Metropolis Sports 18.01.10

download Metropolis Sports 18.01.10

of 24

  • date post

    01-Mar-2016
  • Category

    Documents

  • view

    221
  • download

    0

Embed Size (px)

description

Πολύ κακό για το ΤΙΠΟΤΑ

Transcript of Metropolis Sports 18.01.10

  • , 3-1 .

    - (2-0) 7 .

    . 810 - 18/01/2010

    SUSUSUSUSUSUSUSUUSUSUSUSUSUSUUSUSUPEPEPEPEPEPEPEPEEPEPEPEPEPEPEPEPEPPEP RLRLRLRLRLRLRLRLRLRLRLRLRLRLRLRLRLRRLEAEAEAEAEAEAEAEAAEAEAEAEAEEAEAEAEEAEAEAEEAAEAEAAEEAAEEEAEAEAEAEEAEEAEAEAEAAEEAGUGUGUGUGUGUGUUUUGUUUGUGUGUGUGUGUGGUGUGGUGGUGUGUGUUGUGUUGUGUGUGUEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

    COCOCOCOCOCOCOCOCOCOCOCOCOCOCOCOCOCOPAPAPAPAPAPAPAPAPAPAPAPAPAPAPAPAPAPA AAAAAAAAAAAAAAAAAAAAAAAA AAAFRFRFRFRFRFRFRFRFRFRFFRFRFRFRFRFRRFFRICICICICICICICICICICICICICICICICAAAAAAAAAAAAAAAA

    VOVOVOVOVOVOVOVOVOVOOVOVOVOVOVOVOVOVOVOVOOVOVOVOLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLEYYEYEYYYYYYEYEYYEYEYYEYEYEYYEYYEYEYEYEYEYEYEYEYEYEYEYEYEY

    3-2, .

    !

    -

    ,

    - .

  • h

    A: -

    ,

    ,

    .

    6-8

    8-11

    7-9

    8-11

    7-10

    9-11

    7-10

    6-8

    7-9

    - ETROPOLIS E .. : &

    2 .. 185 47 - .

    - : 12 .. 183 46 -

    .: 210 48.23.977 - 48.16.710Fax: 210 - 48.32.887

    E-mail: metropolis@metropolisnews.gr

    E:

    Project Manager:

    :

    : , ,

    :

    : -, ACTIONIMAGES, AFP, UROKINISSI

    ..

    www.metropolisnews.gr

    - . , , . , - - , - . , -, , -. . -

    , - , - , . , . ... , - . , - ... . , -, - play off. - ... , -

    -. . -. -, play off . , , . , -... ! .

    -, - play off; , - - ; -

    , ; ... -; , - - . .:

    .

    .

    .

    slyo{lzsiwsy

    sz{y

    gsh

    METROPOLIS

    - 11o C

    B 8o C

    - 10o C

    9o C

    - 11o C

    10o C

    10o C

    11o C

  • 3 18/01/10

    ... - - . - - , - , 5 . .

    ... - - - - . -, , - , - - . , - - , -

    - - - .

    , - - ... . , - -, . - - -, . - ...

  • SUPERLEAGUE418/01/10

    ... 12

    - . - -

    , , - , .

    , , . , - , - , . -, ... - - . '

    , ... , - . 45' - , , , - -. 0-0 , - 25 - , -

    . - - , 4 2 , . ... - , - - ...

  • SUPERLEAGUE 518/01/10

    - !!! ,

    - . -, 55 . , , - , , ... ,

    , - , - - - - - 8.000 - ... , - -, - .

    MVP

    - -! - - - - -

    , - - -, - - .

    -

    - - - . -

    - - ... , - -. - - 20 , - - .,

    , - ...

  • SUPERLEAGUE618/01/10

    , 18 - , - 1-0 , 20'. '

    , . - 20', , - ' . - . , 12', - -, ., ' -

    - . - 54', , - ,

    1-0. - - 75' , - 87'

    , -. ( ): -

    , , , , , , , , , (12' -, 92' ), -

    (75' ). (-

    ): , (80' ), -, , - (58' ), (68' ), , , -, , .

    -, - 2-0. --

    , , , - - . -, , 20 , - , - . , 12 - , 26 - . 40, - ,

    - .

    , - -. , , 51 - , , - - 2-0 . ( -

    ): , , (79 ), , -

    , , -, , -, (62 -), . ( -

    ): , , , (81 ), -, , (53 -), (67 -), , , .

    10

    &"

    20

    ..

  • SUPERLEAGUE 718/01/10

    1-1 , - 55', 87'. -

    - 1 3' . . - 10', , 28' - , , 1-0, - . -

    45' , - . ,

    - ' (55'), -

    . 87'. - , - - . - -, - . ( ):

    , , , , , -, (91' -), (80' ), , (61' ), . ( ): -

    , , , , , , , (70' ), , , (83' ).

    - 62' 1-0 , .

    ' , .

    3', - , 42' - , - . , - 13' - 29' . , -

    - 62'. , -

    . 71' - , . - - -. ( -

    ): , -, , , -, , (60' ), (46' -), , , (72' ). ( -

    ): , , - (79' ), , , -, , , (72' ), - (70' ), .

    ...

    .R

    0

    11

    0

    10

  • SUPERLEAGUE818/01/10

    !

    0-2 - 85' - ... ; - - . -

    , - -. , , 45, - . , -

    - -

    . -, - 0-1 57. - 75 -, 2-0. -

    ... 86 2-1 , - - 2-2. ( ):

    , , , , , , -, (76 -

    ), , - (63 ), (30 ). ( -

    ): (77 -), , -, , , -, , (88 ), , , (61 ).

    - , 0-1 51'. 15 , 58 . - - . , -

    -, - - 6 . - 34 -, - , , , - . 42, - .

    - 51 -, - . - 54 () 57, - . - 81, - -, , 89. ( -

    ): , , , , -, , (76 ), (82 ), (62 ), , .

    ( ): , , , -, , , , , (78 ), (86 ), (64 ).

    $

    22

    1 $

    1

  • SUPERLEAGUE 918/01/10

    . . . . . . . .

    723$$

    - 1-0 - 1-1 - 1-0 - 2-2 - 2-1 - 0-1 - 2-0 - 0-0

    - 23/1 - 23/1 - 23/1 - 24/1 - 24/1 - 24/1 - 24/1 - 24/1

    1. 18 47 15 2 1 37 - 11 9 1 0 25 - 6 6 1 1 12 - 5

    2. 18 40 12 4 2 28 - 10 6 2 1 15 - 5 6 2 1 13 - 5

    3. 18 37 11 4 3 23 - 8 8 0 1 15 - 3 3 4 2 8 - 5

    4. 18 31 8 7 3 23 - 16 5 3 1 10 - 5 3 4 2 13 - 11

    5. 18 26 7 5 6 18 - 16 4 3 2 12 - 8 3 2 4 6 - 8

    6. 18 26 7 5 6 25 - 25 5 1 2 15 - 11 2 4 4 10 - 14

    7. 18 24 6 6 6 17 - 15 4 4 1 12 - 7 2 2 5 5 - 8

    8. 18 24 6 6 6 24 - 21 4 3 2 16 - 12 2 3 4 8 - 9

    9. 18 23 6 5 7 23 - 23 4 2 3 8 - 7 2 3 4 15 - 16

    10. 18 22 5 7 6 19 - 20 3 4 2 8 - 7 2 3 4 11 - 13

    11. 18 21 6 3 9 13 - 17 6 1 3 13 - 10 0 2 6 0 - 7

    12. 18 19 5 4 9 22 - 28 3 3 3 11 - 12 2 1 6 11 - 16

    13. 18 18 4 6 8 17 - 26 3 4 1 10 - 8 1 2 7 7 - 18

    14. 18 18 4 6 8 16 - 26 3 4 2 11 - 9 1 2 6 5 - 17

    15. 18 16 4 4 10 17 - 29 3 1 5 7 - 12 1 3 5 10 - 17

    16. 18 2 0 2 16 9 - 40 0 2 7 5 - 16 0 0 9 4 - 24

    683(5/($*8(

    - - - - , 2-1 , - , .

    1-0, 39, - .

    - - - , - - . 63, -, - 2-0: - , - - 2-0. - -

    , - 2-0, 88. , , - 2-1, - , - -. ( -

    ): , , -, , , , (86 ),

    , (81 -), , (71 ). ( -

    ): , , , , (68 ), (56 ), , , , , .

    21

  • 10 18/01/10

    . .

    , , 2-1 , 17 ' , - .

    9' , ... 67', . - 80' , - - . 3-1 -

    - . - - , 17' - 25'. - 60' 3-0,

    - 85' . 2-0 -

    41' 86', 1-

    0 53'. 17 -

    18.00 , .

    ...

    ... ' -

    , . - 2-0 - . - . , 55' . - 69' , . , 71' - , .

    1. 37 11 4 1 31 - 13

    2. . 32 10 2 5 29 - 20

    3. 30 8 6 3 21 - 18

    4. 29 8 5 4 21 - 12

    5. 27 7 6 4 24 - 19

    6. 26 7 5 5 23 - 23

    7. 24 6 6 5 20 - 19

    8. 24 7 3 7 24 - 23

    9. 22 5 7 4 23 - 20

    10. 21 5 6 6 13 - 15

    11. . 20 4 8 5 16 - 16

    12. 19 4 7 6 17 - 24

    13. 19 5 4 8 17 - 18

    14. . 19 4 7 6 14 - 18

    15. 18 4 6 7 16 - 21

    16. 17 3 8 6 22 - 24

    17. 17 3 8 6 9 - 14

    18. 4 0 4 13 8 - 31

    - 1-0 - - . - - - - -. - 8' .

    - -, 1-0 . , - 42' - - .

    , -

    4 , . - . 2' 1-0, - . 10' , 20' -. 24' ... , - , .

    2

    - 2-0

    - 2-2

    - 1-0

    - 1-0

    - 1-0

    - 1-2

    - 2-0

    - 3-1

    - 18/01

    - 24/01

    - 24/01

    - 24/01

    . - . 24/01

    - 24/01

    - 24/01

    - 24/01

    . - 24/01

    - 24/01

    $

    (

  • 11

    1 2

    18/01/10

    . . . .

    1. . 31 9 4 2 19 - 10

    2. 26 8 2 4 17 - 11 3. . 25 7 4 3 29 - 13

    4. 25 6 7 1 14 - 4

    5. 24 7 5 2 16 - 5

    6. 23 6 5 4 12 - 10

    7. 21 6 3 5 14 - 11

    8. . 21 6 3 5 10 - 14

    9. 19 5 4 5 10 - 14

    10. 17 4 5 5 10 - 10

    11. 16 4 4 6 16 - 17

    12 . 16 4 4 6 9 - 17

    13. 15 3 6 5 11 - 14

    14 . . 15 3 6 5 17 - 16

    15. 15 3 6 5 13 - 14 16. 10 3 1 10 7 - 20

    17. 4