n i s e x e tiv a R - Springer Static Content Server 10.1007/s11103-016-0504... · PDF...

Click here to load reader

  • date post

    29-Apr-2018
  • Category

    Documents

  • view

    218
  • download

    1

Embed Size (px)

Transcript of n i s e x e tiv a R - Springer Static Content Server 10.1007/s11103-016-0504... · PDF...

  • Supplementary Figure1. OcXII mRNA levels in several plants from different lineages. RT-qPCR analysis of regenerated knockout plants toverify the OcXII gene silencing levels. eF1a and Ubiquitin were used as reference genes to relative expression and 2-Ct calculation. Oryzasativa Nipponbare are the control non-transformed plants (WT) and the ones indicated by an arrow have the lower levels of OcXII mRNAdetected. The plants from lineages with lower OcXII transcript levels were selected to proceed with the analyses.

    0,00

    0,20

    0,40

    0,60

    0,80

    1,00

    1,20

    WT 8a 8b 8c 8d 9a 9b 9c 9e 10a 10b 10c 10d 10e 10f 11a 11c 14a 19a 19b 19c 19d 24a 24b 24c 24e 24f

    Relativ

    eex

    pres

    sion

  • 0,020,131,008,00

    64,00512,00

    Leg1 Leg2 Leg3 Leg4 Leg5

    Nipp L9 L10 L19 L24

    Relativ

    eex

    pres

    sion

    0,00003

    0,00024

    0,00195

    0,01563

    0,12500

    1,00000

    8,00000

    OcI OcII OcIII OcIV OcVI OcVIII OcX OcXI OcXII

    Relativ

    e ex

    pres

    sion

    Nipp L9 L10 L19 L24

    a a a a a

    ababab

    b

    a

    a a a a a

    a a a ab

    a a abab

    aa a a

    aa a aab

    b

    a aab ba

    a

    bb b b

    Supplementary figure 2. Transcriptional profile of phytocystatins and legumains in T0 OcXII RNAi plants. (a)Gene expression levels of the phytocystatin family in rice were evaluated in T0 OcXII RNAi plants from fourlineages L9, L10, L19 and L24, compared to WT non-transformed plants (Nipp). The specific knockdown wasdemonstrated by RT-qPCR with 98% decrease of OcXII transcript levels in the transgenic lineages. eF1a andUbiquitin genes were used as reference genes. Letters on the bars refer to kruskal-wallis statistical test p

  • 24h

    48h

    WT RNAi L9 RNAi L10

    96h

    Supplementary Figure 3. Time course of the germination experiment showing that there is no majorphenotypical differences among WT and RNAi plants in the first 96h of the germination process.

  • **

    **

    **

    **

    ****

    *

    *

    *

    *

    **

    Supplementary Figure 4. Papain gene expression profile in rice. Thereare 59 papain-like genes in the Oryza sativa genome, for them there aremicroarray probes for 50 loci. The 12 most expressed genes during theplant development were selected (* and**) to perform RT-qPCR assaysand achieve the papain expression profile during rice germination.

  • Table S1. Primer sequences used for OcXII cloning and vector amplification.

    PromoOc12F 5 CACCGCAGAGAGCCAGAAGAAGGA 3 PromoOc12R 5 ATGACGGTTTGGCTGTTGAG 3

    Oc12iF 5 CACCGGTCAAACTCCCTGTTTCCA 3 Oc12iR 5 TCCTCCTTGTTTCCCCTCTT 3

    GusLinker_F 5 CATGAAGATGCGGACTTACG 3 GusLinker_R 5 ATCCACGCCGTATTCGG 3

    HPT_F 5 GAGCCTGACCTATTGCATCTCC 3 HPT_R 5 GGCCTCCAGAAGAAGATGTTGG 3

    pHGWFS7 Hyg_F 5 AACGTTGCGGTTCTGTCAGT 3 pHGWFS7 Egfp_R 5 TGGTGCAGATGAACTTCAGG 3

    F: forward primer, R: reverse primer; PromoOc12 = rice genomic 2.1kb upstream OcXII translation start site; Oc12i = third and fourth exons of OcXII, for RNAi vector insertion; GusLinker and HPT = primers annealing in the pANDA RNAi vector pHGWFS7 = primers annealing in the vector to expresses GUS gene regulated by OcXII promoter sequence.

  • Table S2. Primer sequences used for gene amplification in RT-qPCR analyses.

    Oc1_F 5 AAGGGGAGGAGAAGATGTCG 3 Oc1_R 5 GCTGCTTCACACTCACAAGC 3 Oc2_F 5 CGTTCCCGTTACCCTCTTCT 3 Oc2_R 5 TTCACCACCCTCTCCAACTC 3 Oc3_F 5 TGAAGCCGTGGCTAGATTTT 3 Oc3_R 5 CTCAGTGTTGTGCAGGTCGT 3 Oc4_F 5 GGAAGGACGGAGGTGAGG 3 Oc4_R 5 CGACGCGGAGGTAGTACTTG 3 Oc5_F 5 GGCCTCCAAGCTGTATTACG 3 Oc5_R 5 GTGTTCCACGACGCAGAAG 3 Oc6_F 5 CTGGAGCCCGATAAAGAACA 3 Oc6_R 5 GATTTCGAGGCGGTAGTTCA 3 Oc7_F 5 ATGACCATGAGGACCAGCA 3 Oc7_R 5 GTCACCCTCTCGAACGTCAG 3 Oc8_F 5 GACCCCCACATCCAGGAG 3 Oc8_R 5 GTGTTGGTCCACGACTGCT 3 Oc9_F 5 CAGCAGCCTCGTCCTGTT 3 Oc9_R 5 CGGCCTCAAACCTCTTCTC 3 Oc10_F 5 CGCAGAAGCAGGTCGTCT 3 Oc10_R 5 GGTAGAAGAAGCAGGCGTGA 3 Oc11_F 5 CCGGCAACAATCAGATTCA 3 Oc11_R 5 GCTAGCAGCATCGATGACAA 3 Oc12_F 5 AGAAGGTGTACGAGGCCAAG 3 Oc12_R 5 TGGTCTGCAGCATCTTTGAC 3

    Os_eF1af* 5 GACTTCCTTCACGATTTCATCGTAA 3 Os_eF1ar* 5 TTTCACTCTTGGTGTGAAGCAGAT 3 Os_Ubi5f* 5 ACCACTTCGACCGCCACTACT 3 Os_Ubi5r* 5 ACGCCTAAGCCTGCTGGTT 3 Os_FDHf* 5 CAAAATCAGCTGGTGCTTCTC 3 Os_FDHr* 5 TTCCAATGCATTCAAAGCTG 3

    Os_GAPDHf* 5 GGGCTGCTAGCTTCAACATC 3 Os_GAPDHr* 5 TTGATTGCAGCCTTGATCTG 3

    Os_snU6f* 5 GGGGACATCCGATAAAATTG 3 Os_snu6r* 5 AGGGGCCATGCTAATCTTCT 3

    Sgr_F 5 TGCTGCTACTTCGACCATGT 3 Sgr_R 5 GGAACAGCACCTTCAGCTTC 3

    Pap1_Os01g67980F 5 CACGGAGTACTGGATCGTCA 3 Pap1_Os01g67980R 5 ACACGATTTGGCGAGAACTT 3 Pap2_Os04g57440F 5 CATTCGGCTTCAGGAATCTC 3 Pap2_Os04g57440R 5 CTCAATGGGCTGTTCTTGCT 3 Pap3_Os09g21370F 5 CTCCCAAGTCCCAAACGTC 3 Pap3_Os09g21370R 5 CTCGACAACCCATTTGTACG 3 Pap4_Os05g43230F 5 CTGGATAACGCAGTTTGCTG 3 Pap4_Os05g43230R 5 CAAACCACCCAAAGAAGGAA 3 Pap5_Os09g27030F 5 TGTTGGACTTGTTCGTCCAG 3 Pap5_Os09g27030R 5 GCACCCCATGAGTTCTTGAT 3 Pap6_Os02g27030F 5 ATCAGATTGCTGCCAACCTT 3 Pap6_Os02g27030R 5 ATTGGAGCAAAACCAGATGC 3 Pap7_Os04g24600F 5 ATCAAATTGCTGCCAACCTC 3 Pap7_Os04g24600R 5 TGATCCAGTACGGCTTCTCC 3 Pap8_Os04g55650F 5 CTGCTGCTGCATCTACGAGT 3 Pap8_Os04g55650R 5 GGTACGCTTCAGAGCCTTCA 3 Pap9_Os05g24550F 5 CACATCACAGGTGGCATGAT 3 Pap9_Os05g24550R 5 CATTCGTTTGTGCCCCTTAT 3 Pap10_Os08g44270F 5 GGCACCAAGTACTGGATCGT 3 Pap10_Os08g44270R 5 TCGTCGGTGACCTTCTTGAT 3 Pap11_Os07g29760F 5 CAACCTCCTCGACCTCAGC 3 Pap11_Os07g29760R 5 TGTATGGGTACGCGCTCTG 3 Pap12_Os09g38920F 5 AGCCGGAGGTGTACTTCAAC 3 Pap12_Os09g38920R 5 ACCAGCTTCCCCTTCTTGAT 3

    F: forward primer, R: reverse primer *Genes used for mRNA input normalization

  • Table S3. Templates selected by the Phyre 2 software to build the OcXII model.

    Protein description Protein Databank (PDB) DOI Multicystatins 10.2210/pdb4lzi/pdb 10.2210/pdb2w9p/pdb Cystatins 10.2210/pdb2l4v/pdb 10.2210/pdb3ima/pdb 10.2210/pdb4tx4/pdb 10.2210/pdb3ul5/pdb 10.2210/pdb3l0r/pdb 10.2210/pdb4n6o/pdb 10.2210/pdb4it7/pdb 10.2210/pdb2ch9/pdb Cystatin/monellin 10.2210/pdb1eqk/pdb 10.2210/pdb1roa/pdb 10.2210/pdb1cew/pdb 10.2210/pdb1r4c/pdb 10.2210/pdb1stf/pdb 10.2210/pdb1nb5/pdb Sialostatin l2 10.2210/pdb3mwz/pdb Aspartic protease inhibitor 10.2210/pdb2kxg/pdb