Int J Clin Exp Med 2017;10(12):16144-16153www.ijcem.com /ISSN:1940-5901/IJCEM0057958

Original ArticleInterleukin-1β induces metabolic and reactive oxygen species changes and apoptosis in annulus fibrosus cells

Xing Yang1,2,3*, Lei Wang1,2*, Zhangqin Yuan1,2, Pinghui Zhou1,2, Genglei Chu1,2, Bin Li1,2, Junying Sun1

1Department of Orthopaedics, The First Affiliated Hospital of Soochow University, Suzhou, Jiangsu, China; 2Or-thopedic Institute, Soochow University, Suzhou, Jiangsu, China; 3Changshu No.1 People’s Hospital, Changshu, Jiangsu, China. *Equal contributors.

Received May 21, 2017; Accepted November 7, 2017; Epub December 15, 2017; Published December 30, 2017

Abstract: Degeneration of the annulus fibrosus (AF), a critical load-bearing component of the intervertebral disc (IVD), commonly leads to degenerative disc disease (DDD). To investigate the potential effects of interleukin (IL)-1β on AF cells, we evaluated metabolism, intracellular reactive oxygen species (ROS), and apoptosis of these cells in vitro. Four experimental groups, one control group and three treatment groups treated with 1, 10 or 100 ng/ml IL-1β, were examined in this study. After 24 or 48 h, the proliferation and cell cycling of AF cells were not apparently affected by IL-1β treatment. However, significant upregulation of ADAMTS4 and downregulation of aggrecan were seen in all treatment groups. Depending on the treatment time, IL-6, TIMP-1, MMP3, and ADAMTS5 expression was upregulated significantly, while Col-I, Col-II, and TIMP2 expression was significantly downregulated in certain groups (mostly in 10 and 100 ng/ml treatment groups). In addition, IL-1β significantly increased intracellular ROS levels in AF cells. Importantly, apoptosis of AF cells was increased significantly by IL-1β treatment. Taken together, our results demonstrated that IL-1β induced significant inflammatory reactions in AF cells, leading to metabolic and ROS level changes and increased apoptosis, which suggest the involvement of inflammation in DDD development.

Keywords: Annulus fibrosus cells, intervertebral disc, inflammation, IL-1β, apoptosis

Introduction

Low back pain is a common musculoskeletal disorder affecting the quality of life in adults with a tremendous socioeconomic impact [1]. The intervertebral disc (IVD) plays an important role in maintaining mechanical functions, and IVD degeneration is the main reason for low back pain [2]. Numerous studies have suggest-ed a correlation between degenerative disc dis-ease (DDD) and loss of disc extracellular matrix (ECM) caused by perturbed ECM homeostasis [3, 4]. In addition, enzymes mediating ECM deg-radation, including matrix metalloproteinases (MMPs), are upregulated during IVD degenera-tion and aging, which may lead to increased ECM degradation [5-7]. Inflammation is regard-ed as a response to tissue injury and plays a vital role in the physiopathology of tissues including IVDs [8]. Indeed, IVD diseases are usually correlated to increased levels of proin-flammatory cytokines, such as interleukin (IL)-1β, IL-6, and tumor necrosis factor-α (TNF-α),

within the disc. For example, a study from LeMaitre et al. showed that degenerated discs from clinical patients with chronic back pain had higher IL-1β and TNF-α expression than the non-degenerated discs [9]. Surgical samples from DDD patients also showed higher levels of TNF-α positive cell than those from the normal group [10]. Therefore, inflammatory mediators appear to play a critical role in DDD and possi-bly DDD-related back pain.

Apart from the changes in inflammation and metabolism involved in DDD development, excessive apoptosis of disc cells is also pivotal in DDD, which frequently contributes to neck or low back pain [11]. Numerous factors, including abnormal mechanical stresses [12, 13], IL-1β [14], and serum withdrawal [15], can lead to apoptosis of IVD cells both in vivo and in vitro.

The IVD is mainly composed of two distinct components, the inner nucleus pulposus (NP) and outer annulus fibrosus (AF). The integrity of

Interleukin-1β induces metabolic changes

16145 Int J Clin Exp Med 2017;10(12):16144-16153

AF is critical for maintenance of intradiscal pressure and confining the NP, a fundamental requirement to maintain the structure and physiological functions of IVDs [16, 17]. AF defects may induce mechanical strain concen-tration, cell death, and proinflammatory cyto-kine production [18, 19]. Previous studies have suggested that IL-1β is a significant catabolic cytokine in IVDs, which not only increases matrix-degrading enzyme activity, but also enhances apoptosis in NP and AF tissues [20, 21]. IL-1β also increases the sensitivity of AF cells to mechanical stress [22]. In a recently published study, Oh and his colleagues used a ROCK inhibitor to immortalize rat AF cells and successfully established an AF cell line [23]. This cell line is useful to understand the mecha-nisms of DDD. To understand the potential effects of IL-1β on AF cell biology, we investi-gated the responses of AF cells cultured in an in vitro inflammatory environment that partially mimicked the diseased disc microenvironment. The effects of inflammation on AF cell metabo-lism, intracellular reactive oxygen species (ROS) levels, and apoptosis were examined in this study.

Materials and methods

AF cell line and culture conditions

The rat AF cell line was a generous gift from Prof. Di Chen (Rush University) [23]. The cells were cultured in Dulbecco’s modified Eagle’s medium/Ham’s F-12 (1:1) (Hyclone, GE, USA) supplemented with 20% fetal bovine serum (FBS) (Gibco, Thermo, USA), and 1% penicillin and streptomycin at 37°C with 5% CO2.

Treatment of cells with IL-1β

At 80-90% confluence, cells were trypsinized, seeded into appropriate culture plates, and cul-tured as described previously. Recombinant human IL-1β was from Prospec-TanyTechnogene Ltd (Suzhou Ketone Bio-Pharma Co., Ltd). Four experimental groups were established, one control and three treatment groups. In the three treatment groups, 1, 10 or 100 ng/ml IL-1β was added to the medium. The cells were then incubated for 24 or 48 h. Cultures without added IL-1β served as the control group. Cells from all groups were incubated at 37°C in a humidified atmosphere with 5% CO2.

Cell viability assays

Cells were seeded at 2,000 per well in 96-well plates. Cell viability was assessed using a Cell Counting Kit-8 (CCK-8) (Beyotime, Shanghai, China) following the manufacturer’s instruc-tions. Three independent experiments were performed.

Colony formation assay

Cells were seeded in six-well plates at 1,000 cells/well and cultured for 14 days to allow col-ony formation. After incubation, cells were washed with PBS and fixed with methanol. After further rinsing with PBS twice, cells were stained with 0.1% crystal violet. Visible colo-nies were then counted manually.

Expression analysis and quantitative real-time PCR

Expression of ECM and metabolic genes (Col-I, Col-II, aggrecan, MMP-3, TIMP1, TIMP2, ADAMTS4, and ADAMTS5) and the inflammato-ry gene IL-6 was analyzed by quantitative real-time PCR (qRT-PCR). Total RNA was extracted from cells with an RNA Simple Total RNA Kit (Tiangen, Beijing, China). cDNA was prepared from the mRNA using a Thermo Scientific RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). Quantitative qPCR was performed using prim-ers, cDNA, and a QuantiNova™ SYBR Green PCR Kit (Qiagen). Real-time PCR amplifications were performed with a CFX96 system accord-ing to the following protocol: 95°C for 15 min, followed by 40 cycles of amplification, each consisting of a denaturation step at 94°C for 15 s, an annealing step at 55°C for 30 s, and an extension step at 72°C for 30 s. GAPDH was used as an internal control. Values for all target genes were normalized to internal control values. The fold changes were calculated according to the relative quantification method (RQ = 2-ΔΔCT). Primer sequences are shown in Table 1.

Western blot analysis

For western blot analyses, total proteins were extracted from cultured cells and then quanti-tated using a bicinchoninic acid assay kit (Pierce, Rockford, IL) with bovine serum albu-min as the standard. Proteins were fractionat-

Interleukin-1β induces metabolic changes

16146 Int J Clin Exp Med 2017;10(12):16144-16153

ed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to a polyvinyli-dene fluoride membrane, blocked in 5% dry milk at room temperature for 1 h, and immu-nostained overnight at 4°C using antibodies against aggrecan or MMP-3 (Proteintech Group, USA). An antibody against GAPDH (Proteintech Group, USA) was used for the loading control.

Flow cytometry analyses of apoptosis, cell cycle, and ROS levels

The apoptotic rate was measured by flow cytometry using an Annexin V-FITC/PI kit (Beyotime, Shanghai, China). After treatment with or without IL-1β (1, 10 or 100 ng/ml) for 24 or 48 h, cells were trypsinized, centrifuged, and washed in PBS at 4°C. The washed cells were resuspended in binding buffer at a density of 1×106 cells/ml. The cells were then stained with 5 μl Annexin VFITC and 10 μl propidium iodide (PI) in the dark at room temperature for 15 min. A 400 ml aliquot of the buffer was added to the resuspended AF cells that were then analyzed by flow cytometry to detect the apoptotic fraction in each sample. Cell cycle profiles were determined by analyzing DNA con-tent using PI staining. To measure intracellular ROS levels, AF cells were loaded with the indicator dye from the Reactive Oxygen Sp- ecies Assay kit (TIANDZ, Beijing, China) and incubated on a shaker at 37°C for 30 min. Intracellular ROS levels were then estimated by flow cytometry, following the manufacturer’s protocol.

Statistical analysis

Statistical analyses were performed using SPSS 17.0. All data are presented as the means ± standard error of the mean (SEM). Comparisons were made by one-way analysis

using the CCK-8 assay. Compared with the con-trol group, cell proliferation was not significant-ly affected by all concentrations of IL-1β treat-ment during the first 4 days (Figure 1A). On day 5, the proliferation of cells treated with 100 ng/ml IL-1β was significantly decreased compared with that of the control group. However, there were no significant differences between the other groups and the control group. After treat-ment with IL-1β, the number of colonies in 10 and 100 ng/ml groups was much smaller than that in the control group (Figure 1B, 1C). To test whether IL-1β affected the cell cycle, we used flow cytometry to analyze AF cells before and after IL-1β treatment for 24 or 48 h. As a result, there was no significant difference in the per-centage of cells in G1 and G2 phases among all groups, indicating that IL-1β treatment did not apparently affect AF cell cycling (Figure 1D-G).

IL-1β induces apoptosis of AF cells

Cell apoptosis was detected by flow cytometry using double staining by annexin V and PI. There was an increase in the percentage of apoptotic cells treated with all doses of IL-1β for 24 h (Figure 2A, 2B). The apoptotic rate in the control group was 2.3 ± 0.5%, which increased to 6.5 ± 0.2%, 10.4 ± 0.7%, and 11.1 ± 0.4% after IL-1β treatments at 1, 10, and 100 ng/ml for 24 h, respectively. After 48 h of treat-ment, cell apoptosis showed a similar trend with apoptotic rates of 3.8 ± 0.5%, 11.1 ± 0.4%, 21.3 ± 0.7%, and 24.4 ± 0.6%, respectively (Figure 2C, 2D).

IL-1β increases intracellular ROS levels

To further investigate whether IL-1β affects the AF microenvironment, we used flow cytom-etry to measure intracellular ROS levels. Flow cytometry results confirmed that intracellu-

Table 1. Primer sequences used for genes analyzed in this study Target Forward Primer (5’→3’) Reverse Primer (3’→5’)Col-I TTCTGAAACCCTCCCCTCTT CCACCCCAGGGATAAAAACTCol-II CGAGGTGACAAAGGAGAAGC AGGGCCAGAAGTACCCTGATAggrecan AGACACCCCTACCCTTGCTT AAAGTGTCCAAGGCATCCACMMP-3 GGAAGCCAGTGGAAATGAAA ATGCAATGGGTAGGATGAGCTIMP1 TGCAACTCGGACCTGGTTAT ACAGCGTCGAATCCTTTGAGTIMP2 GCATCACCCAGAAGAAGAGC GTCCATCCAGAGGCACTCATADAMTS4 GCCCGATTCATCACTGACTT GCGGTCAGCATCATAGTCCTADAMTS5 CTTCAGCCACGATCACAGAA CTGGGTGGCATCATAGGTCTIL-6 CACAGAGGATACCACCCACA CAGAATTGCCATTGCACAAC

of variance (ANOVA) followed with independent sample t test. P-values of less than 0.05 were considered to be statistically significant.

Results

IL-1β partly inhibits AF cell pro-liferation and colony formation, but does not affect cell cycling

We first examined the effects of IL-1β on AF cell proliferation

Interleukin-1β induces metabolic changes

16147 Int J Clin Exp Med 2017;10(12):16144-16153

lar ROS levels were significantly increased in all treatment groups, except for the 1 ng/ml IL-1β, 24 h group. Compared with control cells

(250.3 ± 38.0), ROS signals were significantly increased by IL-1β to 344.5 ± 32.5 (10 ng/ml) and 465.3 ± 29.3% (100 ng/ml) after IL-1β

Figure 1. Effects of various IL-1β concentrations on proliferation and cell cycling of AF cells. Various concentrations of IL-1β did not significantly affect cell proliferation (A). The relative number of colonies was calculated at 14 days after seeding (B). Representative images of cell colonies (C). Percentages of AF cells at G2 phase after treatment with various concentrations of IL-1β and representative cell cycle images at 24 h (D, E) and 48 h (F, G).

Interleukin-1β induces metabolic changes

16148 Int J Clin Exp Med 2017;10(12):16144-16153

treatment for 24 h (Figure 3A, 3B). After 48 h of treatment, the ROS intensity was increased significantly with intensities of 470.3 ± 27.1 (1 ng/ml), 707.7 ± 38.5 (10 ng/ml), and 914.7 ± 65.3 (100 ng/ml), respectively (Figure 3C, 3D).

IL-1β induces the gene expression of proin-flammatory cytokine IL-6

Compared with the control group, IL-6 was sig-nificantly upregulated in groups treated with 10 or 100 ng/ml IL-1β for 24 or 48 h. IL-6 expres-sion was also significantly elevated in cells receiving 1 ng/ml IL-1β for 48 h. However, this effect was not observed in cells treated with 1 ng/ml IL-1β for 24 h (Figure 4A).

IL-1β treatment down-regulates ECM gene expression

qRT-PCR results demonstrated significant do- wnregulation of aggrecan in all treatment groups after both 24 and 48 h (Figure 4B). In

addition, western blotting showed a similar trend in expression of aggrecan after treatment with IL-1β for 48 h (Figure 4C, 4D). Compared with the control group, Col-I was significantly downregulated in groups treated with 10 or 100 ng/ml IL-1β at both time points. In con-trast, after treatment with 1 ng/ml IL-1β, no sig-nificant changes were found in Col-I expression at either time point (Figure 4E). Compared with the control group, Col-II was significantly down-regulated at both time points by 10 or 100 ng/ml IL-1β. A similar trend was also observed in groups treated with 1 ng/ml IL-1β for 48 h, but not in those treated for 24 h (Figure 4F).

IL-1β regulates the expression of metabolism-related genes

To evaluate the effects of IL-1β on expression of some key genes involved in DDD, we exam-ined expression of MMP-3, TIMP-1, TIMP-2, ADAMTS4, and ADAMTS5. qRT-PCR results

Figure 2. Apoptotic indices of AF cells treated with various concentrations of IL-1β for 24 h (A). Representative apop-tosis data of AF cells treated with various concentrations of IL-1β for 24 h obtained by flow cytometry (B). Apoptotic indices of AF cells treated with various concentrations of IL-1β for 48 h (C). Representative apoptosis data of AF cells treated with various concentrations of IL-1β for 48 h obtained by flow cytometry (D). All data are means ± SEM of at least three independent experiments. *P < 0.05 vs. control, **P < 0.01 vs. control.

Interleukin-1β induces metabolic changes

16149 Int J Clin Exp Med 2017;10(12):16144-16153

showed significant upregulation of ADAMTS4 in all treatment groups at both time points (Figure 5A). Compared with the control group, only 10 and 100 ng/ml IL-1β caused significant upregu-lation of TIMP-1 after treatment for 24 or 48 h (Figure 5B). In addition, MMP-3 was significant-ly upregulated in all treatment groups except the 1 ng/ml group after 24 h of IL-1β treatment (Figure 5C). We also performed western blot-ting, and the results showed that the expres-sion of MMP-3 was significantly increased after 1L-1β treatment for 48 h (Figure 5D, 5E). There were no significant differences in TIMP-2 expression among all groups at the 24 h time point. However, there was a significant decrease in TIMP-2 expression after IL-1β treatment for 48 h (Figure 5F). Regarding ADAMTS5, there

was upregulation in the 10 and 100 ng/ml treated groups at 48 h (Figure 5G).

Discussion

Although chronic low back pain is a common debilitating disorder with serious socioeconom-ic consequences, the causes of disc degenera-tion, especially its molecular events and cellu-lar changes, are poorly understood. In this study, we investigated whether IL-1β induced any potentially relevant effects in AF cells in vitro, including inflammatory reactions, meta-bolic and microenvironmental changes, and finally apoptosis.

Previous studies have suggested a correlation between increases in cell death and degenera-

Figure 3. Intensities of ROS signals in AF cells treated with various concentrations of IL-1β for 24 h (A). Representa-tive ROS intensity signals in AF cells treated with various concentrations of IL-1β for 24 h obtained by flow cytometry (B). Intensities of ROS signals in AF cells treated with various concentrations of IL-1β for 48 h (C). Representative ROS intensity signals in AF cells treated with various concentrations of IL-1β for 48 h obtained by flow cytometry (D). All data are means ± SEM of at least three independent experiments. *P < 0.05 vs. control, **P < 0.01 vs. control.

Interleukin-1β induces metabolic changes

16150 Int J Clin Exp Med 2017;10(12):16144-16153

tive IVDs [24, 25]. The supply of nutrients has been found to deteriorate during DDD [26], while IL-1β levels increase [27, 28]. In a study by Zhao et al., IL-1β enhanced the effects of serum deprivation on apoptosis in rat annular cells

[20]. Another study showed that treatment with 75 ng/ml IL-1β induced apoptosis [29]. Consistent with these results, our data also showed that IL-1β induced apoptosis of AF cells in vitro.

Figure 4. Real-time PCR analyses of IL-6 (A) and aggrecan (B) expression. The expression level of aggrecan was de-tected by western blot analysis (C, D). Real-time PCR analyses of Col-I (E) and Col-II (F) expression were performed in cells treated with various concentrations of IL-1β for the indicated times. Average expression values were normal-ized to those of GAPDH. All data are means ± SEM of at least three independent experiments. *P < 0.05 vs. control, **P < 0.01 vs. control.

Figure 5. Real-time PCR analysis of ADAMTS4 (A), TIMP-1 (B) and MMP-3 (C) expression. The expression level of MMP-3 was detected by western blot analysis (D, E). Real-time PCR analyses of TIMP2 (F) and ADAMTS5 (G) expres-sion were performed in cells treated with various concentrations of IL-1β for the indicated times.

Interleukin-1β induces metabolic changes

16151 Int J Clin Exp Med 2017;10(12):16144-16153

There is growing evidence that IL-1β induces synthesis of ECM-degrading enzymes and reduces synthesis of proteoglycans, Col-I, and Col-II [27, 30-32]. Le Maitre et al. [27] demon-strated that IL-1β produced by native disc cells induces both ECM and cellular changes in IVD degeneration. Another study from Hoyland et al. [21] indicated that IL-1β increased enzymat-ic activity and an IL-1β inhibitor decreased enzymatic activity, suggesting a key regulatory role of IL-1β in ECM degradation. Consistent with these studies, our study also indicated changes in the expression of metabolism-relat-ed genes induced by IL-1β. Compared with the control group, IL-1β stimulated expression of MMP-3 and TIMP-1, and suppressed that of Col-I, Col-II, and aggrecan.

ROS are oxygen-containing molecules, includ-ing superoxide anion (O2-), hydroxyl radical (OH), hydrogen peroxide (H2O2), and nitric oxide (NO), which are produced during cellular meta- bolism and can diffuse through membranes. Overproduction of ROS may perturb the normal balance between prooxidants and antioxidants in cells, and damage DNA, proteins, and lipids [33]. Several previous studies have indicated a relationship between bone biology and redox balance regulation, implying a major role of ROS in osteoporosis [34, 35]. Other studies suggested that ROS induces chondrocyte death and matrix degradation, contributing to the progression of osteoarthritis [36]. In degen-erative IVD, excessive ROS may exert a cata-bolic effect on AF cells through mitogen-activat-ed protein kinase signaling [33]. In our pre- sent study, we also showed that intracellular ROS levels were increased in AF cells treated with IL-1β. These observations indicated that ROS might play an important role in the de- velopment of musculoskeletal degenerative diseases.

A major limitation of this study is the use of a rat AF cell line in vitro. This approach was cho-sen to ensure homogeneous effects of IL-1β without influences of other clinical characteris-tics, such as gender, age, and medications, which are related to the use of patient samples. Nevertheless, our findings should be confirmed in such patient samples to determine their clini-cal relevance. In addition, we focused our experiments on the effect of inflammation on AF cell proliferation, apoptosis, and metabo-

lism. Thus, we did not study the effects of mechanical stress, which can also play a vital role in regulation of AF cells.

Conclusions

Our study showed that IL-1β induced an inflam-matory reaction in AF cells, which provides an in vitro model for IVD degeneration, resulting in changes in metabolism and ROS levels. Fur- thermore, IL-1β at certain concentrations pro-moted apoptosis in this system. These findings clearly indicate a potential role of inflammation in the development of DDD.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (gr- ant numbers 31530024, 81672213, and 81472060), National Key Research and De- velopment Program (grant number 2016YFC- 1100203), Jiangsu Provincial Special Pro- gram of Medical Science (grant number BL2012004), Jiangsu Provincial Clinical Orth- opedic Center, and the Priority Academic Program Development (PAPD) of Jiangsu Higher Education Institutions.

Disclosure of conflict of interest

None.

Address correspondence to: Junying Sun, De partment of Orthopaedics, The First Affiliated Hospital of Soochow University, 188 Shizi St, Rm 103 Bldg 8, Suzhou 215000, Jiangsu, China. Tel: +86-512-67780101; Fax: +86-512-6778-1163; E-mail: sjysuzhou@126.com; Bin Li, Orthopedic Institute, Soochow University, 708 Renmin Rd, Rm 308 Bldg 1, Soochow University (South Campus), Suzhou 215007, Jiangsu, China. Tel: +86-512-67781163; Fax: +86-512-6778-1163; E-mail: binli@suda.edu.cn

References

[1] Andersson GB. Epidemiological features of chronic low-back pain. Lancet 1999; 354: 581-585.

[2] Loreto C, Musumeci G, Castorina A, Loreto C and Martinez G. Degenerative disc disease of herniated intervertebral discs is associated with extracellular matrix remodeling, vimentin-positive cells and cell death. Ann Anat 2011; 193: 156-162.

Interleukin-1β induces metabolic changes

16152 Int J Clin Exp Med 2017;10(12):16144-16153

[3] Molinos M, Almeida CR, Caldeira J, Cunha C, Goncalves RM and Barbosa MA. Inflammation in intervertebral disc degeneration and regen-eration. J R Soc Interface 2015; 12: 20150429.

[4] Wuertz K, Vo N, Kletsas D and Boos N. Inflam-matory and catabolic signalling in interverte-bral discs: the roles of NF-kappaB and MAP ki-nases. Eur Cell Mater 2012; 23: 103-119.

[5] Cui Y, Yu J, Urban JP and Young DA. Differential gene expression profiling of metalloproteinas-es and their inhibitors: a comparison between bovine intervertebral disc nucleus pulposus cells and articular chondrocytes. Spine 2010; 35: 1101-1108.

[6] Roberts S, Caterson B, Menage J, Evans EH, Jaffray DC and Eisenstein SM. Matrix metallo-proteinases and aggrecanase: their role in dis-orders of the human intervertebral disc. Spine 2000; 25: 3005-3013.

[7] Weiler C, Nerlich AG, Zipperer J, Bachmeier BE and Boos N. Expression of major matrix metal-loproteinases is associated with intervertebral disc degradation and resorption. Eur Spine J 2002; 11: 308-320.

[8] Medzhitov R. Origin and physiological roles of inflammation. Nature 2008; 454: 428-435.

[9] Le Maitre CL, Hoyland JA and Freemont AJ. Catabolic cytokine expression in degenerate and herniated human intervertebral discs: IL-1beta and TNFalpha expression profile. Arthri-tis Res Ther 2007; 9: R77.

[10] Bachmeier BE, Nerlich AG, Weiler C, Paesold G, Jochum M and Boos N. Analysis of tissue distri-bution of TNF-alpha, TNF-alpha-receptors, and the activating TNF-alpha-converting enzyme suggests activation of the TNF-alpha system in the aging intervertebral disc. Ann N Y Acad Sci 2007; 1096: 44-54.

[11] Zhao CQ, Wang LM, Jiang LS and Dai LY. The cell biology of intervertebral disc aging and de-generation. Ageing Res Rev 2007; 6: 247-261.

[12] Zhang YH, Zhao CQ, Jiang LS and Dai LY. Cyclic stretch-induced apoptosis in rat annulus fibro-sus cells is mediated in part by endoplasmic reticulum stress through nitric oxide produc-tion. Eur Spine J 2011; 20: 1233-1243.

[13] Ding F, Shao ZW, Yang SH, Wu Q, Gao F and Xiong LM. Role of mitochondrial pathway in compression-induced apoptosis of nucleus pulposus cells. Apoptosis 2012; 17: 579-590.

[14] Duan DY, Yang SH, Xiong XQ, Shao ZW and Wang H. Interleukin-6 protects annulus fibro-sus cell from apoptosis induced by interleu-kin-1 beta in vitro. Chin Med Sci J 2006; 21: 107-110.

[15] Risbud MV, Fertala J, Vresilovic EJ, Albert TJ and Shapiro IM. Nucleus pulposus cells upreg-ulate PI3K/Akt and MEK/ERK signaling path-

ways under hypoxic conditions and resist apoptosis induced by serum withdrawal. Spine 2005; 30: 882-889.

[16] Vergroesen PP, Kingma I, Emanuel KS, Hoogen-doorn RJ, Welting TJ, van Royen BJ, van Dieen JH and Smit TH. Mechanics and biology in in-tervertebral disc degeneration: a vicious circle. Osteoarthritis Cartilage 2015; 23: 1057-1070.

[17] Li J, Liu C, Guo Q, Yang H and Li B. Regional variations in the cellular, biochemical, and bio-mechanical characteristics of rabbit annulus fibrosus. PLoS One 2014; 9: e91799.

[18] Walter BA, Korecki CL, Purmessur D, Roughley PJ, Michalek AJ and Iatridis JC. Complex load-ing affects intervertebral disc mechanics and biology. Osteoarthritis Cartilage 2011; 19: 1011-1018.

[19] Zhu C, Li J, Liu C, Zhou P, Yang H and Li B. Mod-ulation of the gene expression of annulus fibro-sus-derived stem cells using poly(ether car-bonate urethane)urea scaffolds of tunable elasticity. Acta Biomater 2016; 29: 228-238.

[20] Zhao CQ, Liu D, Li H, Jiang LS and Dai LY. Inter-leukin-1beta enhances the effect of serum de-privation on rat annular cell apoptosis. Apopto-sis 2007; 12: 2155-2161.

[21] Hoyland JA, Le Maitre C and Freemont AJ. In-vestigation of the role of IL-1 and TNF in matrix degradation in the intervertebral disc. Rheu-matology 2008; 47: 809-814.

[22] Elfervig MK, Minchew JT, Francke E, Tsuzaki M and Banes AJ. IL-1beta sensitizes interverte-bral disc annulus cells to fluid-induced shear stress. J Cell Biochem 2001; 82: 290-298.

[23] Oh CD, Im HJ, Suh J, Chee A, An H and Chen D. Rho-associated kinase inhibitor immortalizes rat nucleus pulposus and annulus fibrosus cells: establishment of intervertebral disc cell lines with novel approaches. Spine 2016; 41: E255-261.

[24] Gruber HE and Hanley EN Jr. Analysis of aging and degeneration of the human intervertebral disc. Comparison of surgical specimens with normal controls. Spine 1998; 23: 751-757.

[25] Boos N, Weissbach S, Rohrbach H, Weiler C, Spratt KF and Nerlich AG. Classification of age-related changes in lumbar intervertebral discs: 2002 Volvo Award in basic science. Spine 2002; 27: 2631-2644.

[26] Roberts S, Urban JP, Evans H and Eisenstein SM. Transport properties of the human carti-lage endplate in relation to its composition and calcification. Spine 1996; 21: 415-420.

[27] Le Maitre CL, Freemont AJ and Hoyland JA. The role of interleukin-1 in the pathogenesis of hu-man intervertebral disc degeneration. Arthritis Res Ther 2005; 7: R732-745.

[28] Takahashi H, Suguro T, Okazima Y, Motegi M, Okada Y and Kakiuchi T. Inflammatory cyto-

Interleukin-1β induces metabolic changes

16153 Int J Clin Exp Med 2017;10(12):16144-16153

kines in the herniated disc of the lumbar spine. Spine 1996; 21: 218-224.

[29] Wang H, Ding W, Yang D, Gu T, Yang S and Bai Z. Different concentrations of 17beta-estradiol modulates apoptosis induced by interleukin-1beta in rat annulus fibrosus cells. Mol Med Rep 2014; 10: 2745-2751.

[30] Kang JD, Georgescu HI, McIntyre-Larkin L, Ste-fanovic-Racic M, Donaldson WF 3rd and Evans CH. Herniated lumbar intervertebral discs spontaneously produce matrix metalloprotein-ases, nitric oxide, interleukin-6, and prosta-glandin E2. Spine 1996; 21: 271-277.

[31] Weiler C, Nerlich AG, Bachmeier BE and Boos N. Expression and distribution of tumor necro-sis factor alpha in human lumbar interverte-bral discs: a study in surgical specimen and autopsy controls. Spine 2005; 30: 44-53.

[32] Jimbo K, Park JS, Yokosuka K, Sato K and Na-gata K. Positive feedback loop of interleukin-1beta upregulating production of inflammatory mediators in human intervertebral disc cells in vitro. J Neurosurg Spine 2005; 2: 589-595.

[33] Suzuki S, Fujita N, Hosogane N, Watanabe K, Ishii K, Toyama Y, Takubo K, Horiuchi K, Miya-moto T, Nakamura M and Matsumoto M. Ex-cessive reactive oxygen species are therapeu-tic targets for intervertebral disc degeneration. Arthritis Res Ther 2015; 17: 316.

[34] Bai XC, Lu D, Liu AL, Zhang ZM, Li XM, Zou ZP, Zeng WS, Cheng BL and Luo SQ. Reactive oxy-gen species stimulates receptor activator of NF-kappaB ligand expression in osteoblast. J Biol Chem 2005; 280: 17497-17506.

[35] Samelson EJ and Hannan MT. Epidemiology of osteoporosis. Curr Rheumatol Rep 2006; 8: 76-83.

[36] Henrotin Y, Kurz B and Aigner T. Oxygen and reactive oxygen species in cartilage degrada-tion: friends or foes? Osteoarthritis Cartilage 2005; 13: 643-654.