clin Exp Med 2020;13(8):5823-5830

Flow cytometry analysis

Fresh tissues obtained from lung primary tumors were manually minced and incubated in DMEM with collagenase A (Roche) and DNase I (Roche) for 45 min at 37°C. Suspensions were filtered three times using a 70 μm nylon mesh to remove dead cell debris and enrich leucocytes. No more than 1 × 106 cells were

Gene microarray analysis

Both Hdc+ and Hdc- PMN-MDSCs were harvested from LAC tissues. Total mRNA was extra- cted using a RNeasy Micro Kit (Qiagen) and la- beled with a 3’IVT Expression Kit (Affymetrix) before hybridization to the Affymetrix Gene- Chip mouse genome 430 2.0 array (Affymetrix). Arrays were performed using an Affymetrix

Table 1. Primers for quantitative RT-PCRGene Symbol Organism Gene Name Forward Primer (5’-3’) Reverse Primer (5’-3’)

Wnt1 Mus musculus wingless-type MMTV integration site family, member 1 TACCTACTAGCGTACTGATAC ACTGTCTAGTCTGGCGACTAG

Wnt2 Mus musculus wingless-type MMTV integration site family, member 2 CACCTCTCTTCCTGCTGATTT TCATTCTGCTTTCCATCCCTAC

Wnt3 Mus musculus wingless-type MMTV integration site family, member 3 GATGGTACTGGCTGGGTTTAG GCTCATGGTCACATGGTAGAG

Wnt8a Mus musculus wingless-type MMTV integration site family, member 8a TGCAGGACAGTGGAGATAGA CCACAAGCCAGGAGAACAA

Gapdh Mus musculus glyceraldehyde-3-phosphate dehydrogenase CTTTGTCAAGCTCATTTCCTGG TCTTGCTCAGTGTCCTTGC

Figure 1. P63 expression in lung adenocarcinoma (LAC). (A) A minority of LAC at early stages were positive for p63 antibody. (B) P63 positivity identi-fied a distinct subpopulation of LAC characterized by a poorer prognosis compared with p63- counterparts. Original magnification × 400 (A). *P < 0.05 (B).

incubated with the antibody panel composed of CD45 (30-F11, eBioscience), CD11b (M1/70, eBioscience), and Ly- 6G (1A8, eBioscience). PMN-MDSCs were identified based on their phenotype: CD45+

CD11b+Ly6Ghi. Hdc+ cells were characterized by their high le- vel of GFP expression (GFPhi). CD45+CD11b+Ly6GhiGFPlo cells

harvested from eGFP wild- type littermates were used to set the gate. Stained cells were fixed with Cytofix (BD Bio- science) for 30 min on ice and analyzed by an LSR II flow cy- tometer (BD Bioscience).

RNA-seq analysis

Hdc+ PMN-MDSCs were sorted and lysed in an ARCTURUS PicoPure RNA isolation kit according to the manufactur-er’s instructions (Life Techno- logies). Total RNA was isolated followed by cDNA amplifica-tion. Libraries were established using the SMARTer Ultra Low Input RNA kit (Clontech Laboratories) and the Nextera XT DNA Library Preparation Kit (Illumina). Sequencing was per-formed on a HiSeq 2500 (Illumina).


5826 Int J Clin Exp Med 2020;13(8):5823-5830

Scanner 300-7G scanner with GCOS software. A significance cut-off of a Benjamini-Hochberg false discovery rate ≤ 0.05 was applied.

Quantitative RT-PCR

Total mRNA of sorted cells was isolated using a RNeasy Micro Kit (Qiagen) and underwent

sion

Of the 256 patients with local LAC, 46 patients (18.0%) exhibited nuclear immunoreactivity for p63 (Figure 1A). The retrospective analysis suggested that p63+ LAC patients had a worse prognosis than p63- patients (P < 0.05) (Figure 1B).

Figure 2. PMN-MDSCs infiltration in p63+ LAC. (A) In both patients and mouse models, CD15+ PMN-MDSCs accumulated and expanded in p63+ rather than p63- LAC. The quantification further confirmed an increased number of PMN-MDSCs. (B) Representative FACS analysis of mouse mod-els indicated the expansion of Hdc+ PMN-MDSCs in p63+ tumors. Original magnification × 400 (A). **P < 0.01 (A).

reverse transcription using a SuperScript III First-Strand Synthesis System (Life Tech- nologies). The PrimerQuest Tool (Integrated DNA Tech- nologies) was used to design sequences of SYBR Green for Wnt1, Wnt2, Wnt3, and Wnt8a (Table 1). Quantitative PCR was performed with the Step- One Plus instrument (Appli- ed Biosystems). Relative gene expression was normalized to Gapdh.

Statistical analysis

Experimental results were rep-licated at least once, unless otherwise indicated. Sample sizes for each study were esti-mated on the basis of the expected differences and pre-vious experience with the par-ticular assay. All data are shown as the mean ± SEM. Kaplan-Meier survival was sta-tistically analyzed by the log-rank test. The percentage of cytoplasmic or nuclear β-catenin positivity was compared by Fisher’s exact test. Other sta-tistical comparisons were eval-uated with Student’s t test or one-way ANOVA. Significance levels were set at *P < 0.05; **P < 0.01; ***P < 0.001; n.s., not significant. N indica- tes biological replicates. Data analyses were carried out using Prism 8 (GraphPad).

Results

P63 promoted LAC progres-


5827 Int J Clin Exp Med 2020;13(8):5823-5830

MDSCs were recruited into LAC tissues

To further explore the identity of PMN-MDSCs, we established LAC animal models using Hdc-CreERT2; eGFP; LSL-KrasG12D mice, which were treated with AdenoCre. In primary LAC tissues obtained from patients and mouse models, PMN-MDSCs, defined by the combination of morphology and CD15+, were recruited and sur-rounded cancer cells (Figure 2A). The quantifi-cation results further revealed the propensity of CD15+ PMN-MDSCs to surround p63+ cancer tissues (Figure 2A). Consistent with the immu-nohistochemical staining results, the FACS results confirmed an increased percentage of

Hdc-CreERT2; eGFP; LSL-KrasG12D mice were crossed with porcupineflox/flox (Porcn) to elimi-nate the secretion of Wnts in Hdc-expressing cells (Figure 4A). FACS results indicated that the downregulation of porcupine decreased the incidence of LAC (P < 0.001) rather than the percentage of Hdc+ PMN-MDSCs (P > 0.05) (Figure 4B). Hdc-CreERT2; eGFP; LSL-KrasG12D; DTR mice were treated with DT to ablate Hdc+ cells, resulting in a decreased percentage of both LAC incidence and p63 positivity (Figure 4B and 4C). However, there were no significant differences between Porcn, DTR, and Porcn/DTR groups (P > 0.05) (Figure 4B and 4C).

Hdc+ PMN-MDSCs in p63+ LAC tumors (69.23 ± 7.27%) com-pared to that of p63- tumors (3.33 ± 0.28%) (P < 0.001) (Figure 2B).

Hdc+ myeloid cell-derived Wnts promoted the expression of p63

The majority of p63+ LAC tumors (91.2%) showed the translocation of β-catenin from the membrane to the cyto-plasm and nucleus (Figure 3A). Most p63- cases (94.8%) displayed membranous posi-tivity for β-catenin (Figure 3A). The cellular source of Wnt ligands varies according to different stages. RNA-seq analysis of Hdc+ PMN-MDSCs obtained from LAC masses showed upregulated levels of Wnts, including Wnt1, 2, 3, and 8a, indicating the involvement of canonical Wnt signaling (Figure 3B). RT-PCR analysis supported that Hdc+ PMN-MDSC-derived Wnts levels in p63+ LAC tumors were signifi-cantly higher than those in p63- tissues (Figure 3C).

Blocking of Hdc+ PMN-MDSC-derived Wnts inhibited LAC progression

Figure 3. Aberrant activation of Wnt/β-catenin signaling in p63+ cells. (A) The majority of p63+ (91.2%), rather than p63- tumor cells (5.5%), showed the translocation of β-catenin from the membrane to the cytoplasm and nucleus (P < 0.001). (B) Wnt1, Wnt2, Wnt3, and Wnt5a were upregulated in Hdc+ PMN-MDSCs cells harvested from p63+ LAC tissues confirmed by RNA-seq. (C) qRT-PCR revealed high levels of Hdc+ PMN-MDSCs-derived Wnt1, 2, 3, and 8a. Original magnification × 400 (A). **P < 0.01; ***P < 0.001 (A and C).


5828 Int J Clin Exp Med 2020;13(8):5823-5830

Discussion

The heterogeneous nature of cancer remains the rate-limiting step in the anti-LAC battle. Here we have identified a subgroup of p63- expressing LAC cells at early stages that were associated with a poor prognosis. Hdc+ PMN-MDSCs were recruited to and expanded in the p63+ tissues. They expressed high levels of Wnts 1, 2, 3, and 8a to promote tumor progres-sion and p63 acquisition. The close spatial relationship indicated the possibility that PMN-MDSCs regulate the biological behaviors of p63+ cancer cells through a paracrine-like pat-tern. The ablation of Hdc+ PMN-MDSC-derived Wnts attenuated tumor progression.

LAC is a heterogeneous disease composed of cancer cells with different behaviors. CSCs con-tribute to recurrence or metastasis. However, a lack of consensus regarding a universal marker of CSC hampers the clinical utility of CSC-targeted therapies. P63 plays an important role in normal lung development. The downregulat-ed expression of p63 in transgenic mice led to dysplasia of the epithelium [15]. P63 is tradi-

tionally considered as a tumor suppressor gene, endowing cells with proapoptosis and cell cycle arrest-promoting properties [4, 5]. Lung squamous cell carcinoma (LSCC) patients expressing high levels of p63 showed a better prognosis than their p63- counterparts [6]. Another hypothesis argues that p63 can func-tion as an oncogene. Both LAC and its precan-cerous lesions exhibit strong immunopositivity for p63 [8]. Upregulated expression of p63 causes hyperproliferation and terminal differ-entiation defects [16]. Our study provided pre-liminary data that nuclear p63-positivity in the minority of LAC is linked to a poor prognosis, further supporting the possibility that p63 pro-motes LAC progression.

Myeloid-derived immune cells, including MD- SCs, tumor-associated macrophages (TAMs), and tumor-associated neutrophils (TANs), are essential for the tumorigenesis and progres-sion of many solid tumors [17, 18]. MDSCs, which infiltrate and expand in NSCLC tissues but not in healthy donors, secret high levels of PD-L1 [17]. The levels of circulating S100A9+ MDSCs in LAC patients are correlated with a

Figure 4. Block of Hdc+ PMN-MDSCs-derived Wnts attenuated p63 expression. (A) At 6 weeks, tamoxifen chow induced the ablation of Hdc+ PMN-MDSCs-derived Wnts in porcupineflox/flox transgenic mice. Hdc+ cells were deleted by DT in the combination with tamoxifen in Hdc-CreERT2; eGFP; LSL-KrasG12D; porcupineflox/flox; DTR mice. (B) A block of Hdc+ cells or Hdc+ cells-derived Wnts decreased the number of LAC. Porcupineflox/flox only ruined the secretion of Hdc+ cells-derived Wnts, the distinction of anti-LAC abilities between three transgenic animal groups were not sig-nificant, suggesting the central role of Wnts/β-catenin pathway. (C) In line with Wnts levels, p63+ rates decreased in transgenic animals. ***P < 0.001; n.s., not significant (B and C).


5829 Int J Clin Exp Med 2020;13(8):5823-5830

poor prognosis and treatment response [19]. Our previous studies indicated that Hdc+ PMN-MDSCs facilitated the tumorigenesis and pro-gression of colon cancer [20, 21]. The tendency of Hdc+ PMN-MDSCs towards p63+ LAC tis-sues suggests a close relationship between microenvironment immune cells and cancer cells. Consistent with previous studies, Hdc+ PMN-MDSCs expresses high levels of Wnts, including Wnt1, Wnt2, Wnt3, and Wnt8a, to aberrantly activate Wnt/β-catenin signaling in p63+ LAC cells. Ablation of Hdc+ PMN-MDSCs in DTR transgenic mice significantly decreased the incidence of LAC and the percentage of p63+ cases. Similar results were obtained in Hdc-CreERT2; porcupineflox/flox mice, in which Hdc+ myeloid cells were unable to synthesize Wnts.

In conclusion, we have identified a subpopulation of LAC with a poor prognosis character-ized by positive nuclear expression of p63. We demonstrated that Hdc+ PMN-MDSCs are recruited to and expand in tumor tissues with a significant tendency towards p63+ cells. Sever- al canonical Wnts ligands, including Wnt1, Wnt2, Wnt3, and Wnt8a, are upregulated in Hdc+ PMN-MDSCs. The close spatial relation-ship between Hdc+ PMN-MDSCs and p63+ LAC cells endows the immune cells with the ability to regulate the behaviors of malignant cells in a paracrine-like pattern. Abolishing of Hdc+ PMN-MDSCs or blocking of Hdc+ PMN-MDSC-derived Wnts in transgenic mice attenuated the tumor burden and p63+ rate in LAC models, suggesting a promising prospect for anti-LAC clinical treatment on the basis of targeting Hdc+ PMN-MDSCs.

Acknowledgements

This work was supported by the National Sci- ence Foundation of China (81770624, 8186- 0490), and the Science Foundation of Jiangxi Province for Distinguished Young Scholars, China (20192BCB23025).

Disclosure of conflict of interest

None.

Address correspondence to: Huan Deng, Depart- ment of Pathology, The Fourth Affiliated Hospital of Nanchang University, 133 South Guangchang Road, Nanchang, Jiangxi, China. Tel: +86-791-87022537; Fax: +86-791-87022537; E-mail: [email protected]

References

[1] Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, Yu XQ and He J. Cancer statis-tics in China, 2015. CA Cancer J Clin 2016; 66: 115-132.

[2] Siegel RL, Miller KD and Jemal A. Cancer sta-tistics, 2020. CA Cancer J Clin 2020; 70: 7-30.

[3] Kelsey CR, Marks LB, Hollis D, Hubbs JL, Ready NE, D’Amico TA and Boyd JA. Local recurrence after surgery for early stage lung cancer: an 11-year experience with 975 patients. Cancer 2009; 115: 5218-5227.

[4] Yang A, Kaghad M, Wang Y, Gillett E, Fleming MD, Dotsch V, Andrews NC, Caput D and McKe-on F. p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell 1998; 2: 305-316.

[5] Gressner O, Schilling T, Lorenz K, Schulze Schleithoff E, Koch A, Schulze-Bergkamen H, Lena AM, Candi E, Terrinoni A, Catani MV, Oren M, Melino G, Krammer PH, Stremmel W and Muller M. TAp63alpha induces apoptosis by activating signaling via death receptors and mitochondria. EMBO J 2005; 24: 2458-2471.

[6] Massion PP, Taflan PM, Jamshedur Rahman SM, Yildiz P, Shyr Y, Edgerton ME, Westfall MD, Roberts JR, Pietenpol JA, Carbone DP and Gon-zalez AL. Significance of p63 amplification and overexpression in lung cancer development and prognosis. Cancer Res 2003; 63: 7113-7121.

[7] Koster MI, Lu SL, White LD, Wang XJ and Roop DR. Reactivation of developmentally expressed p63 isoforms predisposes to tumor develop-ment and progression. Cancer Res 2006; 66: 3981-3986.

[8] Sheikh HA, Fuhrer K, Cieply K and Yousem S. p63 expression in assessment of bronchioloal-veolar proliferations of the lung. Mod Pathol 2004; 17: 1134-1140.

[9] Zhang Y, Goss AM, Cohen ED, Kadzik R, Lepore JJ, Muthukumaraswamy K, Yang J, DeMayo FJ, Whitsett JA, Parmacek MS and Morrisey EE. A Gata6-Wnt pathway required for epithelial stem cell development and airway regenera-tion. Nat Genet 2008; 40: 862-870.

[10] Nekulova M, Holcakova J, Coates P and Vojte-sek B. The role of p63 in cancer, stem cells and cancer stem cells. Cell Mol Biol Lett 2011; 16: 296-327.

[11] Heuvers ME, Muskens F, Bezemer K, Lambers M, Dingemans AC, Groen HJM, Smit EF, Hoog-steden HC, Hegmans JPJJ and Aerts JGJV. Argi-nase-1 mRNA expression correlates with my-eloid-derived suppressor cell levels in per- ipheral blood of NSCLC patients. Lung Cancer 2013; 81: 468-474.

mailto:[email protected]

mailto:[email protected]


5830 Int J Clin Exp Med 2020;13(8):5823-5830

[12] de Goeje PL, Bezemer K, Heuvers ME, Dinge-mans AC, Groen HJ, Smit EF, Hoogsteden HC, Hendriks RW, Aerts JG and Hegmans JP. Immu-noglobulin-like transcript 3 is expressed by myeloid-derived suppressor cells and corre-lates with survival in patients with non-small cell lung cancer. Oncoimmunology 2015; 4: e1014242.

[13] Saha S, Aranda E, Hayakawa Y, Bhanja P, Atay S, Brodin NP, Li J, Asfaha S, Liu L, Tailor Y, Zhang J, Godwin AK, Tome WA, Wang TC, Guha C and Pollard JW. Macrophage-derived extra-cellular vesicle-packaged WNTs rescue intesti-nal stem cells and enhance survival after radi-ation injury. Nat Commun 2016; 7: 13096.

[14] Jackson EL, Willis N, Mercer K, Bronson RT, Crowley D, Montoya R, Jacks T and Tuveson DA. Analysis of lung tumor initiation and pro-gression using conditional expression of onco-genic K-ras. Genes Dev 2001; 15: 3243-3248.

[15] Yang A, Schweitzer R, Sun D, Kaghad M, Walk-er N, Bronson RT, Tabin C, Sharpe A, Caput D, Crum C and McKeon F. p63 is essential for re-generative proliferation in limb, craniofacial and epithelial development. Nature 1999; 398: 714-718.

[16] Koster MI, Kim S, Mills AA, DeMayo FJ and Roop DR. p63 is the molecular switch for initia-tion of an epithelial stratification program. Genes Dev 2004; 18: 126-131.

[17] Yamauchi Y, Safi S, Blattner C, Rathinasamy A, Umansky L, Juenger S, Warth A, Eichhorn M, Muley T, Herth FJF, Dienemann H, Platten M, Beckhove P, Utikal J, Hoffmann H and Uman-sky V. Circulating and tumor myeloid-derived suppressor cells in resectable non-small cell lung cancer. Am J Respir Crit Care Med 2018; 198: 777-787.

[18] Quail DF and Joyce JA. Microenvironmental regulation of tumor progression and metasta-sis. Nat Med 2013; 19: 1423-1437.

[19] Feng PH, Yu CT, Chen KY, Luo CS, Wu SM, Liu CY, Kuo LW, Chan YF, Chen TT, Chang CC, Lee CN, Chuang HC, Lin CF, Han CL, Lee WH and Lee KY. S100A9(+) MDSC and TAM-mediated EGFR-TKI resistance in lung adenocarcinoma: the role of RELB. Oncotarget 2018; 9: 7631-7643.

[20] Yang XD, Ai W, Asfaha S, Bhagat G, Friedman RA, Jin G, Park H, Shykind B, Diacovo TG, Falus A and Wang TC. Histamine deficiency promotes inflammation-associated carcinogenesis through reduced myeloid maturation and accumu-lation of CD11b+Ly6G+ immature myeloid cells. Nat Med 2011; 17: 87-95.

[21] Chen X, Takemoto Y, Deng H, Middelhoff M, Friedman RA, Chu TH, Churchill MJ, Ma Y, Nagar KK, Tailor YH, Mukherjee S and Wang TC. Histidine decarboxylase (HDC)-expressing granulocytic myeloid cells induce and recruit Foxp3(+) regulatory T cells in murine colon cancer. Oncoimmunology 2017; 6: e1290034.

Original Article Myeloid-derived suppressor cells promote the ...5824 Int J Clin Exp Med...

Documents

Transcript of Original Article Myeloid-derived suppressor cells promote the ...5824 Int J Clin Exp Med...