Lipid Rafts in Pancreatic Beta and Alpha Cell Stimulus ...€¦ · Lipid Rafts in Pancreatic β-...
279
Lipid Rafts in Pancreatic β- and α-Cell Stimulus-Secretion Coupling by Fuzhen Xia A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Graduate Department of Physiology University of Toronto © Copyright by Fuzhen Xia 2008
Transcript of Lipid Rafts in Pancreatic Beta and Alpha Cell Stimulus ...€¦ · Lipid Rafts in Pancreatic β-...
Lipid Rafts in Pancreatic β- and α-Cell Stimulus-Secretion Coupling
by
Fuzhen Xia
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Graduate Department of Physiology
University of Toronto
© Copyright by Fuzhen Xia 2008
ii
Lipid Rafts in Pancreatic β- and α-Cell Stimulus-Secretion
Coupling
Fuzhen Xia
Doctor of Philosophy
Graduate Department of Physiology University of Toronto
2008
Abstract
Type 2 diabetes is hallmarked by insufficient β-cell insulin secretion and inappropriate α-cell
glucagon secretion concomitant to peripheral insulin resistance. However, the mechanisms
underlying dysregulation of pancreatic β- and α-cells in type 2 diabetes require further
investigation. Whereas triglycerides and saturated free fatty acids have been well recognized to
cause β-cell dysfunction, the physiological and/or pathological role of cholesterol on β- and α-
cells is less well examined. Cholesterol is the major component of membrane microdomains,
termed lipid rafts. Numerous signaling and transport proteins have been found to be targeted to
lipid raft microdomains, where the function of the associated membrane proteins could be
distinctly regulated.
I have identified the expression of lipid raft constituent proteins, caveolin-1/2 in pancreatic β-
cells; and caveolin-2 in α-cells. A variety of membrane proteins (ion channels and SNARE
proteins) critical for β- and α-cell stimulus-secretion coupling were found to be associated with
cholesterol-rich lipid raft microdomians, and the properties of those ion channels (KV2.1,
KV4.1/4.3, and CaV1.2 channels) and SNARE proteins were closely regulated by cholesterol-rich
lipid rafts. Acute depletion of cholesterol from the plasma membrane with methyl-β-cyclodextrin
iii
caused an elevated basal hormone secretion from both β- and α-cells and a loss of glucose-
stimulated insulin secretion, implicating that cholesterol-rich lipid rafts play an important role in
regulating exocytosis of these two types of islet cells. Chronic pharmacological inhibition of β-
cell endogenous cholesterol biosynthesis with squalene epoxidase inhibitor caused an
impairment of both CaV channels and SNARE protein exocytotic machinery, indicating that
intracellular cholesterol and its homeostasis are critical for maintaining normal β-cell function.
The work presented in this thesis provided clear evidence that cholesterol-rich lipid rafts play a
critical role in maintaining the normal function of pancreatic ion channels and SNARE proteins
to regulate pancreatic β- and α-cells stimulus-secretion coupling. Manipulation of cholesterol
level of β- and α-cells could be a potential target for a therapeutic intervention in the treatment
of type 2 diabetes.
iv
Acknowledgments First and foremost I would like to thank my advisor, Dr. Robert Tsushima for his tremendous
support and guidance. I thank him for offering me the opportunity to work as the first staff in his
laboratory. It has been my privilege and pleasure to have known him and worked with him.
Secondly, my sincere gratitude and thanks to my supervisory committee members, Dr. Herbert
Gaisano, and Dr. Tianru Jin, and Dr. Michael Wheeler for their continuous support,
encouragement, and suggesting interesting directions for my thesis work.
I would like to thank all the students and postdocs who were directly involved with my work
over the years such as Alpana Bhattacharjee, Yi Chen, Gregory Gaisano, Xiaodong Gao, Edwin
Kwan, Patrick Lam, Yukman Leung, Anton Mihic, Laura Sheu, and Li Xie.
I would like to thank all of my lab mates and friends, especially Andrew Cooper, Fay Dai, Jingyu
Diao, Youhou Kang, Betty Ng, and Tom Zhao for their generous assistance. These people have
made the time of my working at U of T memorable.
Finally, I would like to thank my parents for all their support and encouragement far away from
China. Thank you for forgiving me for not having visited you for more than three years due to
my busy schedule. I owe a great deal to my two lovely daughters, Anna and Ruby. Your pretty
cards for Father’s Day are the best presents for me ever. Your happy smiles are the best rewards
that have accompanied me throughout my endeavors toward this thesis.
v
Table of Contents Acknowledgments.......................................................................................................................... iv
Table of Contents............................................................................................................................ v
List of Figures .............................................................................................................................. xiii
List of Tables ................................................................................................................................ xv
Abbreviations............................................................................................................................... xvi
Manuscripts.................................................................................................................................. xxi
1 Chapter One: Introduction.......................................................................................................... 1
1.1 General Introduction of Diabetes........................................................................................ 2
1.1.1 Diabetes................................................................................................................... 2
1.1.1.1 Type 1 diabetes......................................................................................... 2
1.1.1.2 Type 2 diabetes......................................................................................... 3
1.1.1.3 The burden of diabetes ............................................................................. 4
1.1.2 Development and Progression of Type 2 Diabetes................................................. 5
1.1.2.1 Insulin action ............................................................................................ 8
1.1.2.2 Hepatic insulin resistance ......................................................................... 8
1.1.2.3 Insulin resistance in skeletal muscle and adipose tissue .......................... 9
1.1.2.4 Insulin action in brain and pancreatic β-cells ......................................... 10
1.1.2.5 Pancreatic β-cell dysfunction ................................................................. 11
1.1.2.6 Dysregulation of glucagon secretion from pancreatic α-cells ................ 12
1.2 Pancreatic β- and α-Cell Stimulus-Secretion Coupling.................................................... 13
1.2.1 β-Cell Stimulus-Secretion Coupling ..................................................................... 13
1.2.1.1 Glucose metabolism and ATP production in β-cells .............................. 15
1.2.1.2 ATP-sensitive K+ (KATP) channels as metabolic sensors ....................... 15
1.2.1.3 Ca2+ influx is critical to trigger β-cell exocytosis................................... 16
vi
1.2.1.4 Biphasic insulin secretion....................................................................... 17
1.2.2 α-Cell Stimulus-Secretion Coupling..................................................................... 18
1.2.2.1 Glucose metabolism and inhibition of glucagon secretion of pancreatic α-cells .................................................................................... 21
1.2.2.2 KATP channel-mediated glucose stimulation of glucagon secretion ....... 21
1.2.2.3 Contradictions of α-cell stimulus-secretion coupling............................. 22
1.2.2.4 Paracrine mediated glucose inhibition on glucagon secretion................ 23
1.2.2.5 Other regulatory factors impacting glucagon secretion.......................... 26
1.2.3 Ion Channels in Pancreatic β- and α-Cells............................................................ 27
1.2.3.1 KATP channels ......................................................................................... 27
1.2.3.2 CaV channels........................................................................................... 30
1.2.3.3 KV channels ............................................................................................ 33
1.2.4 SNARE Proteins in Pancreatic β- and α-Cells...................................................... 36
1.2.4.1 Minimal fusion machinery ..................................................................... 36
1.2.4.2 Synaptotagmin and Ca2+ sensing............................................................ 37
1.2.4.3 Sec1/Munc-18 and Munc-13 .................................................................. 38
1.2.4.4 Exocytotic machinery in pancreatic β- and α-cells ................................ 39
1.3 Cellular Cholesterol and Lipid Rafts ................................................................................ 41
1.3.1 Cellular Cholesterol .............................................................................................. 41
1.3.1.1 Biosynthesis of endogenous cholesterol................................................. 42
1.3.1.2 Uptake of exogenous cholesterol............................................................ 45
1.3.1.3 Output of cellular cholesterol ................................................................. 45
1.3.1.4 Intracellular cholesterol transport........................................................... 46
1.3.1.5 Regulation of cholesterol homeostasis ................................................... 48
1.3.2 The Concept of Lipid Rafts................................................................................... 49
1.3.2.1 Membrane bilayer and lipid rafts............................................................ 51
vii
1.3.2.2 Caveolae and caveolin ............................................................................ 53
1.3.2.3 Strategies to characterize lipid rafts........................................................ 55
1.3.3 Cholesterol / Lipid Rafts and Cellular Signaling.................................................. 58
1.3.3.1 Lipid rafts in signal transduction............................................................ 59
1.3.3.2 Lipid rafts in insulin signaling................................................................ 60
1.3.3.3 Cholesterol and lipid rafts in stimulus-secretion coupling ..................... 61
1.4 General Hypothesis........................................................................................................... 63
1.5 Aims.................................................................................................................................. 63
1.5.1 Aim 1: To Identify the Roles of Lipid Rafts and the Raft-Associated Proteins in β- and α-Cells ................................................................................................... 63
1.5.2 Aim 2: To Determine the Critical Role of Endogenous Cholesterol and its Homeostasis in β-Cells ......................................................................................... 64
2 Chapter Two: Roles of Lipid Rafts in Insulin Secretion of Pancreatic β-Cells ....................... 65
2.1 Abstract ............................................................................................................................. 66
2.2 Introduction....................................................................................................................... 66
2.3 Materials and Methods...................................................................................................... 69
2.3.1 Antibodies and Reagents....................................................................................... 69
2.3.2 Rat Islet and β-Cell Isolations............................................................................... 69
2.3.3 Cell Culture........................................................................................................... 69
2.3.4 Confocal Immunofluorescence Microscopy ......................................................... 70
2.3.5 Lipid Raft Isolation ............................................................................................... 70
2.3.6 Insulin Secretion Assay......................................................................................... 71
2.3.7 Electrophysiology ................................................................................................. 72
2.3.8 Single-cell Capacitance Measurement .................................................................. 73
2.3.9 Statistical Analysis................................................................................................ 73
2.4 Results............................................................................................................................... 73
2.4.1 Expression of Caveolin in β-Cells ........................................................................ 73
viii
2.4.2 KV2.1, CaV1.2 and SNARE Proteins Target to Lipid Rafts in β-Cells................. 76
2.4.3 Cholesterol Depletion Causes and Elevated Basal Insulin Secretion ................... 78
2.4.4 MβCD Enhances Single β-Cell Exocytotic Activity ............................................ 80
2.4.5 Cholesterol Depletion Affects the Amplitude and Gating of KV Channels.......... 82
2.5 Discussion ......................................................................................................................... 85
2.5.1 Lipid Rafts and Caveolins in Pancreatic β-Cells .................................................. 85
2.5.2 Targeting of Ion Channels to Lipid Rafts in Pancreatic β-Cells........................... 85
2.5.3 Targeting of SNARE Proteins to Lipid Rafts in Pancreatic β-Cells..................... 87
3 Chapter Three: Roles of Lipid Rafts in Glucagon Secretion from Pancreatic α-Cells ............ 89
3.1 Abstract ............................................................................................................................. 90
3.2 Introduction....................................................................................................................... 90
3.3 Materials and Methods...................................................................................................... 93
3.3.1 Cell Culture........................................................................................................... 93
3.3.2 Pancreatic Islet Isolation and Dispersion.............................................................. 93
3.3.3 RNA Preparation and Quantitative PCR............................................................... 93
3.3.4 Immunoblotting..................................................................................................... 96
3.3.5 Confocal Immunofluorescence Microscopy ......................................................... 96
3.3.6 Lipid Raft Isolation ............................................................................................... 97
3.3.7 Glucagon Secretion Assay .................................................................................... 97
3.3.8 Electrophysiology ................................................................................................. 98
3.3.9 Membrane Capacitance Measurement .................................................................. 99
3.3.10 Statistical Analysis.............................................................................................. 100
3.4 Results............................................................................................................................. 100
3.4.1 Expression of Caveolin in Pancreatic α-Cells .................................................... 100
3.4.2 Expression of Ion Channels and SNARE Proteins in α-Cells ............................ 102
3.4.3 KV4.1/4.3, CaV1.2 and SNARE Proteins Target to Lipid Rafts in α-Cells ........ 104
ix
3.4.4 Depletion of Membrane Cholesterol Causes Elevated Basal Glucagon Secretion and α-Cell Exocytosis......................................................................... 107
3.4.5 Cholesterol Depletion Inhibits KV4 Current Amplitude but not CaV Currents... 109
3.4.6 The integrity of SNAP-25 and Syntaxin 1A Clusters Depends on Membrane Cholesterol .......................................................................................................... 113
3.5 Discussion ....................................................................................................................... 116
3.5.1 KV and CaV Channels in α-Cells......................................................................... 116
3.5.2 Significance of Ion Channels and SNARE Proteins Targeting to Lipid Rafts ... 117
4 Chapter Four: Essential Role of Endogenous Cholesterol in β-Cell Insulin Secretion.......... 120
4.1 Abstract ........................................................................................................................... 121
4.2 Introduction..................................................................................................................... 122
4.3 Materials and Methods.................................................................................................... 124
4.3.1 Cell Culture......................................................................................................... 124
4.3.2 Pancreatic Islet Isolation and Dispersion............................................................ 124
4.3.3 RNA Preparation and RT-PCR........................................................................... 125
4.3.4 Subcellular Fractionation of Plasma Membranes, Endoplasmic Reticulum, and Insulin Secretory Granules.................................................................................. 125
4.3.5 Cholesterol Content Assay.................................................................................. 127
4.3.6 Insulin Secretion Assay....................................................................................... 128
4.3.7 Electron Microscopy........................................................................................... 129
4.3.8 Electrophysiology ............................................................................................... 129
4.3.9 Photolysis of Caged Ca2+ and Cm Measurement................................................ 130
4.3.10 Immunoblotting................................................................................................... 131
4.3.11 Statistical Analysis.............................................................................................. 132
4.4 Results............................................................................................................................. 132
4.4.1 Inhibition of Squalene Epoxidase Significantly Decreases Endogenous Cholesterol Levels in β-Cells.............................................................................. 132
x
4.4.2 Inhibition of Cholesterol Biosynthesis Perturbs Insulin Secretion of Mouse Islets .................................................................................................................... 135
4.4.3 Inhibition of Cholesterol Biosynthesis Blocks CaV Channels ............................ 139
4.4.4 NB598 Increases KV Channel Inactivation......................................................... 141
4.4.5 Inhibition of Cholesterol Biosynthesis by NB598 Impairs β-Cell Exocytosis ... 145
4.4.6 NB598 does not Affect Variability of MIN6 Cells............................................. 147
4.4.7 NB598 Selectively Inhibits the Expressions of Lipid Raft Structural Protein Caveolin-1........................................................................................................... 149
4.5 Discussion ....................................................................................................................... 152
4.5.1 Chronic Cholesterol Biosynthesis Inhibition vs. Acute Cholesterol Depletion.. 152
4.5.2 Roles of Endogenous Cholesterol in Regulating KV Channel Function............. 153
4.5.3 Role of Endogenous Cholesterol on β-Cell Exocytotic Machinery.................... 154
5 Chapter Five: Summary, Discussion and Future Directions.................................................. 157
5.1 Summary ......................................................................................................................... 158
5.2 Discussion ....................................................................................................................... 160
5.2.1 Characterization of Lipid Rafts and the Raft-Associated Proteins in Pancreatic β- and α-Cells ..................................................................................................... 161
5.2.1.1 Identification of lipid rafts.................................................................... 161
5.2.1.2 Targeting of KV channels to lipid rafts in pancreatic β- and α-cells.... 162
5.2.1.3 Targeting of CaV channels to lipid rafts in pancreatic β- and α-cells .. 164
5.2.1.4 Targeting of SNARE proteins to lipid rafts in pancreatic β- and α-cells....................................................................................................... 165
5.2.1.5 Controversies, challenges and new approaches in lipid raft studies..... 166
5.2.2 Lipid Rafts in the Plasma Membrane Regulate Exocytosis of Pancreatic β- and α-Cells ................................................................................................................ 168
5.2.2.1 SNARE protein clusters and cholesterol dependence .......................... 169
5.2.2.2 Cholesterol depletion at the plasma membrane causes a loss of regulated hormone secretion of both β- and α-cells............................. 170
xi
5.2.2.3 Complexity of lipid raft regulation on exocytosis ................................ 174
5.2.3 Cellular Cholesterol and its Homeostasis is Critical for Pancreatic β-Cell Stimulus-Secretion Coupling .............................................................................. 174
5.2.3.1 Inhibition of endogenous cholesterol biosynthesis perturbs β-cell insulin secretion.................................................................................... 175
5.2.3.2 Endogenous cholesterol is essential for the normal function of CaV channels and SNARE protein exocytotic machinery ........................... 176
5.2.3.3 Endogenous cholesterol is essential for the expression of caveolin-1 in β-cells ............................................................................................... 179
5.2.3.4 Cholesterol accumulation in β-cells is toxic to insulin secretion ......... 180
5.2.4 Study Approaches and Their Limitations ........................................................... 182
5.2.4.1 Cell lines and primary cells .................................................................. 182
5.2.4.2 Manipulation of membrane cholesterol with MβCD and NB598 ........ 183
5.2.4.3 Complementary approaches are required to study lipid rafts due to the limitation of individual techniques ................................................. 184
5.3 Conclusions..................................................................................................................... 185
5.4 Future Directions ............................................................................................................ 186
6 Appendix: Generation of Knockout Mice with β-Cell Specific Cholesterol Deficiency ...... 188
6.1 Abstract ........................................................................................................................... 189
6.2 Introduction..................................................................................................................... 189
6.3 Materials and Methods.................................................................................................... 191
6.3.1 Generation of β-cell Specific SQS Gene Knockout (βSQS-/-) Mice................... 191
6.3.2 DNA Isolation and Genotyping .......................................................................... 192
6.3.3 Pancreatic Islet Isolation ..................................................................................... 194
6.3.4 Intraperitoneal Glucose Tolerance Test (IPGTT) ............................................... 194
6.3.5 In vivo Insulin Secretion Measurements............................................................. 194
6.3.6 Immunoblotting................................................................................................... 194
6.3.7 Statistical analysis............................................................................................... 195
xii
6.4 Results............................................................................................................................. 195
6.4.1 Expression of SQS in β-Cells ............................................................................. 195
6.4.2 Conditional Inactivation of SQS Gene in Pancreatic β-Cells ............................. 197
6.4.3 Normal Development of βSQS-/- Mice ............................................................... 201
6.4.4 βSQS-/- Mice Display a Trend towards Glucose Intolerance.............................. 203
6.4.5 βSQS-/- Mice Exhibit a Trend of Impaired in vivo Glucose-Stimulated Insulin Secretion ............................................................................................................. 205
6.5 Discussion ....................................................................................................................... 207
6.5.1 General Considerations on Generating β-Cell Specific SQS Null Mice ............ 207
6.5.2 Role of Endogenous β-Cell Cholesterol in Maintaining Normal Insulin Secretion ............................................................................................................. 207
6.5.3 Further in vivo and ex vivo Studies on βSQS-/- Mice to Reveal Critical Roles of Endogenous Cholesterol on β-Cell Exocytosis .............................................. 210
Reference List ............................................................................................................................. 212
xiii
List of Figures Figure 1. Development and progression of type 2 diabetes............................................................ 7
Figure 2. β-Cell stimulus-secretion coupling................................................................................ 14
Figure 3. α-Cell stimulus-secretion coupling ............................................................................... 20
Figure 4. Cholesterol biosynthesis pathway ................................................................................. 44
Figure 5. Schematic representation of lipid raft structures in a plasma membrane...................... 50
Figure 6. Isolation of lipid rafts with sucrose gradient ultracentrifugation .................................. 57
Figure 7. Expression of caveolin-1 and caveolin-2 in pancreatic β-cells ..................................... 75
Figure 8. Association of β-cell ion channels and SNARE proteins with lipid rafts ..................... 77
Figure 9. Disruption of lipid rafts with MβCD causes an elevated basal insulin secretion from HIT-T15 cells................................................................................................................................ 79
Figure 10. Cholesterol depletion enhances single-cell exocytotic events..................................... 81
Figure 11. Effects of MβCD pretreatment on β-cell KV current amplitude and channel gating... 83
Figure 12. Effects of MβCD on L-type CaV channels in HIT-T15 β-cells................................... 84
Figure 13. Expression of caveolin in αTC6 cells and rat primary α-cells.................................. 101
Figure 14. Expression of KV and CaV channels, and SNARE proteins in αTC6 cells................ 103
Figure 15. Targeting of ion channels to lipid rafts in αTC6 cells............................................... 105
Figure 16. Targeting of SNARE proteins to lipid rafts in αTC6 cells........................................ 106
Figure 17. Glucagon secretion and single-cell exocytosis measured from primary mouse α-cells..................................................................................................................................................... 108
Figure 18. Effects of MβCD on KV currents in isolated mouse primary α-cells........................ 110
Figure 19. Cholesterol depletion has no effect on CaV or KATP currents in mouse α-cells ........ 112
Figure 20. Integrity of SNAP-25 and syntaxin 1A clusters depends on cholesterol of plasma membranes .................................................................................................................................. 115
Figure 21. Inhibition of squalene epoxidase significantly decreases endogenous cholesterol levels in β-cells...................................................................................................................................... 134
Figure 22. Inhibition of cholesterol synthesis perturbs insulin secretion of mouse islets .......... 136
xiv
Figure 23. Electron microscopic analysis of insulin granules .................................................... 138
Figure 24. NB598 inhibits mouse β-cell CaV channels............................................................... 140
Figure 25. NB598 increases the steady-state inactivation of KV channels in mouse β-cells...... 143
Figure 26. NB598 decreases the density of KATP currents.......................................................... 144
Figure 27. NB598 inhibits β-cell exocytosis independently on CaV channels ........................... 146
Figure 28. NB598 treated-MIN6 cells display normal cell viability .......................................... 148
Figure 29. NB598 does not cause any change in the protein expression of ion channels and SNARE proteins.......................................................................................................................... 150
Figure 30. Inhibition on endogenous cholesterol causes a down-regulation of caveolin-1 in β-cells ............................................................................................................................................. 151
Figure 31. Lipid raft regulation on ion channels and SNARE proteins...................................... 173
Figure 32. Inhibition of endogenous cholesterol biosynthesis perturbs β-cell insulin secretion 178
Figure 33. Cholesterol biosynthesis pathway and expression of squalene synthase in β-cells .. 196
Figure 34. Inactivation of SQS gene in pancreatic β-cells.......................................................... 199
Figure 35. Body weight of βSQS+/+, βSQS+/- and βSQS-/- mice ................................................. 202
Figure 36. Glucose intolerance in βSQS-/- mice ......................................................................... 204
Figure 37. in vivo insulin secretory response of βSQS-/- mice to a glucose challenge ............... 206
Figure 38. βSQS-/- mice compensate for the loss of endogenous cholesterol through cholesterol uptake.......................................................................................................................................... 209
xv
List of Tables Table 1. Primer sequences of KV channels ……………………………...…………..…………95
Table 2. Primers used for genotyping of βSQS-/- mice ……………………………………….193
xvi
Abbreviations
[Ca2+]i intracellular concentration of Ca 2+
4AP 4-amminopyridine
µg microgram
µl microliter
µM micromolar
ABCA1 ATP-binding cassette transporter A1
ACAT acyl-CoA cholesterol acyltransferase
ADP adenosine diphosphate
ATP adenosine triphosphate
βSQS-/- β-cell selective knockout of SQS gene
BSA bovine serum albumin
CDA Canadian Diabetes Association
CNS central nervous system
cDNA complementary DNA
cAMP cyclic adenosine monophosphate
CaV voltage-gated Ca2+ channel
Cm membrane capacitance
d days
DMEM Dulbecco's modified Eagle's medium
DMSO dimethyl sulfoxide
DRMs detergent-resistant membranes
EDTA ethylenediaminetetraacetic acid
EGFP enhanced green fluorescent protein
xvii
EGTA ethylene-bis (oxyethylenenitrilo) tetraacetic acid
F farad
FBS fetal bovine serum
FFAs free fatty acids
FRET fluorescence resonance energy transfer
GABA γ-aminobutyric acid
GFP green fluorescent protein
GK glucokinase
GLP glucagon-like peptide
GLP-1R GLP-1 receptor
GPI glycosylphosphatidylinositol
GSIS glucose-stimulated insulin secretion
h hours
HDL high-density lipoproteins
HEPES 4-(-hydroxyethyl) piperazine-1-ethanesulfonic acid
HG-DMEM high glucose
HGO hepatic glucose output
HMG-CoA 3-hydroxy-3-methylglutaryl CoA
HVA high voltage-activated
I current
IGF insulin growth factor
IR insulin receptor
IRS insulin receptor substrate
KATP ATP-sensitive K+
KChIPs K+ channel-interacting proteins
xviii
KDr delayed rectifying K+
Kir inward-rectifying K+
KRB Kres-Ringer bicarbonate
KV voltage-dependent K+
Ld liquid disordered phase
LDL low-density lipoproteins;
LG low glucose
Lo liquid ordered phase
LVA low voltage-activated
LXR liver X receptor
MΩ megaohm
MAPK mitogen-activated protein kinase
MβCD methyl-β-cyclodextrin
MBS MES buffered saline
MES 2-(N-morpholino) ethane sulfonic acid
MIP mouse insulin promoter
ml milliliter
mM millimolar
mRNA messenger RNA
msec milliseconds
mV millivolts
NaV voltage gated Na+
nA nanoamperes
ng nanograms
nm nanometer
xix
pA picoamperes
PAGE polyacrylamide gel electrophoresis
PBS phosphate buffered saline
PCR polymerase chain reaction
PI3K phosphatidylinositol 3-kinase
PKB proteins kinase B
PPAR peroxisome proliferators activated receptor
RP reserve pool
RIA radioimmunoassay
RIP rat insulin promoter
RPMI Roswell Park Memorial Institute medium
RRP readily releasable pool
RT-PCR reverse-transcriptase chain reaction
s second
SCAP SREBP cleavage-activating protein
SDS sodium dodecyl sulfate
SFVT single fluorophore video tracking
SNAP-25 synaptosome-associated protein of 25 kilodaltons
SNARE soluble N-ethylmaleimide-sensitive factor attachment protein receptor
So solid ordered phase
SPT single particle tracking
SQS squalene synthase
SRE sterol regulatory element
SREBP SRE binding protein
StAR steroidogenic acute regulatory protein
xx
STED stimulated emission depletion
SUR sulphonylurea receptor
Syn1A syntaxin 1A
t-SNARE target-SNARE
TCA tricarboxylic acidcycle
TEA tetraethylammonium
TGN trans-Golgi network
V voltage
v-SNARE vesicle-SNARE
VAMP vesicle-associated membrane protein
VMH ventromedial hypothalamus
xxi
Manuscripts Manuscripts included in the thesis Chapter 2: Xia F, Gao X, Kwan E, Lam P, Chan L, Sy K, Sheu L, Wheeler MB, Gaisano HY and Tsushima RG. Disruption of pancreatic β-cell lipid rafts modifies KV2.1 channel gating and insulin exocytosis. Journal of Biological Chemistry 279 (23): 24685-24691, 2004 Chapter 3: Xia F, Leung YM, Gaisano G, Gao X, Chen Y, Manning Fox JE, Bhattacharjee A, Wheeler MB, Gaisano HY and Tsushima RG. Targeting of KV4, CaV1.2 and SNARE proteins to cholesterol rich lipid rafts in pancreatic α-cells: Effects on glucagon stimulus-secretion coupling. Endocrinology 148:2157-2167, 2007 Chapter 4: Xia F, Xie L, Gao X, Chen Y, Gaisano HY and Tsushima RG. Inhibition of cholesterol biosynthesis impairs insulin secretion and voltage-gated calcium channel function in pancreatic β-cells, Endocrinology Epub July 3, 2008 Manuscripts not included in the thesis He Y, Kang Y, Leung YM, Xia F, Gao X, Xie H, Gaisano HY, Tsushima RG. Modulation of Kv2.1 channel gating and TEA sensitivity by distinct domains of SNAP-25. Biochem J. 396, 363–369, 2006 Leung YM, Kang Y, Xia F, Sheu L, Gao X, Xie H, Tsushima RG, Gaisano HY. Open form of syntaxin-1A is a more potent inhibitor than wild-type syntaxin-1A of Kv2.1 channels. Biochem J. 387(Pt 1):195-202, 2005 Kang Y, Leung YM, Manning-Fox JE, Xia F, Xie H, Sheu L, Tsushima RG, Light PE, and Gaisano HY. Syntaxin 1A inhibits cardiac KATP channels by its actions on nucleotide-binding folds-1 and -2 of sulfonylurea receptor 2A. Journal of Biological Chemistry 279(45):47125-31, 2004 MacDonald PE, Wang X, Xia F, El-kholy W, Targonsky ED, Tsushima RG, and Wheeler MB. Antagonism of β-Cell Voltage-dependent K+ Currents by Exendin 4 Requires Dual Activation of the cAMP/Protein Kinase A and Phosphatidylinositol 3-Kinase Signaling Pathways, Journal of Biological Chemistry 278(52): 52446-52453, 2003 Leung YM, Kang Y, Gao X, Xia F, Xie H, Sheu L, Tsuk S, Lotan I, Tsushima RG, and Gaisano HY. Syntaxin 1A Binds to Cytoplasmic C Terminus of Kv2.1 to Regulate Channel and Trafficking, Journal of Biological Chemistry 278(19): 17532-17538, 2003
1
1 Chapter One: Introduction
2
1.1 General Introduction of Diabetes
1.1.1 Diabetes
Diabetes mellitus (referred to as diabetes hereafter) is a collection of disorders that have
hyperglycemia and glucose intolerance as their hallmark, and is caused by insulin deficiency
and/or impaired effectiveness of insulin action. According to the classification of diabetes by
American Diabetes Association (ADA) and World Health Organization (WHO) (Alberti &
Zimmet, 1998), four types of diabetes are distinguished, type 1 diabetes, type 2 diabetes,
gestational diabetes, and other specific types (genetic defects of β-cell function, genetic defects
in insulin action, disease of endocrine pancreas, endocrinopathies, and drug- or chemical-induced
diabetes). However, the vast majority of the cases belong to the type 1 and type 2 categories.
1.1.1.1 Type 1 diabetes
Type 1 diabetes, or juvenile-onset diabetes is caused by a chronic autoimmune destruction of
pancreatic islet β-cells, usually leading to absolute insulin deficiency. Though it can occur at any
age, type 1 diabetes mostly affects children and adolescents. The patients present with symptoms
of hyperglycemia including polydipsia, polyuria, polyphagia, weight loss, and in severe cases,
ketoacidosis and coma. The etiology of the autoimmune process and β-cell destruction is not
known. Nearly 90% of type 1 diabetes cases do not have a family history. However, the risk of
developing type 1 diabetes increases 15- to 20-fold for the relatives of probands with type 1
diabetes compared with the general population. The autoimmune destruction is probably initiated
by the exposure of a genetically susceptible individual to environmental agent(s), as both genetic
and environmental factors are known to contribute to the susceptibility of type 1 diabetes. The
preclinical period is marked by the presence of autoantibodies to pancreatic β-cell antigens, such
as insulin, glutamic acid decarboxylase, and tyrosine phosphatase. These autoantibodies can
3
appear early in childhood and the presence of two or more these antibodies is highly predictive
for the development of type 1 diabetes (Bingley et al., 1997;Verge et al., 1996). The duration of
preclinical β-cell autoimmunity is variable and can last from months up to 13 years before
clinical diabetes ensues (Bonifacio et al., 1990;Johnston et al., 1989). The prevalence of type 1
diabetes in children aged less than 15 years ranges from 0.05 to 0.3 % in most European and
North American populations (Rewers et al., 1988). The survival rate of type 1 diabetes is
prolonged dramatically by insulin treatment, but it does not cure type 1 diabetes. Recent research
efforts have focused on better understanding of the immunoregulatory and immunoeffector
mechanisms of pancreatic β-cell destruction (Winter & Schatz, 2003). A number of immune-
therapy interventions have already progressed to human clinical trials. A very recent
development of the pathoethiology of type 1 diabetes indicated that insulin responsive TRPV1
(transient receptor potential vanilloid-1) sensory neurons in β-cells play a fundamental role in the
progressive T-lymphocyte infiltration in pancreatic islets causing the stress and death of β-cells
(Razavi et al., 2006). This novel finding could open another avenue for the therapeutic strategies
of type 1 diabetes.
1.1.1.2 Type 2 diabetes
Type 2 diabetes, or adult-onset diabetes, is caused by insulin deficiency relative to the increased
need related to insulin resistance. The pathogenesis of type 2 diabetes involves the pancreatic β-
cells, the liver, and the peripheral target tissues (skeletal muscle and adipose tissue). A variable
degree of β-cell dysfunction occurs in these patients in addition to hepatic insulin resistance,
resulting in glucose overproduction. Skeletal muscle is also resistant to the action of insulin,
resulting in lower uptake of glucose into muscle cells and accumulation of glucose as glycogen
(Revers et al., 1984). Free fatty acids released from adipose tissues can induce insulin resistance
and facilitate the production of hepatic glucose, playing an important role in the pathogenesis of
4
type 2 diabetes (Rajala & Scherer, 2003;Trayhurn & Beattie, 2001). Recent research has focused
on the hormones and cytokines produced from adipose tissue (adipokines), which appear to play
an important role in regulating glucose and fat metabolism (Sell et al., 2006). Some factors such
as obesity, physical activity, dietary factors, are well known to be related to type 2 diabetes.
Obesity and weight gain have consistently been shown as the strongest risk factors for type 2
diabetes (Haffner, 1998;Knowler et al., 1993;O'Dea, 1992). Higher levels of physical activity are
reported to be associated with lower risk of type 2 diabetes (Hu et al., 1999).
The treatments of type 2 diabetes include management of diet, exercise, and drugs. Most of the
diabetic individuals can maintain good glycemic control by the management of diet and proper
exercise. Others need drug treatment, such as injection of insulin, stimulation of insulin secretion
with sulfonyurea and glucagon-like peptide (GLP) -1 (ByettaTM) (Levy, 2006), and other drugs
that counter insulin resistance such as rosiglitazone (AvandiaTM) and pioglitazone (ActosTM)
(Moller, 2001;Saltiel & Olefsky, 1996). Poor glycemic control will expose individuals to long-
term hyperglycemia, leading to the development of a number of diabetes-associated
complications of microvascular and macrovascular diseases (Brownlee, 2001;Reusch,
2003;Saltiel, 2001). Microvascular complications include pathologies in the retina, renal
glomerulus and peripheral nerves. Those complications are the major cause of diabetes-related
blindness, end-stage renal diseases, and a variety of debilitating neuropathies. Macrovascular
complications involve accelerated atherosclerosis of arteries, affecting the blood supply of heart,
brain and lower extremities.
1.1.1.3 The burden of diabetes
It has been widely recognized that diabetes and the related complications are becoming one of
the main burdens to human health in the twenty-first century. It was estimated that the total
5
number of diabetic patients all over the world is between 151 to 171 million in 2000, increasing
to 221 million in 2010, and to 366 million in 2030 (Kasuga, 2006). Accompanied with the
increase of the diabetic individuals, the number of diabetic complications, such as retinopathy,
nephropathy, neuropathy and atherosclerosis, will increase dramatically. The worldwide
mortality caused by diabetes in 2000 was estimated at 2.9 million. Based on the report on the
Canadian Diabetes Association (CDA, 2007), diabetes contributes to the deaths of approximately
41,500 Canadians each year, and adult Canadians with diabetes are twice as likely to die
prematurely. The financial burden of diabetes and the associated complications in Canada are
staggering, costing the Canadian healthcare system an estimated $13.2 billion each year. These
yearly costs will be increased to $15.6 billion by 2010, and $19.2 billion by 2020 (CDA, 2007).
1.1.2 Development and Progression of Type 2 Diabetes
Type 2 diabetes accounts for more than 90% of global diabetes cases. It is very important to
understand the mechanisms for the development of type 2 diabetes and the relative approaches
for the prevention and treatment of this disorder. It is well recognized that the pathogenesis of
type 2 diabetes involves complex interplay of adipokines, insulin resistance, and β-cell
dysfunction (Figure 1). 60% to 90% of type 2 diabetic cases appear to be related to obesity
(Anderson et al., 2003). Adipokines (hormones and cytokines produced by adipose tissue)
appear to play a major role in inducing insulin resistance related to obesity. Preceding the
development of hyperglycemia, insulin resistance occurs primarily in the liver, skeletal muscle
and adipose tissue, collectively contributing to incremental increase in metabolic demand for
insulin. Pancreatic β-cells will compensate for insulin resistance by increasing β-cell mass and
hypersecretion of insulin. During this period, the body can maintain normal or near-normal
glycemia due to the compensation by β-cells (Kloppel et al., 1985). However, at some point
6
following this compensation period, β-cells fail to secrete sufficient insulin and type 2 diabetes
ensues.
7
Figure 1. Development and progression of type 2 diabetes
Type 2 diabetes is usually related to obesity. Adipokines, free fatty acids (FFAs), and chronic inflammation in adipose tissue are the common factors inducing insulin resistance in skeletal muscle, the liver and adipocytes. Initially, pancreatic β-cells compensate for insulin resistance through hypersecretion of insulin to maintain a normal or near-normal glucose level over a period of years. However, over time, β-cell dysfunction (β-cell failure) occurs and insulin secretion begins to decrease, leading to the development of hyperglycemia and diabetes. The figure is adapted from (Kasuga, 2006) with a granted permission.
8
1.1.2.1 Insulin action
Insulin, secreted from pancreatic β-cells, inhibits hepatic glucose production and facilitates
glucose uptake by skeletal muscle and adipose tissues, thus reducing the level of plasma glucose.
The action of insulin is mediated by its binding to cell surface insulin receptors (IR) and the
subsequent cascade of biochemical interactions. Binding of insulin with IR activates the
receptor’s intrinsic tyrosine kinase activity. The activated tyrosine kinase phosphorylates
intracellular substrates, such as insulin receptor substrate (IRS) proteins, followed by two major
signaling pathways (Avruch, 1998;Taniguchi et al., 2006). The first pathway is the
phosphatidylinositol 3-kinase (PI3K)-AKT/proteins kinase B (PKB) pathway, which transmits
most of the metabolic actions of insulin, such as glucose uptake, glucose and protein synthesis
and gluconeogenesis. The increment of glucose uptake is mediated by the recruitment and
translocation of the glucose tranporter, GLUT4 protein from an intracellular pool to the cell
membrane. The second pathway is the Ras-mitogen-activated protein kinase (MAPK) pathway
(Virkamaki et al., 1999), which is responsible for the regulation of gene expression, cell growth
and differentiation in cooperation with PI3K pathway. Insulin resistance, an impairment of
insulin action, is a condition of decreased ability of insulin to lower circulating glucose levels.
The mechanism of insulin resistance is largely not defined, but observation of the decreased
insulin sensitivity among relatives of people with type 2 diabetes suggests a genetic association.
Other factors, like obesity, aging, elevated free fatty acid, as well as hyperglycemia, contribute to
the development of insulin resistance and type 2 diabetes.
1.1.2.2 Hepatic insulin resistance
The liver plays an important role in maintaining glucose homeostasis, and hepatic insulin
resistance is one of the major contributors to the pathogenesis of type 2 diabetes. Basal hepatic
glucose output (HGO) is increased in type 2 diabetes. It has been reported that the degree of
9
abnormality of HGO positively and significantly correlates with the degree of fasting glucose
levels, suggesting that the rate of HGO contributes a major role for the elevated basal glucose
levels (Best et al., 1982). The impairment of insulin to suppress glucose release from the liver
leads the increased rate of HGO. There are some other factors contributing to HGO, such as
inability of glucose to inhibit its own release from the liver (Revers et al., 1984), and increased
glucagon secretion from pancreatic α-cells, which can decrease the suppressive effects of insulin
and glucose on HGO (Baron et al., 1987).
Postprandial HGO is also increased due to defects in hepatic sensitivity to glucose and insulin in
type 2 diabetes (Felig et al., 1978). Glucose and insulin enter the liver via the portal circulation
after feeding. This changes the function of the liver from a glucose production organ in fasting
state to a glucose storage organ in postprandial state, during which glucose is stored in the form
of glycogen in the liver. However, because the liver of a type 2 diabetes patient is not sensitive to
insulin and glucose, HGO can not be effectively suppressed; hence further increasing blood
glucose levels. In the early stage of insulin resistance and prediabetic state, the decreased
suppression of HGO from the liver is a major contributing factor to postprandial hyperglycemia.
1.1.2.3 Insulin resistance in skeletal muscle and adipose tissue
It is well established that type 2 diabetes is characterized by peripheral insulin resistance of the
skeletal muscle and adipose tissue. Some of the signaling factors, such as IRS-1, PI3K and
glycogen synthase kinase (GSK)-3, have been demonstrated to be defective in peripheral insulin
resistance subjects (Beeson et al., 2003;Nikoulina et al., 2000). Functional inactivation of the
insulin growth factor (IGF)-I and insulin receptors (IR) in skeletal muscle has been shown to
cause impaired insulin and IGF-I receptor signaling pathways in MKR mice, an animal model of
diabetes initiated by insulin resistance in skeletal muscle (Fernandez et al., 2001).
10
Skeletal muscle and adipose tissue are the two major organs involved in glucose metabolism.
The skeletal muscle is the main organ for glucose oxidation (glucose usage as metabolic fuel),
whereas adipose tissue is the major organ for energy storage in the form of triglycerides. More
and more studies have been focusing on the crosstalk between adipocytes and skeletal muscle
cells to unveil the connection between obesity and type 2 diabetes (Sell et al., 2006;Kahn & Flier,
2000). It has become clear recently that adipocytes, other than storing energy, are active
secretory cells capable of releasing free fatty acids (FFAs) and producing a variety of cytokines
(Rajala & Scherer, 2003;Trayhurn & Beattie, 2001). These so-called adipocytokines (or
adipokines) include TNFα, IL-6, IL-8, MCP (monocyte chemoattractant protein)-1, PAI
(plasminogen activator inhibitor)-1, and leptin (both as an insulin sensitizer and a contributor to
the insulin-resistance) (Sell et al., 2006). It is now recognized that a negative crosstalk between
excess body fat and skeletal muscle causes the disturbances of insulin signaling in skeletal
muscle, leading to insulin resistance (Dietze-Schroeder et al., 2005;Dietze et al., 2002;Dietze et
al., 2004). Among these adipocytokines found, adiponectin is a positive regulator of insulin
sensitivity (Lihn et al., 2005). In general, insulin resistance in skeletal muscle cells share the
similar pathway as those involved in inflammation, cellular stress (ER-stress), and mitogenesis.
1.1.2.4 Insulin action in brain and pancreatic β-cells
Non-classical insulin target tissues, such as the brain and pancreatic β-cells have been revealed in
the studies of mouse models with targeted mutations in genes encoding insulin signaling
mediators. Tissue specific knockout of insulin receptors in brain have shown the importance of
insulin signaling in central nervous system (CNS) in the regulation of energy metabolism and
reproduction (Bruning et al., 2000). Transgenic rescue of insulin receptor-deficient mice further
demonstrated that insulin action in the brain plays a dominant role of maintaining energy
homeostasis (Okamoto et al., 2004). In addition to the direct effect of insulin on the liver, insulin
11
has been shown to regulate hepatic glucose output (HGO) via signaling events in the
hypothalamus (Plum et al., 2006). The mechanism of hypothalamic insulin action in controlling
glucose utilization in the periphery was reported through its action on central ATP sensitive K+
(KATP) channels, leading to a decreased expression of glucose-6-phosphatase and
phosphoenolpyruvate kinase in the liver (Obici et al., 2002;Pocai et al., 2005). IL-6 and STAT3
in the liver have been recently reported to be responsible for the inhibition of HGO induced by
intracerebroventricular injection of insulin (Inoue et al., 2006). It has been reported that
PI3K/AKT signaling in the mediobasal hypothalamus regulates peripheral glycemic response to
insulin (Gelling et al., 2006).
Insulin action in pancreatic β-cells was first reported in IRS-2-deficient mice (Withers et al.,
1998). Tissue specific knockout mice of insulin receptor in pancreatic β-cells have a defect in
glucose sensing and insulin secretion, similar to that in type 2 diabetes (Kulkarni et al., 1999).
Therefore, insulin resistance in pancreatic β-cells may also be one of the contributing factors in
the development of type 2 diabetes.
1.1.2.5 Pancreatic β-cell dysfunction
In the state of insulin-resistance, pancreatic β-cells compensate for the increased need of insulin
by upregulating secretion to maintain euglycemia. Over time, pancreatic β-cell compensation for
the insulin resistance fails, leading to a progressive decline of insulin secretion and type 2
diabetes. The β-cell failure could be a result from both inadequate expansion of β-cell mass
(Jetton et al., 2005) and a dysfunction of the existing β-cells in response to glucose (Kahn, 2003).
The functional defects of β-cells manifest early in the natural history of type 2 diabetes and are
hallmarked by abnormal basal insulin secretion and loss of both first and second phases of
insulin release in response to glucose challenge. At the time of diagnosis of type 2 diabetes, β-
12
cell mass is significantly reduced as well. The mechanisms involved in β-cell failure might be
caused by a defect in insulin and insulin growth factor (IGF)-1 signaling in pancreatic β-cells.
Tissue-specific knockout of insulin receptor in pancreatic β-cells caused a defect in glucose
sensing and a reduced β-cell mass (Kulkarni et al., 1999). Knocking out of IGF-1 receptor, on
the other hand, has little effect on β-cell mass, causing only a defect of glucose sensing (Kulkarni
et al., 2002;Xuan et al., 2002). However, the double knockout of both insulin receptor and IGF-1
receptor develop early-onset diabetes as a result of decreased β-cell mass (Ueki et al., 2006).
Phosphoinositide-dependent kinase (PDK)-1 is a common downstream mediator of both insulin
and IGF-1 signaling, and the mice lacking PDK-1 in β-cells develop diabetes as a result of β-cell
mass loss (Hashimoto et al., 2006). β-Cell specific knockout of glucokinase (GK) suggested that
glucose plays a dominant role in β-cell compensation for insulin resistance (Terauchi et al.,
2007;Weir & Bonner-Weir, 2007).
1.1.2.6 Dysregulation of glucagon secretion from pancreatic α-cells
The dysfunction of β-cells is the major characteristic of the impairment of endocrine activity of
the pancreas in the development of type 2 diabetes. However, the defect of insulin secretion is
often coupled with inappropriate secretion of glucagon from pancreatic α-cells, resulting in a
significant change in the insulin to glucagon molar ratio. It is the insulin to glucagon ratio that
mainly affects hepatic glucose production (Del Prato & Marchetti, 2004). When insulin secretion
is impaired and/or glucagon secretion is elevated, insulin to glucagon ratio becomes lower. This
will cause an increased level of basal endogenous glucose concentration, termed fasting
hyperglycemia. Due to the decreased insulin to glucagon ratio, hepatic glucose output cannot be
effectively suppressed after ingestion of a meal, leading to an excessive rise of postprandial
glucose. Basal glucagon secretion plays an important role in maintaining the basal hepatic
13
glucose production and the physiological balance of circulating blood glucose. Concomitant to
glucose-stimulated insulin secretion, glucagon secretion is usually suppressed. However, this
suppression is impaired in type 2 diabetes (Baron et al., 1987). Furthermore, amino acid infusion
or protein ingestion has been reported to cause much higher stimulation of glucagon secretion in
subjects with type 2 diabetes than that in the normal controls (Gerich et al., 1975). Numerous
studies implicated that reduced inhibition of endogenous glucose release rather than impaired
glucose clearance contributes to hyperglycemia in type 2 diabetes (Ferrannini et al., 1988).
Taking into account the role of inappropriate glucagon secretion from α-cells, restoration of
more physiological insulin to glucagon ratio appears to be a natural target for therapeutic
intervention. Glucagon-like peptide (GLP) -1 and its agonists have been shown to both stimulate
glucose-dependent insulin secretion and inhibit glucagon release in type 2 diabetic subjects
(D'Alessio & Vahl, 2004;Lim & Brubaker, 2006).
1.2 Pancreatic β- and α-Cell Stimulus-Secretion Coupling
1.2.1 β-Cell Stimulus-Secretion Coupling
Pancreatic β-cells are designed to sense the change in blood glucose levels with the function of
adjusting insulin release according to the body needs. The mechanism underling glucose-
stimulated insulin secretion has been well documented (Rorsman & Renstrom, 2003). In a
consensus model, uptake of glucose by β-cells enhances mitochondrial oxidation and efficient
ATP production. The elevation of ATP/ADP ratio closes KATP channels, leading to membrane
depolarization, opening voltage-dependent Ca2+ (CaV) channels, and fusion of insulin containing
secretory granules with plasma membrane (Figure 2).
14
Figure 2. β-Cell stimulus-secretion coupling
1) Glucose enters a β-cell through the GLUT2 glucose transporter. 2) Metabolism of glucose increases the generation
of ATP by mitochondria, leading to an increase in cytosolic ATP/ADP ratio, 3) which inhibits KATP channels at the
plasma membrane. 4) Closure of the KATP channel leads to membrane depolarization and activation of L-type CaV
channels. 5) Ca2+ influx through CaV channels triggers exocytosis of nearby insulin containing granules via 6) the
cellular SNARE protein machinery. 7) Activation of KV channels repolarize membrane potential, 8) and shut off CaV
channels and temporarily inhibit insulin release. CaV and KV channels activate in a rhythmic pattern resulting in
oscillations of membrane potential, intracellular calcium concentrations and insulin release.
15
1.2.1.1 Glucose metabolism and ATP production in β-cells
Glucose stimulates β-cell insulin secretion via its metabolism and generation of downstream
signals (Maechler et al., 2006;Wiederkehr & Wollheim, 2006;Wollheim & Maechler, 2002).
Pancreatic β-cells take up glucose through the glucose transporter GLUT2 in rodents and mainly
GLUT1 in humans (Thorens et al., 1988). After entering into β-cells, glucose is phosphorylated
by glucokinase (GK) to eventually generate pyruvate. Since the level of lactate dehydrogenase is
extremely low in β-cells (Matschinsky, 2002), pyruvate is the main end product of β-cell
glycolysis. Pyruvate preferentially enters mitochondria, where it is efficiently metabolized by the
tricarboxylic acid (TCA) cycle. The aerobic metabolism in β-cells is at least 3-fold higher than
that in most other cell types (Schuit et al., 1997). The oxidation of the TCA cycle generates CO2
and the reducing equivalents, FADH (flavin adenine dinucleotide) and NADH (nicotinamide
adenine dinucleotide). These reducing equivalents are transferred to the electronic transport
chain, resulting in hyperpolarization of mitochondrial membrane potential and generation of
ATP. Transferring of ATP from mitochondria to cytosol causes an increase in cytosolic ATP
concentration and ATP/ADP ratio, one of the most important signals to initiate the electrical
activity of β-cells during glucose-stimulated insulin secretion.
1.2.1.2 ATP-sensitive K+ (KATP) channels as metabolic sensors
The central part of the cascade event leading to glucose-stimulated insulin secretion is the
induction of β-cell electrical activity. KATP channels sense metabolic changes and couple the
metabolism to the electrical activity in β-cells (Ashcroft & Rorsman, 1990;Ashcroft, 2005).
Under low glucose, the ATP/ADP ratio in the cytoplasm is low, and KATP channels are open.
Positively charged K+ constantly flow out through the opening of KATP channels, leading to a
negative membrane potential of β-cells (resting potential at -70 mV). Conversely, under high
16
glucose, the influx of glucose and the increased glucose oxidation result in an elevated
ATP/ADP ratio, which closes KATP channels. Blockade of the efflux of positively charged K+
through KATP channels causes depolarization of plasma membrane and initiates further electrical
activities, such as Ca2+-dependent action potentials and the subsequent insulin secretion from β-
cells. The important roles of KATP channels in β-cells have been demonstrated by the widely used
sulfonylurea drugs, such as tolbutamide and glibenclamide, in the treatment of type 2 diabetes
(Gribble & Reimann, 2003). These drugs stimulate insulin secretion by binding and closing KATP
channels. In contrast, the KATP channel opener diazoxide inhibits β-cell insulin secretion
independent of blood glucose level (Ashcroft & Gribble, 2000).
1.2.1.3 Ca2+ influx is critical to trigger β-cell exocytosis
The entry of extracellular Ca2+ through voltage-dependent Ca2+ (CaV) channels takes center stage
in glucose-stimulated insulin secretion in pancreatic β-cells (Yang & Berggren, 2006). Elevated
glucose level is sensed by β-cell KATP channels, which depolarize membrane potential through
the channels closure. In response to the membrane depolarization, CaV channels are open,
resulting in a rapid influx of extracellular Ca2+ into the cytoplasm. The increased intracellular
Ca2+ ([Ca2+]i) serves as a second messenger to couple electrical signaling to Ca2+-dependent
cellular processes, such as exocytosis of insulin secretory granules (Ashcroft & Rorsman,
1989;Jing et al., 2005;Rorsman et al., 2000). Another important role of [Ca2+]i is to maintain β-
cell mass and function (Namkung et al., 2001;Sjoholm, 1995). The Ca2+ entry through CaV
channels is uneven over the plasma membrane and locally high [Ca2+]i concentrations have been
detected in pancreatic β-cells (Bokvist et al., 1995;Quesada et al., 2000;Theler et al., 1992) as
well as chromaffin cells (Monck et al., 1994). These observations have led to the concept of the
existence of Ca2+ microdomains beneath the plasma membranes and their control on exocytosis
via recruiting key effect proteins to exocytotic sites (Rutter et al., 2006). Synaptotagmin is
17
widely recognized as a Ca2+ sensor that mediates the elevated intracellular Ca2+ to the exocytotic
proteins such as SNAP-25 and syntaxin 1A to initiate exocytosis of insulin secretory granules
from pancreatic β-cells (Barg et al., 2001;Brunger, 2000;Li & Chin, 2003;Rorsman & Renstrom,
2003). However, the mechanism of the spatial and temporal regulation of CaV channels and
SNARE proteins in the plasma membranes is less studied.
1.2.1.4 Biphasic insulin secretion
The final step of glucose-stimulated insulin secretion is the fusion of insulin secretory granules
with the plasma membrane, a process termed exocytosis. A set of exocytotic proteins referred to
as soluble N-ethylmaleimide sensitive fusion attachment receptor (SNARE) proteins is critically
involved in this membrane fusion process (Rorsman & Renstrom, 2003). According to the
“zipper” model (Bruns & Jahn, 2002), SNARE proteins facilitate exocytosis by zipping vesicle
membranes with the plasma membrane. The conformational changes of the SNARE proteins are
believed to provide the energy for the membrane fusion. Glucose-stimulated insulin secretion is
characterized by a biphasic time course (Rorsman et al., 2000). The first phase is a rapid and
transient secretion shortly after the elevation of glucose concentration, which is maintained for
about 10 min. Following a nadir, a gradually increasing second phase secretion reaches a plateau
after another 25 – 30 min (Yang & Berggren, 2006). The defect of insulin secretion in type 2
diabetes involves a loss of first phase and a reduction of second phase insulin secretion (Rorsman
& Renstrom, 2003). Whereas glucose can elicit both first and second phases insulin secretion,
membrane depolarization resulted from other stimuli such as sulphonyureas and increase in
extracellular K+ can only initiate the first phase insulin secretion, indicating that the second
phase insulin secretion is an energy-dependent process (Henquin, 2000;Rorsman et al., 2000).
Stimulation of the first phase insulin secretion by sulphonyureas also indicates it is KATP
channel-dependent. In contrast, the second phase insulin secretion has been suggested to be a
18
KATP channel-independent mechanism (Henquin et al., 2003;Straub & Sharp, 2002). Both first
and second phase insulin secretion are regulated by [Ca2+]i (Henquin et al., 2003).
It has been proposed that the biphasic insulin secretion reflects the existence of distinct
functional pools (Rorsman & Renstrom, 2003). Approximately 1 – 5% of the total insulin
granules belong to a readily releasable pool (RRP) (Neher, 1998). Those granules are docked just
beneath the plasma membrane and are immediately available for exocytosis without any further
modification after stimulation. Release of insulin from RRP is believed to underlie the first phase
insulin secretion. The majority of granules (95 – 99%) is not immediately available for release
and belongs to a reserve pool (RP). In order to gain release competence, granules from the RP
must undergo a series of ATP, Ca2+, time and temperature-dependent reactions, a process
referred as mobilization or priming (Rorsman & Renstrom, 2003). The release of subsequently
primed granules from RP proceeds at much lower rate, underlying the second phase insulin
secretion.
1.2.2 α-Cell Stimulus-Secretion Coupling
Constituting a proportion of 15-20% of the total pancreatic islet cells (Soria et al., 2000), α-cells
are the second largest group of the endocrine pancreas. α-Cells secrete glucagon in response to
low blood glucose level. Glucagon is the major counter-regulatory hormone to insulin and is
critical in regulating blood glucose homeostasis (Cryer et al., 2003). Inappropriate secretion of
glucagon plays an important role in initiating and maintaining elevated blood glucose in type 2
diabetes (Gerich et al., 1976;Jiang & Zhang, 2003). Whereas pancreatic β-cell stimulus-secretion
coupling has been well documented (Rorsman & Renstrom, 2003), the mechanism underlying α-
cell stimulus-secretion coupling remains an enigma despite intensive research over the last 35
years (Gromada et al., 2007). Two major fundamentally different theories have emerged,
19
involving direct effect of glucose and other nutrients, and indirect action mediated by paracrine
regulation from β- and δ-cells (Figure 3).
20
Figure 3. α-Cell stimulus-secretion coupling
The stimulus-secretion coupling of rat pancreatic α-cells was recently reported to mirror that of β-cells. 1) The higher ATP/ADP ratio under low glucose is thought to 2) partially close KATP channel at the plasma membrane. 3) Closure of the KATP channel leads to membrane depolarization and activation of different types of CaV channels and NaV channels. 4) Ca2+ influx through CaV channels triggers exocytosis of the nearby glucagon containing granules via 5) the cellular SNARE protein machinery. 6) Activation KV channels repolarize membrane potential and 7) shut off CaV channels, leading to an inhibition on glucagon release. This is important for reactivation of CaV and NaV channels. 8) Under high glucose condition, the increased ATP/ADP ratio (though minor) further closes KATP channels and leads to strong Ca2+ influx and glucagon secretion. The observed inhibition of glucose on glucagon secretion is thought to be due to a paracrine effect, such as 9) insulin, Zn and GABA secreted from β-cells; 10) somatostatin secreted from δ-cells. 11) Glucagon secreted from α-cells stimulate glucagon secretion.
21
1.2.2.1 Glucose metabolism and inhibition of glucagon secretion of pancreatic α-cells
High glucose has long been recognized to inhibit glucagon secretion (Heding, 1971;Unger et al.,
1970). In contrast, low blood glucose concentration can stimulate glucagon secretion (Gerich et
al., 1974b;Ohneda et al., 1969;Santiago et al., 1980). In vitro studies have shown α-cells are
more sensitive to glucose than β-cells (Gerich et al., 1974a;Hahn et al., 1974;Marliss et al.,
1973), with a threshold of 2 – 3 mM glucose to inhibit glucagon secretion comparing to a
threshold of 4 – 5 mM glucose to stimulate insulin secretion. Glucose enters α-cells through
GLUT1, a lower capacity glucose transporter than GLUT2 in β-cells, and phosphorylated by
glucokinase (GK) to generate pyruvate (Heimberg et al., 1995;Heimberg et al., 1996;Tu et al.,
1999). Instead of entering mitochondria for aerobic metabolism in β-cells, pyruvate stays in
cytosol of α-cells and is metabolized to lactate by the higher expression of lactate dehydrogenase
(Schuit et al., 1997;Sekine et al., 1994). Therefore, α-cell glucose metabolism is largely
anaerobic, and more pyruvate and lactate are accumulated in α−cell cytosol. Furthermore, the
glucose metabolism rate in isolated rat α-cells is only 20 – 40% of that in β-cells (Gorus et al.,
1984;Schuit et al., 1997). All those metabolic characteristics of α-cells are in accordance to the
observation that glucose-induced increase in intracellular ATP is significantly smaller in α-cells
than that in β-cells (Ishihara et al., 2003;Ravier & Rutter, 2005).
1.2.2.2 KATP channel-mediated glucose stimulation of glucagon secretion
Contrary to the well accepted early observation of glucose inhibition on glucagon secretion from
in vivo studies (Heding, 1971;Ohneda et al., 1969;Unger et al., 1970), recent data from in vitro
studies seems to favor a hypothesis that glucose actually stimulates glucagon secretion (Franklin
et al., 2005;Ishihara et al., 2003;Olsen et al., 2005;Salehi et al., 2006;Takahashi et al., 2006).
The glucose-stimulated glucagon secretion from isolated rat α-cells was thought to follow the
22
similar mechanism as that of β-cells (Franklin et al., 2005;Olsen et al., 2005). Although glucose
oxidation rate in α-cells is much lower than that in β-cells (Gorus et al., 1984;Quesada et al.,
2006;Schuit et al., 1997;Detimary et al., 1998), the ATP concentration and ATP/ADP ratio in rat
α-cells is already high (~ 7 ATP/ADP compared to ~ 2.5 in β-cells) under low glucose conditions
(1 mM) (Detimary et al., 1998). This higher basal ATP/ADP ratio has been proposed to sustain a
very low KATP channel activity in α-cells (Detimary et al., 1998), resulting in a partial
depolarization of membrane potential to around the threshold for action potential firing (-60 mV)
of α-cells. Then the low voltage-activated (LVA) T-type CaV channels activate and bring to the
threshold membrane potentials (-30 to -40 mV) for the opening of voltage gated Na+ (NaV)
channels and high voltage-activated (HVA) CaV channels (L-type and N-type), resulting in basal
glucagon secretion (Barg et al., 2000;Wendt et al., 2004). The elevated glucose level and the
metabolism further close KATP channels, leading the sequential opening of NaV and HVA CaV
channels. This will generate rapid and large upstroke of action potential (often above 0 mV) and
glucagon secretion (Franklin et al., 2005;Olsen et al., 2005). The role of KATP channels in
mediating the coupling of glucose metabolism and α-cell electrical activities is supported by the
recognition that the KATP channel blocker tolbutamide as well as the glycolytic intermediate
pyruvate depolarize the plasma membrane and stimulate glucagon secretion from isolated rat α-
cells (Bokvist et al., 1999;Franklin et al., 2005;Olsen et al., 2005). On the other hand, KATP
channel opener diazoxide and mitochondrial cytochrome c oxidase inhibitor sodium azide
(inhibits ATP formation) suppress basal release of glucagon and abolish glucose-induced
glucagon secretion from isolated rat α-cells (Franklin et al., 2005;Olsen et al., 2005).
1.2.2.3 Contradictions of α-cell stimulus-secretion coupling
In conflict with the above rat model, glucose-induced closure of KATP channels and the resultant
membrane depolarization in mouse α-cells were reported to reduce electrical excitability (Gopel
23
et al., 2000b;Gromada et al., 2004). The explanation for this observation is that T-type CaV
channels and NaV channels in mouse α-cells undergo voltage-dependent inactivation after
membrane depolarization. This will inhibit the generation of action potentials, thus membrane
potential will never reach the level to open HVA CaV channels, causing a suppression of
glucagon secretion. However, others have reported that glucose hyperpolarizes mouse α-cell
membrane potential (Barg et al., 2000;Bode et al., 1999;Hjortoe et al., 2004;Liu et al., 2004b).
Furthermore, a recent study showed high glucose directly stimulated glucagon secretion in
mouse α-cells under hyperpolarizing conditions, in which [Ca2+]i was lower than basal level
(Salehi et al., 2006). This implies that glucose stimulatory action on glucagon secretion is Ca2+-
independent, and glucose initiates rather than amplifies glucagon secretion. The action of glucose
on α-cell glucagon secretion remains hotly debated and unresolved, and needs to be further
elucidated.
1.2.2.4 Paracrine mediated glucose inhibition on glucagon secretion
The above discrepant data of α-cell stimulus-secretion coupling may be in part reflected by the
involvement of paracrine effects from adjacent islet cells. There are three other types of
pancreatic islet cells, insulin-producing β-cells, somatostatin-secreting δ-cells, and pancreatic
polypeptide-releasing PP cells. The stimulatory action of glucose on glucagon secretion was
observed from isolated rat islet cells (Franklin et al., 2005;Olsen et al., 2005), whereas the
inhibitory action of glucose on glucagon secretion was based on the study of intact mouse islets
(Gromada et al., 2004). Ample research has recently favored the hypothesis of paracrine /
endocrine regulation of α-cell glucagon secretion. These include insulin, γ-aminobutyric acid
(GABA), and Zn2+ secreted from β-cells, as well as somatostatin secreted from δ-cells. Glucagon
24
promotes α-cell exocytosis (Ma et al., 2005), implicating a positive autocrine feed back (Figure
3). Below is a brief introduction of the roles of insulin, GABA and somatostatin.
Insulin has been considered the most likely candidate to inhibit α-cell glucagon secretion for a
long time (Unger, 1985). On the one hand, neutralization of endogenous insulin with antibodies
in vitro resulted in an enhancement of glucagon secretion in rat (Franklin et al., 2005;Maruyama
et al., 1984) and human (Brunicardi et al., 2001). On the other hand, exogenously added insulin
has been shown to inhibit glucagon secretion from isolated rat α-cells (Franklin et al.,
2005;Ravier & Rutter, 2005). In addition, the decrement in insulin secretion has been reported to
improve glucagon response to hypoglycemia in advanced type 2 diabetes (Israelian et al., 2005).
This has led to the β-cell “switch-off” hypothesis, proposing that “a sudden cessation of insulin
secretion from β-cells during hypoglycemia is a necessary signal for α-cell response to secrete
glucagon” (Hope et al., 2004;Zhou et al., 2004). Insulin receptor has been found to be
abundantly expressed in rat α-cells (Franklin et al., 2005), as well as clonal αTC6 and In-R1-G9
cells (Kisanuki et al., 1995). Inhibition of insulin on α-cell glucagon secretion is thought to be
mediated through the PI3K/AKT signaling pathway, involving modulation of ion channel
activities. In a mouse model, insulin has been shown to activate α-cell KATP channels (Franklin et
al., 2005), and this activation could be caused by reducing the sensitivity of the KATP channels to
ATP (Leung et al., 2006a). Insulin has also been reported to activate α-cell GABAA receptors by
receptor translocation and activation (Xu et al., 2006). Activation of both KATP channels and
GABAA receptors in α-cells causes membrane hyperpolarization, leading to an inhibition of
glucagon secretion.
Recent studies have revealed the emerging role of β-cell secretory product GABA on regulating
glucagon secretion. Evidence has shown that GABA secreted from synaptic-like microvesicles
25
(SLMVs) directly inhibited static glucagon secretion from rat islets (Wendt et al., 2004).
Exogenous GABA has been reported to inhibit arginine-induced glucagon secretion in mice and
guinea pigs (Gilon et al., 1991;Rorsman et al., 1989) as well as isolated rat α-cells and clonal
αTC6 cells (Olsen et al., 2005;Gaskins et al., 1995). GABAA receptors have been reported to be
expressed in guinea pig and rat α-cells but not in rat β- and δ-cells (Rorsman et al., 1989;Wendt
et al., 2004). GABAA receptors are Cl- channels, and activation of the receptors typically causes
an influx of Cl-, leading to membrane hyperpolarization and inhibition of excitability. In
response to glucose, GABA is co-secreted with insulin from β-cell secretory vesicles, and
activates α-cell GABAA receptors to inhibit glucagon secretion (Rorsman et al., 1989;Wendt et
al., 2004). However, high glucose has recently been reported to inhibit GABA release from β-
cells (Wang et al., 2006), arguing against the primary role of paracrine regulation by GABA on
α-cell glucagon secretion.
Pancreatic δ-cells secrete peptide hormone somatostatin under high glucose conditions
(Murakami et al., 1982;Olofsson et al., 2004). It has been well established that somatostatin is a
potent inhibitor for both glucagon and insulin secretion (Luft et al., 1978;Sakurai et al., 1974).
Somatostatin receptors belong to inhibitory G protein (Gi) coupled receptor families, showing a
tissue-specific expression pattern (Patel, 1999). Type 2 somastostatin receptor is predominantly
expressed in α-cells (Ludvigsen et al., 2004;Portela-Gomes et al., 2000), whereas type 1/5 in β-
cells (Kumar et al., 1999;Mitra et al., 1999). Two major different mechanisms are involved in
somatostatin receptor-mediated inhibition of glucagon secretion. The first is through the
activation of G protein coupled K+ channels in rat and mouse α-cells, leading to membrane
hyperpolarization and inhibition of α-cell electrical activities (Gromada et al., 2001b;Yoshimoto
et al., 1999). The second is through the inhibition of adenylate cyclase activity, reducing cAMP
26
levels and protein kinase A (PKA)-stimulated glucagon secretion (Fehmann et al., 1995;Hahn et
al., 1978;Schuit et al., 1989).
1.2.2.5 Other regulatory factors impacting glucagon secretion
Except for the glucose and paracrine regulations discussed above, some other factors might be
involved in regulating α-cell glucagon secretion, such as glucose-sensing neurons in
hypothalamus, hormone regulation by GLP-1, and autocrine regulation by glucagon. The region
for the central nervous system (CNS) regulation of glucagon secretion is thought to be located at
ventromedial hypothalamus (VMH) (Borg et al., 2003;Evans et al., 2004;McCrimmon et al.,
2004;Miki et al., 2001). Those studies found that VMH not only senses decreases in blood
glucose level, but also initiates counterregulatory response to hypoglycemia. It is believed that
the CNS could respond to hypoglycemia by increasing firing of glucose-inhibited neurons and
decreasing firing of glucose-excited neurons (Song et al., 2001). The sensing mechanism of
glucose level in the CNS is proposed to be similar to that in β-cells, since glucose-sensing
neurons within the VHM share many of the critical components for β-cell glucose-sensing, such
as glucose transporters, glucokinase, and KATP channels (Kang et al., 2004).
Glucagon-like peptide (GLP) -1 has recently been suggested to have suppressive effects on α-cell
glucagon secretion (Dunning et al., 2005). Released mainly from L-cells of the ileum and large
intestine, GLP-1 exerts its actions of both augmentation of glucose-stimulated insulin secretion
and inhibition in glucagon secretion (Brubaker & Drucker, 2004;Drucker, 2006). The direct
inhibitory effect of GLP-1 on glucagon secretion remains to be further investigated since
conflicting data on the expression of GLP-1 receptor (GLP-1R) have been reported in rats α-cells
(Moens et al., 1996;Heller et al., 1997;Moens et al., 1996). GLP-1 could inhibit glucagon
secretion indirectly via stimulation of the neighboring β- and δ-cells (Gromada et al., 2004;Li et
27
al., 2005). A recent report has shown an autocrine regulation on glucagon secretion in rat and
mouse α-cells (Ma et al., 2005). Glucagon receptors have been found to be expressed in rat and
mouse α-cells. Activation of the receptors by glucagon caused an elevation of cAMP levels and
exocytosis in purified rat and mouse α-cells (Ma et al., 2005). This suggests a positive feedback
of glucagon secretion.
1.2.3 Ion Channels in Pancreatic β- and α-Cells
As discussed above, the electrical activities of β- and α-cells play a central role in stimulus-
secretion coupling. What underlie the electrical activities of both islet cells are the various types
of ion channels. Our knowledge about ion channels has been accumulating quickly with the
application of advanced techniques, such as patch clamp, X-ray crystallography, molecular
biology and confocal microscopy. Studies in combination of those new technologies have
provided us an insight of ion channels, such as biophysical and pharmacological properties,
molecular structures, subcellular distributions and functions. Below is a brief discussion of the
major types of ion channels identified in pancreatic β- and α-cells, including KATP, CaV, and KV
channels.
1.2.3.1 KATP channels
In many tissues, KATP channels are central in coupling cell metabolism to electrical activities.
Pancreatic β-cells are the best example for the important role of KATP channels in coupling the
changes of blood glucose concentration to insulin secretion (Ashcroft & Rorsman, 1989). Under
high glucose concentration, the increased metabolism and the resultant elevated ATP/ADP ratio
leads to the closure of β-cell KATP channels. This will result in Ca2+ influx and Ca2+-dependent
insulin secretion. KATP channels have been recently reported to play a similar role in pancreatic
28
α-cells as that in β-cell (Franklin et al., 2005;Olsen et al., 2005), in which they mediate glucose
metabolism to glucagon secretion in α-cells.
KATP channels are octameric complexes comprised of four inwardly rectifying potassium (Kir6.x)
channel subunits and four sulfonylurea receptors (SURx) subunits (Clement et al., 1997;Shyng &
Nichols, 1997;Inagaki et al., 1995a). Kir6.x are the pore-forming subunits (Inagaki et al.,
1995b;Sakura et al., 1995) with two isoforms, Kir6.1 and Kir6.2. Kir6.1 is expressed in vascular
smooth muscle (Inagaki et al., 1995b), and Kir6.2 is widely expressed in many types of tissue
(Sakura et al., 1995). Binding of ATP to Kir6.x results in closure of KATP channels (Tanabe et al.,
1999;Tucker et al., 1997). SUR is a member of the ATP-binding cassette superfamily with
multiple membrane-spanning domains and two nucleotide binding folds (Aguilar-Bryan et al.,
1995). Mg-ADP stimulates KATP channels through the two cytosolic nucleotide binding domains
(Gribble et al., 1997;Nichols et al., 1996). SUR is the site of action for KATP channel opener
drugs (e.g., diazoxide) and the channel blocker drugs (e.g., glibenclamide, tolbutamide) (Aguilar-
Bryan et al., 1995;Tucker et al., 1997). Differences in SUR subunit composition endow the KATP
channels with different sensitivities to metabolism and drugs (Gribble & Reimann, 2003;Liss et
al., 1999). SUR1 is expressed in pancreas and brain (Aguilar-Bryan et al., 1995), SUR2A in
cardiac and skeletal muscle (Chutkow et al., 1996;Inagaki et al., 1996), and SUR2B in a variety
of tissues including brain and smooth muscle (Isomoto et al., 1996;Ashcroft, 2005).
The critical role of KATP channels in regulating β-cell insulin secretion has been well documented
almost two decades ago (Ashcroft & Rorsman, 1989). Kir6.2 and SUR1 are expressed in β-cells
from all species and cell lines investigated (Ashcroft et al., 1989;Misler et al., 1989;Suzuki et al.,
1997;Suzuki et al., 1999). The resting membrane potential (about -70 mV) of β-cells is primarily
controlled by the KATP channels (Ashcroft & Rorsman, 1989). Under elevated glucose level, the
29
closure of KATP channels both initiates and extends electrical activities required for Ca2+-
dependent action potential and the resultant insulin secretion (Ashcroft et al., 1984;Kanno et al.,
2002). The important role of KATP channels in regulating β-cell insulin secretion has been
underscored by the successful clinical application of the channel blocker sulfonylurea
compounds in the treatment of type 2 diabetes (Del Prato & Pulizzi, 2006). Mutations of human
SUR1 (Dunne et al., 2004;Thomas et al., 1995) and Kir6.2 (Thomas et al., 1996;Nestorowicz et
al., 1997) cause congenital hyperinsulinism of infancy, which is characterized by unregulated
insulin secretion despite severe hypoglycemia (Dunne et al., 2004). Kir6.2-deficient mice
generated by either dominant-negative transgenic mice (Miki et al., 1997) or knockout mice
(Miki et al., 1998) exhibited transient hypoglycemia in neonates and impaired glucose-
stimulated insulin secretion in adults. All those data have indicated the important role of KATP
channels in maintaining normal β-cell function.
The role of KATP channels in pancreatic α-cells remains controversial, and different data were
collected among different species (Gromada et al., 2007). KATP channels have been found to be
expressed in mouse (Barg et al., 2000;Leung et al., 2005a) and rat α-cells (Bokvist et al.,
1999;Olsen et al., 2005) as well as clonal αTC6 cells (Rajan et al., 1993;Ronner et al., 1993).
The KATP channel densities in mouse α-cells is comparable to that in mouse β-cells, but their
sensitivity to ATP in α-cells is much higher than that in β-cells (Leung et al., 2005a). The high
ATP sensitivity of KATP channels in mouse α-cells might be required for the fine regulation of
glucagon secretion by metabolism. Glucose has been shown to inhibit KATP channel activities in
single rat (Olsen et al., 2005) and mouse α-cells (Gromada et al., 2004). KATP channel subunit
SUR1-deficient mice have been shown to exhibit impaired glucagon secretion in response to low
glucose concentration (Doliba et al., 2006;Gromada et al., 2004;Munoz et al., 2005;Shiota et al.,
2005). Contrary to the above SUR1-deficient mice, Kir6.2-deficient mice have been shown to
30
remain low-glucose responsive with regard to glucagon secretion (Miki et al., 2001). The
discrepancies between the two types of KATP channel knockout mice as well as the role of KATP
channel in regulating α-cell hormone secretion remains to be investigated.
1.2.3.2 CaV channels
Ubiquitously expressed in a variety of cell types throughout the body, CaV channels execute
unique functions in different cell types, such as muscle contraction, neurotransmitter release, and
hormone secretion (Yang & Berggren, 2006). CaV channels function as Ca2+ conducting pores in
plasma membranes. In response to membrane depolarization, CaV channels open rapidly, leading
to a rapid influx of extracellular Ca2+ to cytoplasm, where Ca2+ functions as a second messenger
to couple electrical signaling to Ca2+-dependent protein-protein interaction and enzymatic
responses (Catterall, 2000). CaV channels in pancreatic β- and α-cells take a center stage in
hormone secretion and regulation of glucose homeostasis (Ashcroft & Rorsman, 1989;Gromada
et al., 2007;Yang & Berggren, 2006).
CaV channels are heteromultimeric proteins consisting of four subunits: CaVα1, CaVβ, CaVγ, and
CaVα2δ (Catterall, 2000;Curtis & Catterall, 1984;Leung et al., 1987;Takahashi et al., 1987).
Among the four CaV channel subunits, only the CaVα1 is large enough to contain four
homologous transmembrane domains forming a Ca2+ conducting pore, responsible for ion
conductance and selectivity, voltage-dependence, and pharmacological properties (Catterall,
2000;Takahashi et al., 1987). The other subunits, CaVβ, CaVγ, and CaVα2δ are auxiliary subunits,
modulating CaV channels in many important ways (Arikkath & Campbell, 2003). Based on the
primary structure analysis of CaVα1 subunits, CaV channels have been categorized into three
families, CaV1, CaV2 and CaV3, each of which consists of closely related members (Ertel et al.,
2000). The early electrophysiological studies classified CaV currents according to
31
phenomenological parameters including biophysical and pharmacological properties. Based on
this phenomenological nomenclature, CaV currents are categorized into L-type (CaV1.1, 1.2, 1.3
and 1.4), P/Q-type (CaV2.1), N-type (CaV2.2), R-type (CaV2.3), and T-type (CaV3.1, 3.2 and 3.3)
(Tsien et al., 1988). The L-, P/Q, N, and R-type CaV currents have high thresholds (~ -30 mV) of
activation, and therefore were referred to as high-voltage activated (HVA) CaV currents (Tsien et
al., 1988). On the other hand, T-type CaV currents have a low threshold (~ -60 mV) for activation
and were referred to as low-voltage activated (LVA) CaV currents (Tsien et al., 1988). Below is a
brief discussion of the roles of CaV channels in pancreatic β- and α-cells.
Pancreatic β-cells are equipped with a rich assortment of CaV channels including CaV1.2, CaV1.3,
CaV2.1, CaV2.2, CaV2.3, and CaV3.1 channels, and all those types of CaV channels are likely to
be involved in insulin secretion (Lang, 1999;Mears, 2004;Yang & Berggren, 2006). There is now
consensus that the major type of CaV channels in β-cells is CaV1 (L-type) channel, which plays a
predominant role over other CaV channels in Ca2+-dependent insulin secretion (Yang & Berggren,
2006). Ca2+ influx through CaV1 channels have been reported to account for 60 – 80% of
glucose-stimulated insulin secretion from mouse, rat and human islets (Davalli et al., 1996;Ohta
et al., 1993;Schulla et al., 2003).Two types of CaV1 channels, CaV1.2 and CaV1.3 have been
detected in β-cells (Namkung et al., 2001;Wiser et al., 1999;Yang et al., 1999;Schulla et al.,
2003). Studies on the mice with β-cell specific knockout of CaV1.2 has shown a decrease of
whole cell Ca2+ currents by approximately 45%, and a strong inhibition on first phase insulin
secretion (by about 80%), and glucose intolerance (Schulla et al., 2003). These data
demonstrated that CaV1.2 subunits play a critical role in stimulus-secretion coupling in mouse β-
cells. CaV1.3 knockout mice, on the other hand, exhibit a reduction of islet size and β-cell mass
due to an impaired β-proliferation (Namkung et al., 2001), without a significant change in insulin
or glucose serum levels (Platzer et al., 2000). The non-L-type CaV channels, though contributing
32
to β-cell Ca2+ currents, appear not important for first phase insulin secretion (Schulla et al., 2003).
Ca2+ influx through these channels could partially mediate second-phase insulin secretion by
contributing to global [Ca2+]i rises or affect insulin secretion indirectly by enhancing the
excitability of β-cell membrane (Mears, 2004). The role of CaV2.3 channels has been
demonstrated by the generation of CaV2.3 knockout mouse model and the selective CaV2.3
channel peptide blocker SNX-482 (Jing et al., 2005;Newcomb et al., 1998;Yang & Berggren,
2005). The gene deletion or the blockade of CaV2.3 subunits with SNX-482 selectively
suppressed the second phase of glucose-stimulated insulin secretion, without influencing the first
phase secretion (Jing et al., 2005;Schulla et al., 2003). These studies implicated that, unlike CaV1
channels, which are tightly coupled to the exocytotic machinery, CaV2.3 channels are located
distant from exocytotic sites, and could mediate the recruitment of insulin-containing granules
from the reserve pool (RP) to the readily releasable pool (RRP) to regulate second phase insulin
secretion (Jing et al., 2005;Schulla et al., 2003).
Compared to β-cells, the roles of CaV channels in pancreatic α-cells have been less clear. There is
a consensus that CaV1.2 (L-type), CaV2.2 (N-type), CaV2.3 (R-type), and CaV3.3 (T-type) Ca2+
channels are expressed in mouse α-cells (Barg et al., 2000;Gopel et al., 2000b;Leung et al.,
2006b;Pereverzev et al., 2005;Vignali et al., 2006;Xia et al., 2007). However, in one study, N-
and T-type CaV channels were not detected by single cell PCR and patch clamp experiments
(Vignali et al., 2006). This discrepancy could be due to the differences in identifying α- and β-
cells, as well as the different conditions of cell isolation and culturing (Gromada et al., 2007). L-
and N-type CaV channels have been reported in rat α-cells (Rorsman & Hellman, 1988), and L-
and T-type CaV channels in guinea pig α-cells (Rorsman, 1988). Contrary to β-cells, L-type CaV
channels appear not to play an important role in α-cell stimulus-secretion coupling. They
regulate glucagon secretion only when intracellular cAMP and PKA levels are elevated
33
(Gromada et al., 1997). N-type CaV channels are important in regulating glucagon secretion in α-
cells. This is supported by the observations of a close relationship between N-type CaV channels
and glucagon secretion in mouse and rat islets (Gromada et al., 2001a;Olsen et al., 2005;Wendt
et al., 2004). Ca2+ influx through N-type CaV channels was thought to control basal glucagon
secretion from rat α-cells (Gromada et al., 1997;Gromada et al., 2001a). N-type CaV channel
knockout mice exhibit a reduced blood glucagon level (Takahashi et al., 2005). Recent studies
have indicated that R-type CaV channels are involved in the glucose regulation of glucagon
secretion from mouse α-cells (Pereverzev et al., 2005;Vignali et al., 2006). The LVA T-type CaV
channels open at the lower threshold of membrane potential (about -60 mV). This property of T-
type CaV channels implies their function as a pacemaker by initiating action potential in α-cells
(Gopel et al., 2000b;Rorsman & Hellman, 1988). On the other hand, the HVA CaV channels (L-,
N, and R-type) open at the rapidly rising phase of membrane potential (about -30 to -40 mV)
with larger amplitudes, responsible for most of the Ca2+ entry for glucagon section (Gromada et
al., 2007).
1.2.3.3 KV channels
After membrane depolarization and the resultant action potential, endocrine cell membranes need
to be repolarized to maintain electrical excitability for further stimulation and hormone secretion.
Activation of KV channels in pancreatic β- and α-cells after each action potential results in efflux
of K+, suppressing insulin and glucagon secretion, respectively.
KV channels are the members of a superfamily of membrane proteins. There are at least 11
different families, from KV1 to KV11 (Macdonald & Wheeler, 2003;Yellen, 2002). Each KV
family is composed of different family members, such as KV3.1, KV 3.2, and KV 3.3 in KV3
family. KV α-subunits are 6-transmembrane domains, and the subunits within the same family
34
co-assemble as homo- or hetero-tetramers to form functional channels (Jan & Jan, 1997;Yellen,
2002). Due to the diversity of KV channel families and the hetero-tetrameric assemblies, the
naturally occurring and functional KV channels are enormous, making the identification and
characterization of KV channels difficult. The identification of mRNA transcripts of KV channel
α-subunits with reverse transcriptase-PCR (RT-PCR) and the confirmation of protein expression
with Western blot or immunohistochemistry are the two major approaches identifying the
molecular correlates of KV channels. Electrophysiological and pharmacological studies have
characterized two major types of KV channels, delayed rectifying K+ (KDR) currents and transient
(A-type) currents. KDR currents are sensitive to general K+ channel antagonists,
tetraethylammonium (TEA) and 4-aminopyridine (4-AP), whereas A-type currents are TEA
resistant and sensitive to 4-AP only. This pharmacological property is useful for identifying these
two types of KV channels.
Pancreatic β-cells and clonal β-cell lines express a variety of KV channels, including both
functional (KV1, KV2, KV3, and KV4) and electrically silent (KV6 and KV9) KV channels (Dukes
& Philipson, 1996;Macdonald & Wheeler, 2003;Yan et al., 2004). Although KV1 is the largest
family expressed in β-cells (from KV1.1 to KV1.7), the studies with the limited number of KV1
antagonists and a dominant-negative approach suggest little contribution of KV1 channels (20%
and 30% from rat β-cells and HIT-T15 cells respectively) to outward KV currents (Ji et al.,
2002;Macdonald et al., 2001). On the other hand, KV2.1 mediates the majority of outward KV
currents in rat and mouse β-cells (Macdonald & Wheeler, 2003). KV2.1 expression has been
detected in insulin-secreting cells (βTC-neo) more than a decade ago (Roe et al., 1996). The
importance of β-cell KV2.1 channels was recognized by a dominant-negative strategy, which
suggested that KV2.1 contributed 60 – 70% of voltage-dependent outward K+ currents in rat β-
cells and HIT-T15 insulinoma cells (Macdonald et al., 2001). Further studies using a KV2.1
35
antagonist C-1 have demonstrated that KV2.1 contributes up to 85% of outward K+ currents in
mouse β-cells and MIN6 insulinoma cell lines (Macdonald et al., 2002b). What is more
important is that inhibition of KV2.1 with C-1 enhanced insulin secretion from mouse pancreas
and MIN6 insulinoma cells in a glucose-dependent manner (Macdonald et al., 2002b). KV2.1
knockout mice were recently generated and show a 83% reduction of KV currents with an
enhanced insulin secretion and improved glucose tolerance (Jacobson et al., 2007a). Thus KV2.1
channels could be promising targets for the development of hypoglycemia therapeutics
(Macdonald & Wheeler, 2003). KV3.1, KV3.2, KV3.4 have been reported to be expressed in INS-
1 insulinoma cells by RT-PCR (Su et al., 2001), KV3.2 in βTC cells by RT-PCR (Roe et al.,
1996), and KV3.4 in mouse β-cells by immunohistochemistry (Gopel et al., 2000a). The
significance of KV3 family in β-cells is not clear. KV4.2 has been detected in rat islets by
Western blot (Macdonald et al., 2002a). KV1.4 and KV4.2 could contribute to the TEA-
insensitive A-type currents detected in mouse β-cells (Macdonald & Wheeler, 2003;Smith et al.,
1989).
KV channels in pancreatic α-cells were mainly characterized by their electrophysiological and
pharmacological properties. Similar to that in β-cells, the functional role of KV channels in α-
cells is to repolarize action potential (Gromada et al., 2007). KDR currents have been described in
dispersed α-cells from mouse (Barg et al., 2000;Leung et al., 2005a;Xia et al., 2007), guinea pig
(Rorsman & Hellman, 1988), and rat (Gromada et al., 2007). Blockade of KDR channels with 10
mM TEA inhibits more than 90% of outward K+ currents, leading to an increased glucose-
induced glucagon secretion in rat α-cells due to an enhanced membrane depolarization (Olsen et
al., 2005). TEA-resistant A-type currents have been observed in mouse α-cells (Gopel et al.,
2000b). Interestingly, blockade of A-type currents with 4-AP have been reported to reduce
glucagon secretion at 1 mM glucose in mouse islets (Gromada et al., 2004). No A-type currents
36
have been observed in rat α-cells. Consistently, 4-AP does not affect glucagon secretion from rat
islets (Olsen et al., 2005). Those data implie that KDR channels play a major role in repolarizing
action potential in rat and mouse α-cells. KV3.1 have been reported to be expressed in human
islet cells by RT-PCR (Yan et al., 2004) and KV4.3 in mouse α-cells by confocal microscopy
(Gopel et al., 2000a). The molecular correlates of KV channels remain to be further investigated.
1.2.4 SNARE Proteins in Pancreatic β- and α-Cells
A set of exocytotic proteins called SNARE (soluble N-ethylmaleimide sensitive factor
attachment protein receptor) proteins play a critical role in membrane fusion, a process involving
the release of neurotransmitter and hormone. Syntaxin, synaptosomal-associated protein of 25
kDa (SNAP-25), and vesicle-associated membrane protein (VAMP)-2 are the three SNARE
proteins recognized as the “minimal fusion machinery” (Weber et al., 1998). Synaptotagmin,
Munc-13 and n-Sec1 (Munc-18) are some of the major SNARE-interacting proteins (Brunger,
2005), among which synaptotagmin is Ca2+ sensor in Ca2+-triggered exocytosis.
1.2.4.1 Minimal fusion machinery
Syntaxin and SNAP-25 are SNARE proteins located on target plasma membranes, collectively
termed target-SNAREs (t-SNAREs), whereas VAMP-2 is a SNARE protein located on donor
vesicles, hence the name vesicle-SNARE (v-SNARE). Based on a current view, SNARE proteins
facilitate exocytosis by binding v-SNARE protein to its paired t-SNARE proteins, giving rise to
a tight complex that brings the secretory granules to plasma membranes (Bruns & Jahn,
2002;Weber et al., 1998). Using X-ray crystallography, the complex of the truncated soluble t-
and v-SNARE proteins (termed core domain) has been determined at 2.4 Å (Sutton et al., 1998).
The full length t-SNARE and v-SNARE in opposing bilayers have been demonstrated to interact
to form conducting channels in the presence of Ca2+ (Cho et al., 2002;Jeremic et al., 2004).
37
These data indicated that in the physiological state in cells, both SNAREs and Ca2+ operate as
the minimal fusion machinery. SNAREs bring opposing bilayers closer to within a distance of 2
– 3 Å, allowing Ca2+ to interact and bridge the phospholipids head groups (Jeremic et al., 2004).
The water between the bilayers is excluded by the bound Ca2+, resulting in lipid mixing and
fusion of secretory granules with plasma membrane. Therefore, SNARE proteins not only bring
opposing membrane bilayers closer, but also determine the site and size of the fusion area during
exocytosis (Jeremic et al., 2004).
1.2.4.2 Synaptotagmin and Ca2+ sensing
Exocytosis is triggered by Ca2+ influx upon an action potential. Synaptotagmin is the most likely
candidate for the Ca2+-sensor of the exocytotic machinery (Fernandez-Chacon et al., 2001). It
has been demonstrated to be essential for Ca2+-dependent neurotransmission (Littleton et al.,
1993) and insulin release from secretory granules (Lang et al., 1997). Synaptotagmin has been
characterized in several isoforms in neurons and non-neuronal cells (Li et al., 1995).
Synaptotagmin III and VII are reported to be expressed in pancreatic β-cells (Gao et al.,
2000;Lang et al., 1997). A more recent report employing a synaptotagmin VII knockout mouse
indicated that this synaptotagmin is likely the more important one in insulin exocytosis
(Gustavsson et al., 2008).
All synaptotagmin isoforms are composed of a short intravesicular amino-terminal region, a
single vesicle membrane-spanning domain, and a large cytoplasmic domain with two tandem
Ca2+-binding C2 domains (C2A and C2B) (Sutton et al., 1995). In a Ca2+-dependent manner,
C2A and C2B interact with phospholipids, SNAP-25, syntaxin and the ternary SNARE complex
(Brunger, 2005). Cultured hippocampal neurons from mice with a mutant synptotagmin I gene
exhibited a selective defect in Ca2+-triggered neurotransmitter release whereas Ca2+-independent
38
release was not affected (Geppert et al., 1994). Over-expression of synaptotagmin I has been
shown to prolong the time from fusion pore opening to dilation (Wang et al., 2001a). With Ca2+
binding to C2A and C2B domains, synaptotagmin I appeared to regulate the choice between full
fusion and kiss-and-run (Wang et al., 2003). Therefore, synptotagmin probably plays a role in
the opening of the fusion pore, perhaps by associating with trans SNARE complex and/or lipids
(Brunger, 2005;Wang et al., 2001b).
1.2.4.3 Sec1/Munc-18 and Munc-13
Besides synaptotagmin, Sec1/Munc-18 and Munc-13 are the other two important SNARE-
interacting proteins involved in the regulation of exocytosis. Sec1/Munc-18 proteins are
cytosolic proteins, including at least seven members in mammalian, Munc-18-1, Munc-18-2,
Munc-18-3, Vps33A, Vsp33B, Vsp45, and Sly1 (Brunger, 2005). Munc-18-1, Munc-18-2,
Munc-18-3 are functionally homologous to yeast Sec1p and function at the plasma membrane
(Hong, 2005), hence the name of neuronal Sec1 (nSec1). The crystal structure of Munc-18-1
revealed that Munc-18 proteins bind to the closed conformation of syntaxin 1A (Misura et al.,
2000). The N-peptide of Hc-linker domains of syntaxin 4 is important for binding Munc-18 (Hu
et al., 2007;Jewell et al., 2008). Different subtypes of Munc-18 could have distinct functions.
Munc-18-1 is abundantly expressed in neurons and plays a role in vesicle docking and SNARE
complex formation (Rizo & Sudhof, 2002;Sudhof, 2004). Munc-18-2 is more widely expressed,
and involved in regulating syntaxin 2/3 (Hata & Sudhof, 1995;Kauppi et al., 2002). I have found
that Munc-18-1/2 is also expressed in pancreatic β- and α-cells (Xia et al., 2004;Xia et al., 2007),
but its exact function remains to be determined. Munc-18-3 has been reported to interact with
syntaxin 4, playing a role in GLUT4 translocation to plasma membrane in response to increased
level of insulin (Bryant et al., 2002;Watson et al., 2004;Ke et al., 2007;Thurmond et al., 1998).
39
Munc-13 is a family of homologous proteins (Munc-13-1, -2, -3, and -4) with molecular weight
of about 200 kDa. The presence of Ca2+-binding C2 domains implicate the interaction of Munc-
13s with diacylglycerol, Ca2+, and phospholipids (Brose et al., 1995;Koch et al., 2000;Shirakawa
et al., 2004). Munc-13-1, -2, and -3 have been found expressed in different cells in brain (Hong,
2005). We have detected the expression of Munc-13-1 in both pancreatic β- and α-cells (Sheu et
al., 2003;Xia et al., 2004;Xia et al., 2007). Munc-13-1/2 were proposed to be essential for the
priming process of synaptic vesicles and secretory granules tethered to plasma membranes
(Kwan et al., 2006;Varoqueaux et al., 2002). It has been proposed that Munc-13-1/2 catalyze the
transition from the closed to the open state of syntaxin, probably through facilitating the
dissociation of Munc-18-1 from syntaxin (Betz et al., 1997;Varoqueaux et al., 2002). The open
form of syntaxin can interact with SNAP-25 to form binary t-SNARE complex, which bind to
the v-SNARE protein VAMP-2 to form a ternary complex to facilitate exocytosis. The tethering
of synaptic vesicles is regulated by Rab3 and its effector RIMs (Hong, 2005;Wang et al., 1997).
The N-terminal region of Munc-13-1 binds to RIMs to form a ternary Rab3/RIM/Munc-13
complex, facilitating the localization of secretory vesicles to the priming machinery (Dulubova et
al., 2005).
1.2.4.4 Exocytotic machinery in pancreatic β- and α-cells
A unifying model for regulated exocytosis has been established based on a vast body of
molecular and physiological data for more than a decade (Calakos & Scheller, 1996). Pancreatic
β- and α-cells are typical examples of hormone-secreting endocrine cells. All of the above
discussed SNAREs and SNARE interacting proteins involved in the regulation of
neurotransmitter release have been identified in pancreatic β-cells (Easom, 2000;Lang, 1999) and
α-cells (McGirr et al., 2005;Xia et al., 2007), and demonstrated to participate in insulin and
glucagon secretion. Intracellular application of anti-syntaxin monoclonal antibodies has been
40
shown to inhibit insulin secretion on permeabilised mouse β-cells (Martin et al., 1995;Martin et
al., 1996). Exocytosis in pancreatic β- and α-cells conforms to the general picture of SNARE-
regulated exocytosis (Barg, 2003;Rorsman & Renstrom, 2003), in which the ternary complex of
syntaxin, SNAP-25 and VAMP-2 plays a central role.
CaV channels play a critical role in the release of neurotransmitter and hormone, and have been
suggested to be an integral component of the exocytotic machinery (Mochida et al., 1996). Both
L-type and N-type CaV channels have been found to bind SNARE core complex (Mochida et al.,
1996;Wiser et al., 1997;Wiser et al., 1999;Atlas, 2001). The binding site of CaV channels with
SNARE complex is called synprint region, which is located between the transmembrane region
II and III of the channel pore-forming α1 subunit (Atlas, 2001;Sheng et al., 1996;Wiser et al.,
1997). Injection of recombinant peptides containing the synprint region of CaV channels
dissociates the interaction of L- and N-type CaV channels from the core complex, resulting in an
inhibition of synaptic transmission (Mochida et al., 1996) and depolarization-evoked insulin
exocytosis (Barg et al., 2001;Wiser et al., 1999). The coupling of CaV channels with SNARE
core complex assures a rapid influx of Ca2+ in the vicinity of secretory granules and a local high
Ca2+ concentration required for granule docking and membrane fusion. In addition, the binding
of CaV channels with SNARE proteins results in modulation of channel properties (Kang et al.,
2002).
Voltage gated K+ channels KV1.1 (Ji et al., 2002) and KV2.1 (He et al., 2006;Leung et al.,
2003;Leung et al., 2005b) have also been found directly interact with SNARE proteins, syntaxin
1A and SNAP-25 in pancreatic β-cells. This suggests that, like CaV channels, KV channels may
be in close vicinity to insulin secretory granules as well, constituting part of the secretory
machinery.
41
In summary, the SNARE protein complex constitutes the minimal exocytotic machinery in
pancreatic β- and α-cells. The Ca2+ sensor synaptotagmin and other SNARE regulating proteins
like Munc-18 and Munc-13 could play an important role in the regulated exocytosis of insulin
and glucagon granules. The discovery of the interaction of CaV and KV channels with SNARE
proteins in pancreatic β-cells implicates them as part of the exocytotic machinery. I and others
have found CaV channels, KV channels, and SNARE proteins syntaxin 1A, SNAP-25, and
VAMP-2 target to specific cholesterol-rich membrane microdomains, termed lipid rafts in both
pancreatic β-cells (Ohara-Imaizumi et al., 2004a;Takahashi et al., 2004;Xia et al., 2004) and α-
cells (Xia et al., 2007). This membrane compartmentalization of ion channels and SNARE
proteins in lipid rafts appears to be critical for the temporal and spatial coordination for the
exocytosis processes of pancreatic β- and α-cells.
1.3 Cellular Cholesterol and Lipid Rafts
1.3.1 Cellular Cholesterol
Cholesterol is essential for the growth and viability of mammalian cells (Chang et al., 2006).
Constituting about 20% of the total membrane lipid, cholesterol has been involved in several
subcellular functions, such as influencing the thickness and fluidity of membranes and insulating
membranes (Ohvo-Rekila et al., 2002). Cholesterol also plays a vital role as a metabolic
intermediate. It acts as a precursor for steroid hormones, including glucocorticoid, aldosterone,
estrogen, progesterone, and androgen. Cholesterol is also a precursor of bile acid, which is
synthesized in the liver and secreted to the proximal small intestine for digestion. Cholesterol
exists both as free cholesterol and cholesterol ester. Since high levels of free cholesterol is
thought to be deleterious to cells, the excess of this unesterified cholesterol is converted into
cholesterol ester by the enzyme acyl-CoA cholesterol acyltransferase (ACAT) on the
42
endoplasmic reticulum (ER) membrane. Two sources of cholesterol exist: endogenous
biosynthesis, and exogenous uptake from the tissue matrix. Over the past decade, numerous
publications support the concept that cholesterol plays a more important role than just being a
membrane constituent by forming membrane microdomains, termed lipid rafts.
1.3.1.1 Biosynthesis of endogenous cholesterol
Essentially all cells of the body can synthesize cholesterol de novo, although liver is the major
place for cholesterol biosynthesis. The extrahepatic tissues collectively synthesize as much
cholesterol as the liver does (Dietschy et al., 1993). Acetyl-CoA (acetate) is the starting material
for the biosynthesis of the 27-carbon tetracyclic cholesterol molecule, involving a series of over
30 enzymatic reactions (Figure 4). The rate-limiting enzyme of the pathway is
hydroxymethylglutaryl CoA (HMG-CoA) reductase, which generates mevalonate production by
catalyzing HMG-CoA (synthesized through the condensation of acetyl-CoA). HMG-CoA
reductase contains a conserved sterol-sensing domain shared with six other polytopic membrane
proteins, implicating its involvement in cholesterol regulation (Radhakrishnan et al., 2004).
HMG-CoA reductase inhibitors (i.e. statins) have been used for the treatment of
hypercholesterolemia, and their ability to reduce mortality and morbidity from cardiovascular
events well recognized (Schwartz et al., 2001).
The primary site for cholesterol synthesis is ER, and HMG-CoA reductase is integrated into ER
membranes (Reinhart et al., 1987). Squalene synthase and squalene epoxidase are the first two
enzymes in the committed sterol synthesis, producing the first sterol lanosterol. Conversion of
lanosterol to cholesterol involves a 19-step enzymatic reaction sequence. The exact reaction
order has not been delineated, and more than one pathway may be involved. It should be noted
that the intermediate farnesyl pyrophosphate, formed prior to squalene, is not only used for
43
cholesterol biosynthesis but also for a number of other biomolecules involved in protein
prenylation (isoprenylated proteins), mitochondrial electron transport (ubiquinone/Q10
coenzyme), and protein N-glycosylation (dolichol) (Ikonen, 2006) (Figure 4).
44
Figure 4. Cholesterol biosynthesis pathway
Cholesterol biosynthesis starts from the reduction of HMG CoA, undergoing series of over 30 enzymatic reactions until the final cholesterol products. Squalene synthase and squalene epoxidase are the first two enzymes in the committed sterol biosynthesis.
45
1.3.1.2 Uptake of exogenous cholesterol
It has been estimated that humans synthesize ~1g and ingest ~0.4g cholesterol per day (Grundy,
1983). Cholesterol is incorporated into lipoprotein particles in the pools of interstitial fluid and
blood, facilitating its intercellular exchange. Triglycerides and cholesterol esters (i.e. fatty
acylated cholesterol) constitute the core of lipoprotein particles, whereas phospholipids and free
cholesterol distribute on the surface of the particles. Receptor-mediated uptake of lipoprotein
particles is the major pathway for exogenous cholesterol to enter cells. Low-density lipoproteins
(LDL) bind to LDL receptors on plasma membranes, being internalized via formation of coated
vesicles that enter into the clathrin-mediated endocytic pathway by fusing with early endosomes,
from which the LDL receptors are recycled to plasma membranes via recycling endosomes
(Matter et al., 1993). The LDL particles then rapidly undergo proteolytic and lipolytic
degradation in late endosomes and lysosomes, where the cholesterol esters are hydrolyzed by the
lysosomal acid lipase (Sugii et al., 2003). The freed cholesterol from LDL particles is then
transported to plasma membranes and the cellular compartments such as ER and secretory
vesicles, resulting in an increase in cholesterol esterification and down-regulation of cholesterol
biosynthesis.
1.3.1.3 Output of cellular cholesterol
Cholesterol efflux from cells is critical for maintaining cellular cholesterol homeostasis since
extrahepatic cells can not degrade cholesterol. Excess cellular cholesterol from peripheral tissues
needs to be removed and transported to the liver for reutilization and excretion, a process known
as reverse cholesterol transport. The high-density lipoproteins (HDL) act as the major acceptor
mediating the release of cellular cholesterol from the extrahepatic cells (Chang et al., 2006). The
mature HDL particles are mainly composed of apolipoprotein A-I and A-II, phospholipids,
46
cholesterol and cholesterol esters. They transport cholesterol to the liver, adrenals, and other
steroidogenic tissues for the synthesis of bile acid and steroid hormones.
The HDL-mediated cellular cholesterol output is controlled by ATP-binding cassette transporter
A1 (ABCA1) (Yokoyama, 2005), a plasma membrane protein expressed in a variety of
peripheral cells (Langmann et al., 1999;Wellington et al., 2002). Defective mutations of ABCA1
gene cause Tangier Disease, a rare genetic disorder leading to family HDL deficiency and
cellular cholesterol accumulation (Oram, 2002). ABCA1 mediates the rate-limiting step in HDL
assembly by effluxing cellular cholesterol and phospholipids to apolipoproteins (Yokoyama,
2005). Pancreatic β-cell specific ABCA1 knockout mice exhibit an alteration of β-cell
cholesterol homeostasis and impairment in insulin secretion, suggesting that cholesterol
accumulation may contribute to β-cell dysfunction in type 2 diabetes (Brunham et al., 2007).
1.3.1.4 Intracellular cholesterol transport
As discussed above, the biosynthesis of endogenous cholesterol and the uptake of exogenous
cholesterol are the two sources of cellular cholesterol. Moreover, since cells cannot degrade
cholesterol, the excess cellular cholesterol has to be exported in order to keep cellular cholesterol
homeostasis. Therefore, cells must undergo a complex series of intracellular cholesterol transport
steps in order to maintain the required amount of cholesterol in specific cellular membranes to
perform its specific function. Plasma membrane contains the majority of cellular cholesterol.
Endocytic and exocytic membrane trafficking routes endow cholesterol-enriched domains
(Simons & Ikonen, 2000). These two trafficking routes connect the endosomes and the trans-
Golgi network to the plasma membrane. Although many critical enzymatic reactions of
cholesterol metabolism take place in the ER and mitochondria, they contain relatively less
cholesterol. Because cholesterol is hydrophobic, spontaneous exchange of cholesterol between
47
subcellular membranes across aqueous cytoplasm is slow (Ikonen, 2006). The transport of
intracellular cholesterol was proposed by a combination of vesicular trafficking and nonvesicular
mechanisms (Maxfield & Wustner, 2002), such as mediated via cytosolic carrier protein, or
steroidogenic acute regulatory protein (StAR) (Miller & Strauss, III, 1999). Below is a brief
introduction on the transport process of endogenously synthesized cholesterol and exogenous
uptake/endosomal cholesterol.
The transport of endogenous cholesterol starts from the ER, where the late stage of cholesterol
synthesis takes place. To monitor the trafficking of endogenous cholesterol, intact cells are fed
with acetate (the simple precursor for de novo cholesterol biosynthesis) for a few minutes. It has
been determined that once biosynthesized, most of the endogenous cholesterol is rapidly (within
10-20 min) transported to the cholesterol- and sphingolipid-rich domains (i.e. lipid rafts/caveolae)
of the plasma membrane by an energy-dependent, nonvesicular trafficking process (Chang et al.,
2006). Caveolin-1 and other soluble proteins are involved in this cholesterol trafficking
(Matveev et al., 2001), however the molecular mechanism is not well understood. The
immediate fate of the endogenous cholesterol after its arrival at the plasma membrane is also
largely unknown.
Endosomes contain substantial amounts of cholesterol acquired not only from LDL uptake but
also from membrane recycling and nonvesicular equilibration. Cholesterol from endosomes may
return to plasma membranes directly or via the trans-Golgi network, or transported to the ER
(Ikonen, 2006). The egress of endosomal cholesterol is critically dependent on two proteins,
NPC1 and NPC2 (Chang et al., 2005), named after the rare Niemann-Pick type C disease. NPC1
is a multispan membrane protein located on late endosomes and NPC2 is a soluble protein in the
lumen of the late endosomes / lysosomes (Chang et al., 2006). Both proteins bind to cholesterol,
48
but the exact roles of NPC1 and NPC2 are not well understood (Ko et al., 2003;Walter et al.,
2003). Another mechanism mediating endosomal cholesterol transport is vesicular trafficking
(Holtta-Vuori & Ikonen, 2006). Over expression of Rab9 has been shown to prevent cholesterol
accumulation in NPC1 and NPC2 mutants (Choudhury et al., 2002;Walter et al., 2003). Rab9 is
one of the late endosomal small GTPases facilitating endosomal vesicle docking and fusion with
the trans-Golgi network (Pfeffer & Aivazian, 2004). The rescue of the impaired endosomal
cholesterol transport of NPC1 and NPC2 mutant mice with Rab9 implicates the importance of
vesicular trafficking mechanism.
1.3.1.5 Regulation of cholesterol homeostasis
The ER membranes are embedded with the main cholesterol homeostasis machinery,
SREBP/SCAP complex, that controls many genes involved in cholesterol biosynthesis and influx
(Goldstein & Brown, 1990;Vallett et al., 1996;Goldstein et al., 2006). Sterol regulatory element
binding proteins (SREBPs) are transcription factors, and their precursor forms are integral
membrane proteins in the ER. SREBP cleavage-activating protein (SCAP) is a multispan ER
membrane protein that binds to the precursors of SREBPs. The decrease in cellular cholesterol
level results in translocation of SREBP/SCAP complex from ER to Golgi complex via secretory
pathways. The cleavage of the precursor of SREBPs in Golgi complex generates the mature
SREBP transcription factors. SREBPs then enter to the nucleus to activate genes involved in
cholesterol biosynthesis and uptake, including HMG-CoA reductase and LDL receptor
(Goldstein et al., 2006). Cholesterol homeostasis is also regulated by another transcriptional
network mediated by the nuclear hormone receptors liver X receptor (LXR) and peroxisome
proliferator activated receptor (PPAR) (Ikonen, 2006). LXR and PPAR are activated by
oxysterol and fatty acid, respectively, regulating the expression of some regulatory proteins in
49
cholesterol and fatty acid metabolism, such as ABCA1 and lipoprotein lipase (Beaven &
Tontonoz, 2006).
1.3.2 The Concept of Lipid Rafts
Lipid rafts are membrane regions enriched in cholesterol and sphingolipids containing a variety
of signaling and transport proteins. Caveolae are subtypes of lipid rafts rich in caveolins.
Numerous evidence shows that lipid rafts play an important role in regulating the raft-associated
membrane proteins (Figure 5). However, limitation of tools with which to study lipid rafts has
led to a disconnection between the concept of lipid rafts and their existence in living cells.
50
Figure 5. Schematic representation of lipid raft structures in a plasma membrane
Lipid rafts are small lipid patches floating in the plasma membrane, mainly composed of cholesterol and sphingolipid. Different subtypes and compositions of lipid rafts constitute distinct signaling platforms. Caveolae are lipid rafts with invaginated structures and the constituent protein caveolin, whereas other lipid rafts are planar plaques. Ion channels and SNARE proteins are among the numerous membrane proteins anchored to lipid raft microdomains, in which their functions are regulated. Fusion of lipid rafts favors interactions between rafts associated proteins. The figure is adapted from (Maguy et al., 2006) with a granted permission.
51
1.3.2.1 Membrane bilayer and lipid rafts
The traditional fluid mosaic model of cell membranes describes the lipid bilayer as a neutral two
dimensional solvent in which proteins diffuse freely (Singer & Nicolson, 1972). In recent years,
this membrane concept has been substantially extended, as membrane compartmentalization has
been shown to occur through lipid-lipid, lipid-protein and membrane-cytoskeletal interactions
(Nicolau, Jr. et al., 2006). Studies on model membranes that consist of simple hydrated
phospholipids revealed that the phospholipids undergo a phase transition from a solid ordered
phase (So) to a liquid disordered phase (Ld) at a temperature that is characteristic to the particular
lipid species (Hancock, 2006). The lateral mobility of the lipids in Ld phase increases and the
acyl-side chains become disordered and no longer tightly pack together. However, if sufficient
cholesterol is added to the phospholipids, a liquid ordered phase (Lo) also occurs. Lo phase is
characterized both by a high degree of acyl-chain ordering of So phase, and by an increased
lateral mobility of Ld phase. More importantly, Lo and Ld phases can co-exist in membranes that
consist of appropriate mixture of phospholipids, cholesterol and sphingolipid (de Almeida et al.,
2003;de Almeida et al., 2005).
Lipid rafts in biological membranes are postulated to be microdomains with a lipid structure
equivalent to the Lo phase of model membranes, and to be surrounded by a contiguous sea of
membrane with a lipid structure to the Ld phase of model membranes (Hancock, 2006). The idea
of lipid rafts was established more than a decade ago by the demonstration that
glycosylphosphatidylinositol (GPI) lipid-anchored proteins are sorted into distinct cholesterol-
and sphingolipid-rich microdomains in plasma membranes, with the development of a method to
isolate those domains by detergent extraction (Brown & Rose, 1992;Varma & Mayor,
1998;Simons & Ikonen, 1997). The hypothesis proposed that plasma membrane is organized into
different domains of lipid rafts and non-lipid rafts, and that this segregation of lipids, as well as
52
the raft-associated membrane proteins, is important for the organization of membranes as
platforms for critical cellular functions such as signal transduction and vesicular trafficking. The
recent Keystone Symposium on Lipid Rafts and Cell Function made a comprehensive definition
to the rafts: “membrane rafts are small (10-200 nm), heterogeneous, highly dynamic, sterol- and
sphingolipid-enriched domains that compartmentalize cellular process” (Pike, 2006).
Two models have been proposed to explain how lipid rafts accumulate and remain in the
membranes. Based on the first model, the interaction among the headgroups (amide and
hydroxyl/carboxy) of sphingolipids holds sphingolipid together (Simons & Ikonen, 1997). The
space between the bulky sphingolipid headgroups is filled by cholesterol via hydrogen bonds and
van der Waals interactions between the 3-OH groups of cholesterol and the amide groups of
sphingolipids (Filippov et al., 2006). The second model proposed that the interaction among the
saturated acyl chains of sphingolipids mainly contributes to the tight assembly of sphingolipids
and cholesterol (London & Brown, 2000).
The mechanism of protein association with lipid rafts is not well understood. There are three
structural features proposed for a protein to promote its partitioning into cholesterol-rich
membrane domains (Epand, 2006), including certain types of lipidation, properties of
transmembrane segments, and short juxtamembrane segments. Firstly, protein lipidations
associated with raft domains include acylation with either myristic acid on the N-terminal amino
group or palmitic acid on cysteine residues (Brown & London, 2000;Resh, 2004), through GPI-
linkage (Morandat et al., 2002;Sharma et al., 2004;Sharom & Lehto, 2002), and covalent
attachment with cholesterol (Karpen et al., 2001). The nature of a transmembrane segment is the
second feature for targeting proteins to lipid rafts. A smooth, uniform surface counter of
transmembrane helix can more readily mix with rigid cholesterol-rich membrane domains
53
(Epand, 2006). The specific lengths of protein transmembrane helices also affect the association
with lipid rafts (Ren et al., 1997), which are relatively thicker than the surrounding bilayers.
Thirdly, some lipid raft-associated proteins have a juxtamembrane segment, a region described
as cholesterol recognition amino acid consensus (i.e. tetrapeptide motif YIYF), which is
frequently found near the end of a transmembrane helix of a sterol-sensing domain (Epand,
2006). These regions help the interaction of proteins with cholesterol-rich lipid rafts. Caveolin is
one example of a protein that has cholesterol recognition amino acid consensus motif (Schlegel
et al., 1999).
1.3.2.2 Caveolae and caveolin
More than five decades ago, scientists were able to first glimpse the cellular structures, owing to
the advent of electron microscopy (EM). One of the most abundant cellular structures was the 50
– 100 nm, rosette-like structures, termed caveolae, on the plasma membranes in certain cells
(Palade, 1953;Yanada, 1955). Caveolae are abundant in endothelial cells, where they were
proposed to act as transendothelial carriers (Bruns & Palade, 1968;Simionescu et al., 1975) and
to be involved in the activation of specific signaling pathways in response to blood flow (Rizzo
et al., 1998). Muscle is another caveolae-abundant tissue, where caveolae could act as stretch
sensors, the reservoirs of membrane during cycles of contraction and relaxation (Severs, 1988),
and as the sites of calcium influx or regulation (Isshiki & Anderson, 1999). Caveolae could be
endocytic carriers in other cell types (Montesano et al., 1982). Certain bacterial toxins could be
internalized into conventional endosomes through binding to specific lipids and the association
with caveolae (Montesano et al., 1982). GPI anchored proteins were found highly concentrated
in caveolae (Mayor et al., 1994;Schnitzer et al., 1995).
54
Biogenesis of caveolae depends on caveolar proteins, 21-22 kDa membrane proteins, discovered
independently by two different groups in the early 1990s (Dupree et al., 1993;Kurzchalia et al.,
1992;Mayor et al., 1994;Rothberg et al., 1992;Schnitzer et al., 1995). Caveolins are crucial
component of caveolae. The experimentally induced loss of caveolin has been shown to result in
a loss of caveolae (Parton, 2003). Conversely, the expression of caveolin in cavolae lacking cells
caused a production of caveolae (Fra et al., 1995). Three members of the caveolin family were
found in mammalian cells (Parton, 2003). Caveolin-1 and caveolin-2 are widely expressed in
many tissues, such as adipocytes, endothelial cells, fibroblasts and smooth muscle (Scherer et al.,
1996). By contrast, the expression of caveolin-3 is highly restricted to cardiac and skeletal
muscle (Tang et al., 1996;Way & Parton, 1995). The caveolar invagination appears to be
uncoated compared with clathrin-coated structures (Parton et al., 2006). Scanning electron
microscope (SEM) revealed striations (oligomers of 1-101 residues at N-terminal of caveolin-1)
that form a spiral around the cytoplasmic surface of the caveolar invagination (Peters et al.,
1985;Rothberg et al., 1992;Stan, 2002). Both caveolin-1 and -3 are essential for the formation of
caveolae. Caveolin-2 is generally expressed together with caveolin-1. It might facilitate but not
necessary for the formation of caveolae (Razani et al., 2002). There are 100-200 caveolin
molecules per caveola. caveolin-1 and caveolin-3 might be structural proteins involved directly
in the bending of the membrane to generate caveolae (Parton et al., 2006). The 33-residue central
hydrophobic region might form a hairpin in the lipid bilayer. Incorporation of caveolins into lipid
raft domains in the Golgi complex might be required for formation of caveolae in the Golgi
complex or transport of caveolin to the surface prior to their formation (Ren et al., 2004).
Caveolin-membrane interactions, and specifically insertion of the scaffolding domain into the
membrane and its interaction with cholesterol, might provide driving force for generating
caveolae (Parton et al., 2006).
55
Caveolin has been reported to interact directly with numerous signaling proteins through its
conserved scaffolding domain (Couet et al., 1997). Binding of caveolin-1 with the small Rho
family GTPase Cdc42 has recently been reported to regulate insulin granule exocytosis of
pancreatic β-cells (Nevins & Thurmond, 2006). Signaling proteins were also found to be
associated with caveolin-containing fractions determined biochemically (Lisanti et al., 1994).
Those findings have implicated caveolin proteins as crucial regulators of signaling cascades
(Parton, 2003). However, it should be noted that some previously proposed functions for
caveolae have now been assigned to ubiquitous surface membrane domains, planar lipid rafts
lacking caveolins (Simons & Toomre, 2000). It is technically difficult to purify caveolae away
from other membrane rafts, and to dissect the functions of caveolae. So like most of the
researchers, I did not attempt to subdivide caveolae and non-caveolar membrane rafts in this
thesis. Except for the role of caveolins in signaling, other roles are emerging, such as the role in
lipid regulation. Caveolin-1 has been found to bind cholesterol and fatty acids (Murata et al.,
1995;Trigatti et al., 1999). Over expression of caveolin-1 increased cholesterol transport to the
cell surface, and cholesterol regulates the expression of caveolin-1 (Fielding & Fielding, 2001).
1.3.2.3 Strategies to characterize lipid rafts
The useful and common approach for studying lipid rafts and their putative role is biochemical
isolation of lipid rafts and their subsequent identification to determine if the signaling
components are localized. Lipid raft membranes are traditionally defined as being insoluble in
cold non-ionic detergent such as Triton X-100 (Allen et al., 2007). The fractions of detergent-
resistant membranes (DRMs) float into the buoyant fractions between 5% and 30% of sucrose
gradient after ultracentrifugation (Brown & Rose, 1992) (Figure 6). Another method of isolating
lipid raft membranes is non-detergent isolation based on pH and carbonate resistance (Song et al.,
56
1996). Proteins that are firmly attached to membranes are separated with sodium carbonate (500
mM, at pH 11) from those that are more peripherally associated. After sucrose gradient
ultracentrifugation, fractions are collected and determined for the association of the specific
proteins that might be targeted to lipid rafts.
57
Figure 6. Isolation of lipid rafts with sucrose gradient ultracentrifugation
One of the major properties of lipid rafts is resistant to detergent or sodium carbonate. To isolate lipid rafts, cells are lysed with 1% Triton X-100 or 500 mM sodium carbonate (pH 11), and sucrose is added to 40%. Then 30% and 5% of sucrose are added on top of the sample to form a discontinuous gradient. After ultracentrifugation at 39,000 rpm for 20 hours, the detergent resistant lipid rafts are floated between 5% and 30% sucrose interface. A total of 20 fractions from the centrifuge tube were collected for the analysis by Western blot.
58
Disruption of lipid rafts is the commonly used approach to confirm the association of proteins
with lipid rafts, and most importantly, to determine the physiological relevance of the raft
association of the proteins of interest. Lipid rafts are sensitive to the removal or reduction of
membrane cholesterol thanks to their enrichment in cholesterol. Disruption of cholesterol will
result in a redistribution of the proteins away from lipid raft membranes. Depletion of cholesterol
with methyl-β-cyclodextrin (MβDC) is one of the most commonly used strategies for acute
cholesterol disruption from plasma membrane (applied in this thesis, Chapter Two and Three).
Cellular cholesterol can be modulated by the chronic inhibition of endogenous cholesterol
biosynthesis with drugs, such as HMG-CoA reductase inhibitors (statins) and squalene epoxidase
inhibitors (first performed in this thesis, Chapter Four). Genetic manipulation of cellular
cholesterol and caveolins includes generation of tissue specific squalene synthase knockout mice
(first performed in this thesis, Appendix), globally knocking out of the genes responsible for the
last two steps of cholesterol synthesis (7-dehydrocholesterol reductase and lathosterol-5-
desaturase) (Gondre-Lewis et al., 2006), as well as caveolin-1 knockout mice (Trushina et al.,
2006;Razani et al., 2001) and RNAi-mediated caveolin-1 depletion (Nevins & Thurmond,
2006;Veluthakal et al., 2005). The combination of some of the above approaches of cholesterol
manipulation and the confirmation with sucrose gradient fractionation is particularly informative.
1.3.3 Cholesterol / Lipid Rafts and Cellular Signaling
Being proposed as freely diffusing and dynamic lateral assemblies of cholesterol and
sphingolipids on plasma membranes, lipid rafts facilitate specific protein-protein interactions by
selectively including or excluding proteins. This lipid-based sorting mechanism constitutes the
formation of transient signaling platforms and the sorting of proteins to enter into specific
endocytic / exocytic trafficking pathways (Hancock, 2006), thereby providing spatial and
temporal control of those cellular process. Over recent years, the importance of lipid rafts has
59
been elucidated in the pathogenesis of metabolic disorders and diseases such as insulin resistance,
cardiovascular disease, cancer, HIV, and Alzheimer’s disease. These are beyond the scope of this
thesis, and are referred to the recent reviews (Ma, 2007;Michel & Bakovic, 2007). In relation to
my studies, below is a general introduction of lipid rafts in signal transduction, followed by the
two specific roles of lipid rafts, in insulin signaling and in stimulus-secretion coupling.
1.3.3.1 Lipid rafts in signal transduction
A strikingly wide array of signaling molecules has been found localized in lipid raft
microdomains by the biochemical analysis of the protein composition of purified lipid rafts
(Zajchowski & Robbins, 2002). Based on those observations, lipid rafts have been proposed to
play an important role in mediating signal transduction (Pike, 2003;Zajchowski & Robbins,
2002). Lipid rafts could be involved in modulating cellular signaling in a variety of ways. In the
simplest scenario, membrane rafts act as signaling platforms, in which receptors, coupling
factors, effector enzymes, and substrates are colocalized. Upon activation of signaling pathways
by hormone binding, signal transduction would occur rapidly and efficiently due to the spatial
proximity of the signaling molecules. Furthermore, a specific signaling pathway could be
restricted to a particular class of lipid rafts, limiting the access of the receptor to the components
from other signaling pathways. This would help to enhance the specificity of signaling and to
prevent nonspecific signaling.
The regulation of cellular signaling by lipid rafts on could be more complicated. Under basal
conditions, the complementary components of a signaling pathway are segregated into different
lipid rafts. In response to stimuli, lipid rafts are transiently fused, leading to the interactions of
the signaling components. Alternatively, a nearly complete signaling pathway in lipid rafts could
be triggered by the recruitment of a receptor or other required molecule from non-raft
60
membranes. The observation that many raft proteins are only partially localized in lipid raft
microdomains implicates that lipid rafts may play a more subtle role in signal transduction.
Protein tyrosine kinases (PTKs) are one of the examples, as they are localized in both raft and
non-raft portions of membranes. The same PTK could activate different signaling pathways
owing accessing to different subsets of signaling partners in different compartments (Pike, 2003).
1.3.3.2 Lipid rafts in insulin signaling
Insulin signaling plays a critical role in glucose clearance and in maintaining circulating glucose
within a narrow physiological range. Impairment of the insulin signaling pathway, generally
defined as insulin resistance, is thought to be part of the pathogenesis of type 2 diabetes
(Virkamaki et al., 1999). Insulin receptor and some other important elements of the insulin signal
transduction machinery are localized to lipid rafts or caveolae (Bickel, 2002). The insulin action
tissues highly express lipid raft constituent protein caveolin, such as caveolin-1 in adipose tissue
(Cohen et al., 2003a;Cohen et al., 2003b) and caveolin-3 in skeletal muscle (Capozza et al.,
2005). Knockout of caveolin-1 and caveolin-3 has been reported to result in insulin resistance
and glucose intolerance (Capozza et al., 2005;Cohen et al., 2003b). The insulin resistance in
caveolin-1 knockout mice is associated with reduced expression of insulin receptors in adipose
tissue without any change in mRNA level, indicating that caveolin-1 may act as a chaperone to
prevent the degradation of insulin receptor in caveolae (Cohen et al., 2003b). In vitro
experiments showed that caveolin-1 and caveoin-3 also bind and activate the insulin receptor in
293T cells (Yamamoto et al., 1998). All these findings suggest that lipid rafts and caveolins play
a critical role in regulating insulin signaling pathways.
Lipid rafts or caveolae may directly participate in GLUT4 translocation, a down-stream step in
the insulin signaling pathway. Electron microscopy has shown that GLUT4 localizes to caveolae
61
in 3T3 L1 adipocytes, and insulin induced the translocation of GLUT-4 to these caveolae
membrane fractions (Karlsson et al., 2002). Similarly, biochemical analysis of lipid rafts also
detected a transient increase in GLUT4 localization to caveolin-enriched membrane domains in
3T3-L1 adipocytes after insulin stimulation (Scherer et al., 1994). A model has been proposed
that upon insulin stimulation, GLUT4 moves first to plasma membranes and then to lipid rafts or
caveolae, where it mediates the glucose transport (Gustavsson et al., 1996).
1.3.3.3 Cholesterol and lipid rafts in stimulus-secretion coupling
There was no report on the roles of cellular cholesterol and lipid rafts in β-cell insulin secretion
and α-cell glucagon secretion when I started my PhD studies. Some of the evidence that lipid
rafts may play an important role on regulating exocytosis came from the studies on PC12 cells
(Chamberlain et al., 2001;Lang et al., 2001). Stimulus-secretion coupling in pancreatic β- and α-
cells is essentially regulated by ion channels (i.e. KATP, CaV, and KV channels) and SNARE
protein secretory machinery (i.e. SNAP-25, syntaxin 1A, and VAMP-2). Below is an
introduction of lipid raft association of ion channels and SNARE proteins in other cell types.
Several ion channels have been reported to associate with lipid rafts in which their functions
were being regulated. KV2.1 is the first ion channel reported to be associated with lipid rafts in
transfected Ltk-cells and rat brain (Martens et al., 2000). Subsequently, the same group reported
another KV channel, KV1.5, was also associated with lipid rafts in the same cell lines (Martens et
al., 2001). KV1.2 and KV4.2 channels were found associated with lipid rafts in rat brain and
transfected HEK 293 cells (Wong & Schlichter, 2004). Therefore, multiple KV channels are
associated with lipid raft microdomains. Several subtypes of CaV channels have been reported to
associate with lipid rafts, such as CaV1.2 in smooth muscle and cardiomyocytes (Darby et al.,
2000;O'Connell et al., 2004), CaV2.1 channels in neuron (Taverna et al., 2004;Davies et al.,
62
2006), and CaV2.2 in neuroblastoma cells (Lundbaek et al., 1996;Toselli et al., 2005).
Localization of ion channels at specific membrane microdomains ensures that ion channels are
located in proximity to signaling molecules that modulate them, and to coordinate complex
functions, such as exocytosis.
Recent studies suggest that cholesterol- and sphingolipid-rich lipid rafts could play an important
role in regulated exocytosis through compartmentalizing SNARE proteins at defined sites of
plasma membranes. The plasma membrane-associated SNAREs (t-SNAREs) syntaxin 1 - 4,
SNAP-25 and SNAP-23 were found in concentrated spotty structures termed clusters, and the
integrity of SNARE clusters on the plasma membrane is dependent on cholesterol (Lang, 2007).
It remains unanswered whether the SNARE clusters are the same structures as lipid raft
microdomains in the plasma membrane. Localization of SNAREs in detergent resistant
membranes (DRMs) was first reported in canine kidney cells (Lafont et al., 1999). Two
independent groups subsequently demonstrated the association of SNAREs with cholesterol-rich
membrane microdomains in PC12 cells (Chamberlain et al., 2001;Lang et al., 2001). One of the
groups found that syntaxin 1 and SNAP-25 were clustered with cholesterol, but failed to isolate
them from DRMs (Lang et al., 2001). However, the other group reported that ~20% of syntaxin
1A and SNAP-25 were localized in DRMs (Chamberlain et al., 2001). Both groups demonstrated
that cholesterol depletion caused an inhibition in regulated exocytosis from PC12 cells,
suggesting these membrane microdomains play an important role in regulating SNARE functions.
Based on the above observation, the clusters and the DRMs association of SNARE proteins
could represent the same membrane structures by the different approaches. Lipid rafts could play
a critical role in regulated exocytosis by SNARE proteins.
63
This thesis has explored the important role of cholesterol-rich lipid rafts in regulating stimulus-
secretion coupling of pancreatic β- and α-cells. Ion channels (CaV and KV), and SNARE proteins
(syntaxin 1A, SNAP-25 and VAMP-2), and lipid raft constituent protein caveolins have been
found to be associated with lipid rafts, in which their functions were regulated in both pancreatic
β- and α-cells. Acute depletion of membrane cholesterol with MβCD implicated association of
SNAP-25 and syntaxin 1A with lipid rafts in the plasma membrane regulates exocytosis. Further
studies by the pharmacological inhibition of endogenous cholesterol biosynthesis demonstrated
that cellular cholesterol and its homeostasis is critical for the normal function of ion channels and
insulin secretion in pancreatic β-cells.
1.4 General Hypothesis
Cholesterol-rich lipid rafts present in pancreatic β- and α-cells. Stimulus-secretion couplings of
β- and α-cells are regulated by lipid rafts through membrane compartmentalization and
regulation of ion channels and SNARE proteins. Cellular cholesterol and its homeostasis are
critical for normal pancreatic β- and α-cell stimulus-secretion coupling.
1.5 Aims
1.5.1 Aim 1: To Identify the Roles of Lipid Rafts and the Raft-Associated Proteins in β- and α-Cells
Lipid rafts in both pancreatic β- and α-cells will be identified. The ion channels and SNARE
proteins critical for stimulus-secretion coupling will be investigated for their association with
lipid rafts in pancreatic β- and α-cells. Functional regulation of the ion channels and SNARE
proteins by lipid rafts will be further studied.
64
1.5.2 Aim 2: To Determine the Critical Role of Endogenous Cholesterol and its Homeostasis in β-Cells
The critical role of cellular cholesterol in pancreatic β-cell insulin secretion will be examined by
chronic inhibition of endogenous cholesterol biosynthesis through pharmacological blockade.
The effects of endogenous cholesterol inhibition on CaV and KV channels, exocytotic secretory
machinery, and caveolins will be further determined for their contribution to the impaired β-cell
exocytosis.
65
2 Chapter Two: Roles of Lipid Rafts in Insulin Secretion of Pancreatic β-Cells
The content of the following chapter was published in Journal of Biological Chemistry, and the
figures were reprinted with the permission of the American Society for Biochemistry and
Molecular Biology from:
Xia F, Gao X, Kwan K, Lam P, Chan L, Sy K, Sheu L, Wheeler MB, Gaisano HY and Tsushima
RG. Disruption of pancreatic β-cell lipid rafts modifies KV2.1 channel gating and insulin
exocytosis. Journal of Biological Chemistry 279 (23): 24685-24691, 2004
Contributions by co-authors to the figures presented are stated in the figure legends.
66
2.1 Abstract In pancreatic β-cells, the predominant voltage-gated Ca2+ channel (CaV1.2) and K+ channel
(KV2.1) are directly coupled to SNARE proteins, which modulate channel trafficking and gating
and closely associate these ion channels with the insulin secretory vesicles. I demonstrated the
expression of lipid raft constituent proteins caveolin-1 and 2 in pancreatic β-cells, and found that
KV2.1 and CaV1.2 channels target to specialized cholesterol-rich lipid raft domains on β-cell
plasma membranes. Similarly, the SNARE proteins syntaxin 1A, SNAP-25, and VAMP-2 are
also found associated with lipid rafts. Disruption of lipid rafts by depleting membrane cholesterol
with methyl-β-cyclodextrin (MβCD) shunts KV2.1, CaV1.2 channels, and SNARE proteins out of
lipid rafts. Furthermore, depletion of membrane cholesterol with MβCD caused an elevated basal
insulin secretion and single β-cell exocytotic events, which could be partially mediated by the
inhibition of KV2.1 channel activity. Therefore, the temporal and spatial coordination of insulin
release may be regulated by the membrane compartmentalization of ion channels and SNARE
proteins in lipid rafts of pancreatic β-cells.
2.2 Introduction In pancreatic islets, glucose uptake by β-cells initiates a cascade of cellular events resulting in
insulin secretion. A key response leading to insulin release is the change in transmembrane
potential associated with the opening and closing of ion channels. Glucose uptake and
metabolism increases the ratio of ATP/ADP, leading to the blockade of ATP-sensitive potassium
(KATP) channels. Inhibition of these ion channels results in cell membrane depolarization and
subsequent activation of voltage-gated Ca2+ (CaV) channels (Rorsman & Renstrom, 2003). Influx
of extracellular Ca2+ through CaV channels causes oscillatory elevations in intracellular Ca2+
([Ca2+]i), fusion of insulin-containing vesicles with cell membranes, and insulin release (Rorsman
67
& Renstrom, 2003). This entire process is suppressed or terminated by the opening of voltage-
gated K+ (KV) channels (Macdonald et al., 2001). The integrated process of the channel gating is
critical for the coordination of insulin release and thus the consequent maintenance of proper
plasma glucose levels.
Pancreatic β-cells and clonal insulinoma cells express four different families of KV channels
(KV1, KV2, KV3, KV4) in variable levels (Dukes & Philipson, 1996;Macdonald et al., 2001;Yan
et al., 2004). KV2.1 is the most abundant KV channel isoform expressed in both isolated islet β-
cells and insulinoma cells. To support this notion, the dominant-negative knockout of KV2.1
channel or pharmacological blockade with a selective KV2.1 antagonist reduces outward KV
currents by ∼60-70% (Macdonald et al., 2001;Macdonald et al., 2002b). In addition to KV2.1,
other KV channel α subunits are expressed in pancreatic β-cells to a lesser extent, including
KV1.4 and KV1.6, which account for less than 25% of outward K+ currents measured in these
cells (Macdonald et al., 2001).
The central role of CaV channels in insulin secretion is well recognized (Rorsman & Renstrom,
2003). The predominant CaV channel in β-cells is the L-type channel (CaV1.2 and CaV1.3)
(Namkung et al., 2001;Schulla et al., 2003). The L-type CaV channel antagonists nifedipine and
verapamil inhibit glucose-induced insulin release (Namkung et al., 2001;Schulla et al., 2003),
whereas L-type CaV channel agonists (BAY-K 8644 and CGP28392) augment the release of
insulin (Malaisse-Lagae et al., 1984;Morgan et al., 1985). Recent evidence from Hofmann and
co-workers (Schulla et al., 2003) has demonstrated a greater role of CaV1.2 in regulating insulin
secretion in comparison with CaV1.3 in mouse β-cells. Specifically, tissue-directed knockout of
CaV1.2 inhibited the first phase of insulin secretion (Schulla et al., 2003), whereas CaV1.3
68
knockout either had no effect on β-cell function (Platzer et al., 2000) or caused some
developmental alterations in β-cell growth and proliferation (Namkung et al., 2001).
Lipid rafts are specialized membrane microdomains highly enriched with cholesterol and
sphingolipids unlike other membrane regions, which are comprised mainly of phospholipids
(Galbiati et al., 2001;Simons & Ehehalt, 2002). The lipid composition of these raft domains and
the tight packing of the acyl lipid chain make these membrane fractions resistant to Triton X-100
or Na2CO3 solubilization. This characterization and their buoyancy on sucrose gradients have
been utilized to purify lipid rafts. Caveolin is a key structural protein of caveolae, and has been
used as a marker protein to isolate caveolae (Smart et al., 1999). Interest in caveolae has emerged
due to the numerous associated membrane and cell signaling proteins within this complex,
including ion channels, G-protein coupled receptors, insulin receptor, kinases, adenylate cyclase,
structural proteins, and SNARE proteins, which are collectively important for exocytosis of
neurotransmitters and hormones (Smart et al., 1999).
In this chapter, I have identified lipid rafts and caveolins in pancreatic β-cells and the raft
association of ion channels and SNARE proteins. I demonstrate that KV2.1 and CaV1.2 are
enriched in lipid rafts. Furthermore, the SNARE proteins syntaxin 1A, SNAP-25, and VAMP-2
target to lipid raft microdomains. Depletion of membrane cholesterol with MβCD results in an
enhancement of β-cell insulin secretion and single-cell exocytotic events. I speculate this could
be partially mediated by the alteration of KV2.1 channel amplitude and gating.
69
2.3 Materials and Methods
2.3.1 Antibodies and Reagents
Antibodies against KV2.1, KV1.4, CaV1.2, and Kir6.2 were purchased from Alomone
Laboratories (Jerusalem, Israel), and the SUR1 antibody was from Santa Cruz Biotechnology
(Santa Cruz, CA, USA). Caveloin-1, caveolin-2, and caveolin-3 antibodies were from BD
Biosciences (Mississauga, ON). The SNARE proteins were probed with mouse anti-syntaxin 1A
antibody (Sigma, Oakville, ON), mouse anti-SNAP-25 antibody (SMI-25, Sternberger
Monoclonal, Lutherville, MD, USA), or rabbit anti-Munc-18a/b antibody (BD Biosciences).
Rabbit anti-VAMP-2 antibodies were generated as described previously (Wheeler et al., 1996).
The mouse monoclonal Munc-13-1 antibody was kindly provided to us by Dr. N. Brose (Max-
Planck-Institut für Experimentelle Medizin, Göttingen, Germany). Guinea pig anti-insulin
antibody was a gift from Dr. R. Pederson (University of British Columbia, BC). MβCD and all
other reagents were from Sigma.
2.3.2 Rat Islet and β-Cell Isolations
Isolation of rat islets by collagenase digestion was performed as described previously (Leung et
al., 2003). Dispersion of islets with 0.015% trypsin in Ca2+- and Mg2+-free phosphate-buffered
saline was used to isolate single β-cells. Both islets and β-cells were cultured in Roswell Park
Memorial Institute (RMPI) 1640 medium supplemented with 10% fetal bovine serum, 0.25%
HEPES, and 100 units/ml penicillin-100 µg/ml streptomycin. β-Cells were used within 3 days
after isolation.
2.3.3 Cell Culture
Hamster HIT-T15 cells were provided by Dr. R. P. Robertson (Pacific Northwest Research
Institute, Seattle, WA, USA). Rat INS-1 cells were obtained from the American Tissue Culture
70
Collection, and mouse MIN6 cells were a gift from Dr. Susumu Seino (Chiba University, Chiba,
Japan). HIT-T15 and INS-1 cells were cultured in RPMI 1640 medium, and MIN6 cells were
grown in Dulbecco's modified Eagle's medium (DMEM). The media were supplemented with
10% fetal bovine serum, 100 units/ml penicillin, and 100 µg/ml streptomycin. For INS-1 and
MIN6 cells, the media were supplemented with 2 µl/500 ml β-mercaptoethanol. Membrane
cholesterol depletion of HIT-T15 cells was performed by incubating 10 mM of MβCD for 30 min
at 37 °C.
2.3.4 Confocal Immunofluorescence Microscopy
Laser confocal immunofluorescence microscopy was performed as described previously (Sheu et
al., 2003). Rat islets and β-cells were fixed in 2% formaldehyde for 0.5 h at room temperature,
blocked with 5% normal goat serum and 0.1% saponin for 0.5 h at room temperature, and then
immunolabeled with mouse monoclonal anti-caveolin-1 or -2 (1:20 dilution) and guinea pig anti-
insulin (1:200 dilution) overnight at 4 °C. The coverslips were rinsed with 0.1% saponin in
phosphate-buffered saline and then incubated with the appropriate fluorescent-labeled secondary
antibodies (either rhodamine red or fluorescein isothiocyanate) for 1 h at room temperature and
mounted on slides in a fading retarder (0.1% p-phenylenediamine in 90% glycerol). Images were
obtained using a Zeiss LSM-410 laser scanning confocal imaging system (Carl Zeiss,
Oberkochen, Germany).
2.3.5 Lipid Raft Isolation
HIT-T15 cells were harvested and lysed in a sodium carbonate solution (500 mM Na2CO3, pH 11,
supplemented with protease inhibitors) using a sonicator. Lysed cells were centrifuged at 2000
rpm for 15 min at 4°C. The supernatant was mixed with an equal volume of a 90% sucrose
solution in MES-buffered saline (MBS, 25 mM MES, 150 mM NaCl, pH 6.5, supplemented with
71
protease inhibitors) and placed into an ultracentrifuge tube (the resulting concentration of sucrose
will be 45%). On top of this 45% sucrose-HIT-T15 lysate, 30% and 5% sucrose (in MBS
containing 250 mM sodium carbonate) were added to form a discontinuous sucrose gradient.
Gradient fractions (600 µl each) were collected from the top, and 30 µl of each fraction was
loaded onto an SDS-PAGE gel. The protein was transferred to polyvinylidene difluoride-plus
membranes (Fisher Scientific Ltd, Nepean, ON) and immunoblotted with the desired primary
antibodies and the peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology).
Proteins were detected by chemiluminescence (ECL-Plus, GE Healthcare, Mississauga, ON), and
membranes were exposed to X-ray film (Eastman Kodak Co, Rochester, NY, USA).
2.3.6 Insulin Secretion Assay
Krebs-Ringer bicarbonate (KRB) buffer containing (in mM) 129 NaCl, 5 NaHCO3, 4.8 KCl, 1.2
KH2PO4, 2.5 CaCl2, 2.4 MgSO4, 10 HEPES (pH 7.4) and 0.1% BSA was used for insulin
secretion assay from HIT-T15 cells. The cultured cells were plated into a 12 well culture plate at
5 × 105 cells per well and cultured overnight in the normal culture medium for HIT-T15 cells
(see the cell culture section). The culture medium was aspirated, and the cells were washed once
with KRB and preincubated for 30 min in 500 μl KRB without or with 10 mM MβCD. The cells
were then washed once with KRB, and incubated for 1 h with 500 μl of fresh KRB, and the
supernatants collected for the assay of basal insulin secretion. 500 μl KRB supplemented with 10
mM glucose was changed to incubate the cells for 1 h at 37 °C, and the supernatants collected for
the assay of glucose-stimulated insulin secretion. The cells were washed with ice-cold PBS and
lysed with 200 µl of acetic acid (1M) - BSA (0.1%) by 2 cycles of freeze-thaw. The cell lysates
were collected and microcentrifuged at 15,000 x g for 10 min at 4°C, and supernatant was used
for the assay of total insulin content and protein concentration determination. All the samples
72
were kept at –20°C until assayed for insulin using a radioimmunoassay (RIA) kit (Millipore
Corporation, St. Charles, MO, USA). The values of the released insulin in the supernatants were
normalized to the total islet insulin contents, which were normalized to the total protein of cell
lysates.
2.3.7 Electrophysiology
Single HIT-T15 cells were voltage-clamped in the whole cell configuration using an EPC-9
amplifier and Pulse software (HEKA Electronik, Lambrecht, Germany). Patch electrodes were
fabricated from 1.5-mm thin-walled borosilicate glass and polished to a tip resistance of 3-4 MΩ
when filled with intracellular solution. For measuring KV currents, the pipette solution contained
(in mM): 140 KCl, 1 MgCl2, 5 EGTA, 5 MgATP, and 5 HEPES (pH 7.2). The bath solution
consisted of (in mM): 140 NaCl, 4 KCl, 1 CaCl2, 1 MgCl2, 10 glucose, and 5 HEPES (pH 7.4).
For the measurement of CaV currents, pipettes were filled with (in mM): 120 CsCl, 20
tetraethylammonium chloride, 5 EGTA, 5 MgATP, and 5 HEPES (pH 7.2). The external solution
comprised of (in mM): 100 NaCl, 20 BaCl2, 20 tetraethylammonium, 4 CsCl, 1 MgCl2, 10
glucose, and 5 HEPES (pH 7.4). Tetraethylammonium was used to block KV currents. Current
recordings were performed at room temperature (21-23 °C), and normalized to cell capacitance.
To elicit KV currents, cells were held at -80 mV and depolarized from -80 mV to +80 mV in 10
mV increments using 500-msec step pulses. CaV currents were triggered by depolarizing voltage
pulses (-60 mV to +80 mV, 500-msec) with membrane potential held at -80 mV. Steady-state
inactivation properties of KV currents were investigated by depolarizing the cells with 5-sec
prepulses from -120 to 20 mV, and the curves were fit with a Boltzmann equation: I/Imax = 1/(1
+ exp(V-V1/2)/k), where V1/2 is the voltage at which half of the channels are inactivated, and k is
the slope factor.
73
2.3.8 Single-cell Capacitance Measurement
Patch electrodes were coated with orthodontic wax (Butler, Guelph, ON) close to the tips and
fire-polished. Pipette resistance ranged from 2-5 MΩ when pipettes were filled with the
intracellular pipette solutions. The pipette solution contained (in mM): 125 K-glutamate, 10 KCl,
10 NaCl, 1 MgCl2, 5 HEPES, 0.05 EGTA, 0.1 cAMP, and 4 MgATP, pH to 7.1. The
extracellular solution consisted of (in mM): 138 NaCl, 5.6 KCl, 1.2 MgCl2, 2.6 CaCl2, 5 HEPES,
and 2.5 D-glucose, pH to 7.4. Some rat islet β-cells were preincubated with the extracellular
solutions containing 10 mM of MβCD for 30 min at 32°C before recordings. Cell capacitance
was estimated by the Lindau-Neher technique (Lindau & Neher, 1988), implementing the "Sine
+ DC" feature of the Lock-in module (40 mV peak-to-peak and a frequency of 500 Hz) in the
standard whole cell configuration. Recordings were conducted using an EPC9 patch clamp
amplifier and Pulse software. Exocytotic events were elicited by a train of eight 500-msec
depolarizing pulses (1-Hz stimulation frequency) from -70 to 0 mV. All recordings were
performed at 32 °C.
2.3.9 Statistical Analysis
Data points represent mean ± SEM. An unpaired Student's t test was used to compare control
values from MβCD-treated groups. P < 0.05 was considered statistically significant.
2.4 Results
2.4.1 Expression of Caveolin in β-Cells
The presence of lipid rafts and caveolin-1 has been described in the neuronal PC12 cells and
pancreatic exocrine acinar cells, and shown to be important in exocytosis (Chamberlain et al.,
2001;Lang et al., 2001;Liu et al., 1999). The thorough identification and characterization of lipid
rafts in β-cells has yet to be reported. Therefore, I initially examined the expression of caveolin, a
74
constituent protein of specialized caveola lipid rafts, in pancreatic islets and insulinoma cell lines.
Using Western blot, I detected the expression of both caveolin-1 and -2 in isolated rat islets as
well as in HIT-T15, MIN6, and INS-1 cells (Figure 7A). No expression of muscle-specific
caveolin-3 was detected in either islets or insulinoma cells.
Pancreatic islets are comprised of insulin-secreting β-cells (>60%), as well as non-β-cells (i.e. α-,
δ- and PP-cells). Therefore, confocal immunofluorescence microscopy was performed to
determine the cellular distribution and localization of caveolins in the islet cells. Immunolabeling
of both caveolin-1 (Figure 7B) and caveolin-2 (Figure 7C) demonstrated their abundant
expression in rat islets. Coimmunolabeling of the islets with insulin to identify β-cells revealed
that both caveolin-1 and caveolin-2 were present in β-cells. Caveolin-2 was also present in non-
insulin-containing cells (Figure 7C). Caveolin is important for the formation of caveolae, flask-
shaped invaginations on the plasma membrane, and for trafficking of cholesterol to the cell
surface membrane (Galbiati et al., 2001). Dispersed islet β-cells were examined for the cellular
localization of caveolin-1. Surprisingly, caveolin-1 showed mainly intracellular labeling and was
colocalized with insulin, implicating its expression on insulin secretory granules (lower panel of
Figure 7B). The detection of caveolins implicates the existence of lipid rafts in pancreatic β-cells.
75
Figure 7. Expression of caveolin-1 and caveolin-2 in pancreatic β-cells
A, Western blots show the expression of caveolin-1 and caveolin-2 in rat islets, as well as INS-1, MIN6, and HIT-T15 β-cell lines. B, Co-immunolocation of caveolin-1 (in green) and insulin (in red) in rat islets (top panel) and isolated rat β-cells (lower panel). The white scale bar denotes 200 µm for top panel and 10 µm for lower panel. C, Co-immunolocation of caveolin-2 (in green) and insulin (in red) in rat islets. The white scale bar denotes 100 µm. Overlay images demonstrate co-localization of caveolin-1 in insulin-containing cells (β-cells) (B), whereas caveolin-2 appears to be expressed in both β-cells and non β-cells (C). Experiments in B and C were performed by Robert Tsushima and Laura Sheu, respectively.
76
2.4.2 KV2.1, CaV1.2 and SNARE Proteins Target to Lipid Rafts in β-Cells
In other cell types, some ion channels and SNARE proteins have been demonstrated to be
enriched in lipid rafts (Chamberlain et al., 2001;Lang et al., 2001;Martens et al., 2000). Proteins
localized in lipid rafts are resistant to sodium carbonate or Triton X-100 solubilization, and can
be separated on discontinuous sucrose gradients (Liu et al., 1999). To examine the presence of
lipid rafts and their constituent proteins, HIT-T15 cells were lysed with 500 mM Na2CO3 (pH 11)
and lipid raft fractions were separated with a discontinuous sucrose gradient ultra-centrifugation.
Targeting of ion channels and SNARE proteins were identified with Western blot. I found that
that KV2.1 and CaV1.2 channels co-migrated with caveolin-1 and -2 to the interface between 5%
and 30% sucrose, suggesting that these proteins target to lipid rafts. In contrast, neither KV1.4 nor
the KATP channel subunits, Kir6.2 and SUR1, migrated to the lipid raft fractions (Figure 8A).
Since our laboratory and other groups have demonstrated that both KV2.1 and CaV1.2 channels
functionally coupled with the SNARE proteins, syntaxin 1A and SNAP-25 (Kang et al.,
2002;Leung et al., 2003;Macdonald et al., 2002c;Wiser et al., 1996;Wiser et al., 1999), I
therefore examined if these SNARE proteins are colocalized with these two ion channels in the
lipid raft membrane domains. Indeed, I found that SNARE proteins syntaxin 1A, SNAP-25, and
VAMP-2, but not SNARE regulatory proteins Munc-13-1 or Munc-18a/b, localized to the lipid
raft-rich fractions (Figure 8A). To confirm that KV2.1 and CaV1.2 channels and the SNARE
proteins were localized to cholesterol-rich lipid rafts, I disrupted lipid rafts by depleting
membrane cholesterol with MβCD, a technique that has been used to verify the association of
proteins with lipid rafts (Foster et al., 2003). Incubation of HIT-T15 cells with 10 mM MβCD
resulted in the redistribution of KV2.1 and CaV1.2, as well as the SNARE proteins, syntaxin-1A,
SNAP-25, and VAMP-2 out of the lipid raft fraction (Figure 8B), indicating that these proteins
are indeed localized to lipid raft domains.
77
Figure 8. Association of β-cell ion channels and SNARE proteins with lipid rafts
A, Western blot analysis was performed on HIT-T15 cell fractions taken from the 5-45% discontinuous sucrose gradient. Na2CO3-resistant fractions (the interface between 5 and 30% sucrose) denote the ion channels and SNARE proteins in lipid raft. B, MβCD (10 mM) pretreatment shifted KV2.1, CaV1.2, syntaxin 1A, SNAP-25, and VAMP-2 out of Na2CO3-resistant fractions, suggesting that these proteins are no longer associated with lipid rafts.
78
2.4.3 Cholesterol Depletion Causes and Elevated Basal Insulin Secretion
Cholesterol depletion in neuronal PC-12 cells reduces the number of SNARE protein clusters on
the plasma membrane and resulted in a reduction of exocytosis and the rate of dopamine
secretion (Chamberlain et al., 2001;Lang et al., 2001). Therefore, I determined whether
cholesterol depletion might have similar effects on β-cells. The cultured HIT-T15 β-cells were
pre-incubated without or with 10 mM MβCD for 30 min before the incubation with low and high
glucose KRB solutions. Disruption of lipid rafts with MβCD caused elevated basal insulin
secretion from HIT-T15 cells under 0 mM glucose by 266% (n = 6, P < 0.01). Although insulin
secretion of MβCD-treated cells under 10 mM glucose was elevated by 80% (n = 6, P < 0.05)
compared to untreated control cells, it was not significantly different from MβCD-treated cells
under 0 mM glucose condition. Therefore, MβCD caused an elevated basal insulin secretion, and
the cells did not further response to glucose stimulation, implicating a loss of regulated
exocytosis (Figure 9).
79
Figure 9. Disruption of lipid rafts with MβCD causes an elevated basal insulin secretion from HIT-T15 cells
HIT-T15 cells were pre-incubated for 30 min in KRB solution without and with10 mM MβCD. Basal insulin secretion (0 mM glucose) and glucose-stimulated insulin secretion (10 mM glucose) were measured after 1 h incubation with KRB solution. 10 mM MβCD causes a significant elevation of basal insulin secretion under 0 mM glucose conditions. Under 10 mM glucose condition, MβCD-treated cells show a higher insulin secretion than that of untreated cells, but this is not significantly different from that of MβCD-treated cells under 0 mM glucose (p = 0.23). * P < 0.05, ** P < 0.01 compared to controls.
80
2.4.4 MβCD Enhances Single β-Cell Exocytotic Activity
Single cell capacitance (Cm) measurements were then performed to examine the effects of
MβCD on insulin granule exocytosis of single rat islet β-cells (Lindau & Neher, 1988;Sheu et al.,
2003). Exocytosis was elicited by eight depolarizing pulses from -70 mV to 0 mV to measure
both the size of the readily releasable pool of insulin granules and the extent of refilling of this
pool from the reserve pool (Rorsman & Renstrom, 2003) (Figure 10). A single depolarizing pulse
increased cell capacitance by 115 ± 34 fF (n = 6) in control β-cells. This value is similar to a
previous study suggesting that this represents the readily releasable pool of insulin vesicles
docked at the plasma membrane (Barg et al., 2001). Preincubation of the cells with 10 mM
MβCD increased Cm by 213 ± 34 fF (n = 6); however, this did not achieve statistical significance
from control (P = 0.07). A more marked effect was observed following seven additional
depolarizing trains whereby control Cm increased by 266 ± 47 fF from baseline, whereas
cholesterol depletion resulted in a rise of 698 ± 74 fF (n = 6; p < 0.001), indicating a greater
capacity to fill up the readily releasable pool and amplify exocytosis. Furthermore, although the
Cm increases leveled off by the 5th depolarizing pulse in control cells, a further incremental
increase in Cm even up to the 8th pulse in the MβCD-treated cells was observed. Taken together,
both insulin secretion and single cell capacitance measurement indicated disruption of lipid raft
with MβCD significantly enhanced basal β-cell insulin secretion. Since ion channels play a
critical role on β-cell stimulus-secretion coupling, the possible effect of membrane cholesterol
depletion on ion channel activities was examined next.
81
Figure 10. Cholesterol depletion enhances single-cell exocytotic events
Changes in cell capacitance (ΔCm) were measured from single rat β-cells using a train of eight depolarizing pulses (500-msec in duration) from -70 mV to 0 mV. A, representative recordings of ΔCm from a control β-cell and a separate β-cell pretreated with 10 mM MβCD. B, summarized changes in ΔCm from control and MβCD pretreated β-cells. Points represent the mean ± SEM from six cells. *, P < 0.05; , P < 0.01; , P < 0.001compared to controls. Edwin Kwan helped with this experiment.
82
2.4.5 Cholesterol Depletion Affects the Amplitude and Gating of KV Channels
Membrane cholesterol depletion by MβCD has been shown to alter the gating but not current
amplitude of heterologous expressed KV2.1 in transfected Ltk-cells (Martens et al., 2000). The
effects of cholesterol depletion on KV and CaV channel gating in HIT-T15 cells were then
examined. There was a marked reduction in peak KV current amplitude in HIT-T15 cells after
pretreatment with MβCD (Figure 11A). Peak outward KV currents were reduced from 276 ± 15
pA/pF (control) to 187 ± 31 pA/pF in MβCD-treated cells (n = 4, P < 0.05) (Figure 11B). The
remaining outward KV currents displayed a prominent inactivating component, similar to the
currents observed following blockade of KV2.1 channels in β-cells (Macdonald et al.,
2001;Macdonald et al., 2002b). The reduction in KV currents is not the result of a large
hyperpolarizing shift in the steady-state current inactivation as observed by Martens et al.
(Martens et al., 2000), which could lead to reduction in measured KV currents. There was a small,
yet significant, leftward shift in the steady-state inactivation curve with a V1/2 of -27 ± 2 mV in
control to -36 ± 1mV after treating the cells with MβCD (n = 4, P < 0.05) (Figure 11C). No
changes in the voltage dependence of KV channel activation were observed. In contrast to the
effect of MβCD on the KV channels, there was no significant change to the property of CaV
current amplitude (Figure 12).
83
Figure 11. Effects of MβCD pretreatment on β-cell KV current amplitude and channel gating
A, whole cell currents were recorded from HIT-T15 cells. A marked reduction in peak outward K+ currents and acceleration of current inactivation are observed following MβCD pretreatment. B, a significant reduction in peak KV current amplitude is observed following treatment with MβCD (left panel), but there is no significant change in the voltage dependence of channel activation (right panel). C, steady-state inactivation was measured using a standard two-pulse protocol. MβCD significantly elicited a hyperpolarizing shift in the inactivation curve (p < 0.05) with no change in the slope factor. Experiments of this figure were performed by Robert Tsushima.
84
Figure 12. Effects of MβCD on L-type CaV channels in HIT-T15 β-cells
A, representative whole cell recordings of L-type CaV currents recorded using 20 mM BaCl2 in the bath solution and 20 mM tetraethylammonium inside and outside to block KV currents. Currents were elicited from a holding potential of -80 mV with step depolarizations from -60 to +80 mV. 30-min preincubation with 10 mM MβCD had no significant effect on peak CaV currents. B, current-voltage relationship of L-type CaV channels in control and following preincubation with MβCD (n = 5). Cholesterol depletion had no effect on the amplitude of L-type CaV channels.
85
2.5 Discussion
2.5.1 Lipid Rafts and Caveolins in Pancreatic β-Cells
Lipid rafts have garnered much interest due to the targeting of numerous membrane proteins to
these domains and the association of caveolin with normal cell biology and pathogenesis of a
variety of diseases including diabetes, cancer, atherosclerosis, Alzheimer’s disease, and muscular
dystrophy (Galbiati et al., 2001;Simons & Ehehalt, 2002). The existence and role of lipid rafts in
pancreatic β-cells has not been fully elucidated. Using Western blot and confocal microscopy, the
protein expression of caveolin-1 and caveolin-2 have been detected in primary pancreatic β-cells
and clonal β cell lines. Caveolin-2 appeared to be expressed in non-β-cells as well, possibly α-
cells (to be examined in Chapter Three), the second major groups of pancreatic islet cells.
Surprisingly, expression of caveolin-1 in primary β-cells was concentrated in intracellular
compartments in a similar manner to insulin. This is in accordance with the reports that both
endocrine and exocrine secretory granular membranes are rich in cholesterol and caveolin-1 (Liu
et al., 1999;Orci et al., 1981). Western blot analysis on subcellular fractions of MIN6 β-cells
indicated that caveolin-1 was expressed in fractions of both plasma membranes and insulin
secretory granule membranes (Nevins & Thurmond, 2006).
2.5.2 Targeting of Ion Channels to Lipid Rafts in Pancreatic β-Cells
I have demonstrated the selective localization of the ion channels, KV2.1 and CaV1.2, but not
Kir6.2/SUR1 and KV1.4, to lipid rafts. Previous work has shown KV2.1 target to lipid rafts in
transfected Ltk-cells (Martens et al., 2000). Depletion of membrane cholesterol in their study
resulted in a marked voltage shift in the steady-state inactivation curve without any effect on
KV2.1 current amplitude. This is in stark contrast to the present study, in which a dramatic
decrease in KV2.1 currents was observed following treatment with MβCD. The reasons for these
86
differences on KV2.1 current magnitude are not currently known but may result from the
differences in the lipid microenvirnoment between insulin-secreting cells and Ltk-cells. In
contrast to the marked effects on KV2.1 channels, No effect of cholesterol depletion on L-type
CaV currents was observed, although CaV1.2 channels were no longer associated with lipid rafts.
These results are similar to the lack of changes on L-type Ca2+ channel gating and amplitude in
cardiac and smooth muscle cells after MβCD treatment (Lohn et al., 2000) and suggest that these
channels are more resistant to changes in the surrounding lipid milieu. Lastly, I did not find the
KATP channel subunits, Kir6.2 and SUR1, migrated to lipid raft fractions on sucrose gradients,
indicating that KATP channels are not regulated by lipid rafts in pancreatic β-cells.
It is not clear why only KV2.1 and CaV1.2 channels are localized to lipid rafts. However, our
laboratory and other groups have shown that both these channels directly interact with the
SNARE proteins, syntaxin 1A and SNAP-25 (Kang et al., 2002;Leung et al., 2003;Macdonald et
al., 2002c;Wiser et al., 1996). These channels may cluster at the limited and discrete active zones
on the plasma membranes, where insulin granules are docked (Bokvist et al., 1995), forming
what has been referred to as the excitosome complex (Wiser et al., 1999). It is conceivable that
trafficking of cholesterol, via caveolin on the insulin granules, to the active zones incorporates
cholesterol into the surrounding membrane around these channels after granule fusion. The
reduction in KV2.1 currents could partially account for the increased insulin secretion. Knock-
down of KV2.1 channel expression or selective pharmacological blockade of these channels in β-
cells markedly enhanced glucose-induced insulin secretion (Macdonald et al., 2001;Macdonald
et al., 2002b).
87
2.5.3 Targeting of SNARE Proteins to Lipid Rafts in Pancreatic β-Cells
As in PC12 cells, I observed the association of the SNARE proteins syntaxin 1A, SNAP-25, and
VAMP-2 in lipid rafts, but not the SNARE-associated proteins Munc-13-1 or Munc-18a/b.
SNARE proteins play an important role in structural and spatial organization of secretory vesicles
for exocytosis. Cholesterol depletion MβCD in PC12 cells inhibited exocytosis and dopamine
release (Chamberlain et al., 2001;Lang et al., 2001). I demonstrated here that depletion of
membrane cholesterol in pancreatic β-cells resulted in elevated basal insulin release and impaired
glucose-stimulated insulin secretion, indicating a loss of regulated exocytosis. This is consistent
to the report of the Thurmond group, who found siRNA-mediated depletion of caveollin-1 in
MIN6 β-cells and mouse islets results in an elevation of basal insulin secretion only (Nevins &
Thurmond, 2006). Single cell capacitance measurement indicates MβCD causes increases in
both readily releasable pool of insulin granules (the first two pulses) and the refilling of this pool
from the reserve pool (the remaining pulses). This suggests that membrane cholesterol depletion
may profoundly affect the sequential steps of insulin exocytosis, including vesicular mobilization,
docking, or priming of insulin granules with the plasma membrane. Future studies are warranted
to determine the cellular mechanism of the elevated hormone secretion following cholesterol
depletion (Chapter Three).
In summary, I have demonstrated the presence of lipid rafts and caveolin proteins in pancreatic
β-cells and the selective association of KV2.1, CaV1.2, and the SNARE proteins syntaxin 1A,
SNAP-25, and VAMP-2 in cholesterol-rich lipid rafts. The cellular role of caveolins in β-cells
remains to be determined. Localization of KV2.1 in lipid rafts is important for channel gating
given that cholesterol depletion results in a large decrease in KV2.1 current amplitude. The loss of
regulated insulin secretion caused by cholesterol depletion with MβCD implicates that β-cell
88
exocytosis is regulated by the integrity of lipid rafts. Inhibition of KV2.1 channels could be one
of the mediators to the elevated insulin secretion. The possible contribution of SNARE proteins
is further investigated in the following chapter (Chapter Three). This study clearly demonstrated
the role of cholesterol-rich lipid rafts on regulating β-cell ion channels and exocytotic machinery.
89
3 Chapter Three: Roles of Lipid Rafts in Glucagon Secretion from Pancreatic α-Cells
The following chapter was published in Endocrinology, and reprinted with the permission of the
Endocrine Society from:
Xia F, Leung YM, Gaisano G, Gao X, Chen Y, Manning Fox JE, Bhattacharjee A, Wheeler MB,
Gaisano HY and Tsushima RG. Targeting of KV4, CaV1.2 and SNARE proteins to cholesterol-
rich lipid rafts in pancreatic α-Cells: Effects on glucagon stimulus-secretion coupling.
Endocrinology 148:2157-2167, 2007
Xiaodong Gao helped in islet isolation. Contributions by other co-authors to the figures
presented are stated in the figure legends.
90
3.1 Abstract
Pancreatic α-cells secrete glucagon in response to low glucose to counter insulin action, thereby
maintaining glucose homeostasis. The molecular basis of α-cell stimulus-secretion coupling has
not been fully elucidated. I investigated the expression of voltage-gated K+ (KV) and Ca2+ (CaV)
channels, and SNARE proteins in pancreatic α-cells, and examined their targeting to specialized
cholesterol-rich lipid rafts. In α-cells, I detected the expression of KV4.1/4.3 (A-type current),
KV3.2/3.3 (delayed rectifier current), CaV1.2 (L-type current), CaV2.2 (N-type current), and the
SNAREs (syntaxin 1A, SNAP-25, and VAMP-2) and SNARE-associated proteins (Munc-13-1,
Munc-18a/b). I also detected caveolin-2, a structural protein of cholesterol-rich lipid rafts. Of
these proteins, caveolin-2, KV4.1/4.3, CaV1.2, and SNARE proteins (syntaxin 1A, SNAP-25, and
VAMP-2) target to lipid raft domains on α-cell plasma membranes. Disruption of lipid rafts by
depletion of membrane cholesterol with methyl-β-cyclodextrin (MβCD) decreased the
association of KV4.1/4.3, CaV1.2 and SNARE proteins with lipid rafts. Incubation of pancreatic
islets with MβCD resulted in an enhancement of glucagon secretion and single α-cell exocytotic
activity, an effect that could be caused by the dissociation of SNAP-25 and syntaxin 1A from
cholesterol-rich lipid raft domains. These data indicate that lipid rafts in pancreatic α-cells play
an important role in regulating glucagon secretion.
3.2 Introduction
Glucagon-secreting α-cells and insulin-secreting β-cells are the most important groups of
pancreatic islet cells for controlling glucose homeostasis. However, the precise molecular basis
of stimulus-secretion coupling of α-cells has not been fully elucidated compared to our
knowledge of the neighboring β-cells. A model has been proposed by which low glucose
91
stimulates glucagon release in mouse α-cells (Barg et al., 2000;Gopel et al., 2000b;Gromada et
al., 2004). However, recent data has demonstrated conflicting evidence on α-cell stimulus-
secretion coupling. Single rat α-cell stimulus-secretion coupling was shown to mirror that of β-
cells, in which glucose stimulates glucagon secretion (Franklin et al., 2005;Olsen et al., 2005).
Similar findings have been shown in mouse islets and In-R1-G9 clonal α-cells (Salehi et al.,
2006). The action of glucose on α-cell glucagon secretion does not seem to be mediated by
mitochondrial oxidative metabolism as in pancreatic β-cells, since glucose does not provoke
significant changes in α-cell metabolism (Quesada et al., 2006) or in ATP/ADP ratio (Detimary
et al., 1998). There is additional evidence to support the theory that the cross-talk between islet
α- and β-cells plays an important role in regulating α-cell stimulus-secretion coupling. This
suggests glucose itself, as well as other contributing factors such as paracrine regulation by
neighboring β- and δ-cells, are involved in controlling glucagon release (Cejvan et al.,
2003;Franklin et al., 2005;Xu et al., 2006).
Ion channel activity in α-cells has been characterized by their electrophysiological properties
(Barg et al., 2000;Barg, 2003;Gopel et al., 2004;Gopel et al., 2000b;Gromada et al., 2004), but
the molecular identity of these ion channels in α-cells has not been fully determined (Bokvist et
al., 1999;Suzuki et al., 1999;Yan et al., 2004). Two types of KV currents, A-type TEA-resistant
transient KV currents and TEA-sensitive delayed rectifier KV currents, have been recorded in α-
cells (Barg et al., 2000;Gopel et al., 2000b;Gromada et al., 2004). In human α-cells, expression
of mRNA transcripts of KV3.1 and silent KV6.1 have been reported, but corresponding A-type
KV channel transcripts (KV1.4, KV3.4, KV4) were not detected in these cells (Yan et al., 2004).
KV4.3 have been found to be expressed in mouse α-cells by confocal microscopy (Gopel et al.,
2000a), which would presumably carry the A-type KV currents in pancreatic α-cells.
92
High voltage-activated L-type and N-type voltage-gated Ca2+ (CaV) currents and low voltage-
activated T-type CaV currents have been recorded in mouse and rat α-cells (Barg et al.,
2000;Gopel et al., 2000b;Gromada et al., 1997;Leung et al., 2006b;Rorsman & Hellman, 1988).
Work by the Rorsman group (Gopel et al., 2004) demonstrated that blockade of the N- but not L-
type CaV channels impairs glucagon release and exocytotic activity in mouse α-cells. L-type CaV
channels can regulate glucagon secretion, but only when intracellular cAMP levels are elevated
(Gromada et al., 1997). However, a recent study by Vignali and colleagues (Vignali et al., 2006)
observed a lack of expression of N-type (CaV2.2) and T-type CaV channels in mouse α-cells by
single cell PCR and patch clamp experiments. The reason for these differences is not currently
known, but may be due to genetic differences in the mouse strains (NMRI vs. C57BL/6).
Lipid rafts are membrane microdomains composed mainly of cholesterol and sphingolipids
(Galbiati et al., 2001;Golub et al., 2004), which are insoluble to cold Triton X-100. These
detergent-resistant properties of lipid rafts and their buoyancy on sucrose gradients have been
used for purification of these plasma membrane microdomains. Lipid rafts have garnered much
interest due to the targeting of numerous membrane proteins to these domains, and the
association of caveolin in normal cell biology and in the pathogenesis of a number of diseases,
including diabetes (Galbiati et al., 2001). In the previous chapter (Chapter Two), I reported the
expression of caveolin proteins in pancreatic β-cells and the targeting of KV2.1, CaV1.2 and the
SNARE proteins syntaxin 1A, SNAP-25 and VAMP-2 to lipid raft microdomains in β-cells (Xia
et al., 2004). That work indicated that membrane compartmentalization of ion channels and
SNARE proteins in β-cells play an essential role in regulating insulin release from β-cells. In this
chapter, I explored whether cholesterol-rich lipid rafts play a fundamental role in regulating
stimulus-secretion coupling in pancreatic α-cells.
93
3.3 Materials and Methods
3.3.1 Cell Culture
Mouse αTC6 cells (kindly provided by Dr. Y. Moriyama, Okayama University, Japan) were
grown and maintained in Dulbecco’s modified Eagle’s medium (DMEM, Sigma-Aldrich Canada
Ltd. Oakvile, ON) containing 25 mM glucose and supplemented with 10% fetal bovine serum,
100 U/ml penicillin, 100 μg/ml streptomycin and 2 mM L-glutamine.
3.3.2 Pancreatic Islet Isolation and Dispersion
Pancreatic islets from rats and MIP-GFP mice (green fluorenscent protein (GFP)-transgenic mice
driven by mouse insulin promotor (MIP), kindly provided by Dr. M. Hara, University of
Chicago), were isolated by collagenase digestion as described in Chapter Two (Xia et al., 2004).
Islets were dispersed into single cells with 0.25% trypsin in Ca2+- and Mg2+-free Hanks’s
Balanced Salt Solution (Invitrogen, Burlington, ON). Both intact islets and dispersed islet cells
were cultured in RPMI 1640 media containing 11 mM glucose supplemented with 10% fetal
bovine serum, 0.25% HEPES, 100 U/ml penicillin and 100 µg/ml streptomycin. The cultured
islet cells were used within 2 d.
3.3.3 RNA Preparation and Quantitative PCR
Total RNA was isolated from a monolayer of αTC6 cells using TRIzol (Invitrogen) following the
manufacturer’s protocol. Subsequent DNase I treatment was performed to remove any residual
DNA contamination (QIAGEN, Mississauga, ON). One µg of the isolated RNA was reverse
transcribed using Moloney murine leukemia Virus Reverse Transcriptase according to the
manufacturer’s instructions (Invitrogen).
94
Quantitative PCR (qPCR) was performed as described previously (Wang et al., 2004). Primers
were designed using Primer Express version 2.0 software (Applied Biosystems, Foster city, CA,
USA) (Table 1), and sequence specificity confirmed before use. Master mix was aliquoted to a
384-well plate (Applied Biosystems) with each well containing: 4 μl DNA, 2.85 µl H2O, 1 µl
10x PCR buffer, 0.2 µl Rox, 0.2 µl primer mix (or 0.1 µl forward, 0.1 µl reverse, 50 µM stock
each), 1.2 µl 25 mM MgCl2, 0.2 µl dNTP mix (10 mM each), 0.025 µl Platinum Taq polymerase,
0.3 µl 1:1000 SYBR Green I (all components from Invitrogen). Ten nanograms of αTC6 cDNA
per well was used as the template for amplification. The real-time PCR protocol employed was
as follows: heat activation of polymerase at 95°C for 3 min, followed by 40 cycles of: 95°C for
10-sec, 65°C for 15-sec and 72°C for 20-sec. Readings were carried out on an ABI Prism
7900HT Sequence Detection System (Applied Biosystems) and compared against a standard
curve created from mouse genomic DNA. Data was normalized to the expression of β-actin in
each sample.
95
Table 1. Primer sequences of KV channels
Gene Channel Forward Reverse Accession no.
KCNA1 Kv1.1 AGATCGTGGGCTCCTTGTGT ACGGGCAGGGCAATTGT NM_010595
KCNA2 Kv1.2 AGCTGATGAGAGAGATTCCCAGTT GACTGCCCACCAGAAAGCA NM_008417
KCNA3 Kv1.3 TTGTGGCCATCATTCCTTA CCTGCTGCCCATTACCTTGT NM_008418
KCNA4 Kv1.4 TCTACCACAGAGAGACTGAAAATGAAG TGGACAACTGACTGCGTTTTG NM_021275
KCNA5 Kv1.5 TGAGCATTCACTGTAAGATGGATGT TTGAGTTATCCCTCTGCTGGGTA NM_145983
KCNA6 Kv1.6 CCTGGATGAGATGCACGTTT TTACAAGACCCAGGCATGAAAA NM_013568
KCNA7 Kv1.7 CTGGTTGGAGCCACAAGGA CTGCCACATCTTTTCCCAAGTAC NM_010596
KCNB1 Kv2.1 CGTCATCGCCATCTCTCATG CAGCCCACTCTCTCACTAGCAA NM_008420
KCNC1 Kv3.1 TGCCCCAACAAGGTGGAA ATGGCCACAAAGTCAATGATATTG NM_008421
KCNC3 Kv3.3 CGGGCTGCCAGGTATGTG AGGTGGTGATGGAGATGAGGATAA NM_008422
KCNC4 Kv3,4 TGTTGAAGTCAGTTGAAGGCAAGA GGTGGGAGGTAGAACCCCAAT NM_145922
KCND1 Kv4.1 GCTGCTCTCGAAGGGTCAAT CACGGCTGACAGAGGCAGTA NM_008423
KCND3 Kv4.3 CCTGCTGCTCCCGTCGTA GGGTGGCAGGCAGGTTAGA NM_001039347
KCNF1 Kv5.1 TATCAGATGGCCTGGCATGA ATGCTGAACAGGAGGTTTTATTGAG NM_201531
KCNE1 Kv6.1 TGCCCCACTGCTCTATGTCA AGCGGAGATGCTGGTGAATT XM_984475
KCNE4 Kv6.2 GGGCCCTCTGTTCACTTTAAGAT TTAAACGGCCCCCTTTGG NM_134110
KCNG4 Kv6.3 AGTGCATCTTGACCATGTGGAA GGAGCATGTGTGTGCATCTGT NM_025734
KCNS1 Kv9.1 GCCTACACAGCCGAAGAAGAA ACCAGCAGGCAGGGATTG NM_008435
KCNS2 Kv9.2 TGGGACATAAGCCCTAGATTGC GACACACCATCCTCAAAAGAAAAA NM_181317
KCNS3 Kv9.3 AATTGGCTTAGAAGGACCTGCTT AACTATCACCTAAGGAGCCATGAAA NM_173417
KCNG3 Kv10.1 GAGAGCGTGCGGTGACTGT CAAACTGCTGGGCCTGCTTA NM_153512
KCNV2 Kv11.1a CGGGACATGCGCTTCTATG GGCGGCCACAGAGGAAA NM_183179
ACTB β-Actin CTGAATGGCCCAGGTCTGA CCCTGGCTGCCTCAACAC NM_007393
96
3.3.4 Immunoblotting
Western blot was performed to analyse the protein expression of ion channels and SNARE
proteins. The cell lysates and sucrose gradient fractions were subjected to SDS-PAGE and
transferred to polyvinylidene difluoride-plus membranes (Fisher Scientific Ltd, Nepean, ON).
Membranes were probed with the indicated primary antibodies; anti-KV2.1, KV3.2, KV3.3, KV3.4,
KV4.1, KV4.2, KV4.3, CaV1.2, and CaV2.2 from Alomone Laboratories (Jerusalem, Israel), anti-
caveolin and anti-Munc-18a/b from BD Biosciences (Mississauga, ON), anti-SNAP-25, syntaxin
1A, (Sigma), anti-VAMP-2 generated as described previously (Wheeler et al., 1996), and anti-
Munc-13-1 was kindly provided to us by Dr. N. Brose (Max-Planck-Institut für Experimentelle
Medizin, Göttingen, Germany). The bound primary antibodies were detected with appropriate
peroxidase-conjugated secondary anti-mouse or anti-rabbit antibodies (Jackson ImmunoResearch
Laboratories, West Grove, PA, USA), and then visualized by chemiluminescence (ECL-Plus, GE
Healthcare, Mississauga, ON) and exposured to X-ray films (Eastman Kodak Co., Rochester,
NY, USA).
3.3.5 Confocal Immunofluorescence Microscopy
Dispersed rat islet cells were fixed in 2% formaldehyde for 0.5 h at room temperature, blocked
with 5% normal goat serum and 0.1% saponin for 0.5 h at room temperature, and then double
immunolabeled with anti-caveolin (1:200 dilution, BD Biosciences) and anti-glucagon (1:400
dilution, Sigma) antibodies for 2 h at room temperature. The coverslips were rinsed with 0.1%
saponin in PBS, then incubated with fluorescein isothinocyanate (FITC)-labeled anti-rabbit and
Texas Red-labeled anti-mouse antibodies for 1 h at room temperature, and mounted on slides in a
fading retarder (0.1% p-phenylenediamine in 90% glycerol). αTC6 cell lines and dispersed MIP-
GFP mouse islet cells were used for the detection of membrane localization of SNAP-25 and
syntaxin 1A. The same procedure was performed as above except the different antibodies were
97
used, anti-SNAP-25 and syntaxin 1A (Sigma) and FITC- (for αTC6) or tetramethylrhodamine
isothiocyanate (TRITC)-labelled anti-mouse antibodies (for MIP-GFP islet cells). Images were
obtained using a Zeiss LSM 410 laser scanning confocal imaging system (Carl Zeiss,
Oberkochen, Germany).
3.3.6 Lipid Raft Isolation
αTC6 cells were harvested and lysed by sonication with cold 1% Triton X-100 in 2-(N-
morpholine)-ethane sulfonic acid (MES)-buffered saline (MBS, 25 mM MES, 150 mM NaCl
(pH 6.5), supplemented with protease inhibitors). Lysed cells were centrifuged at 2000 rpm for
15 min at 4°C. The supernatant was diluted with equal volume of an 80% sucrose solution in
MBS (with 1% Triton X-100) and placed into the bottom of an ultracentrifuge tube. The 30%
and 5% sucrose in MBS were loaded on top of the 40% sucrose-Triton X-100 αTC6 lysate
sequentially to form a discontinuous sucrose gradient, and the sample was centrifuged at 39,000
rpm in a Beckman SW41 rotor for 20 h at 4°C. Twenty gradient fractions (600 µl each) were
collected from the top, and 10-30 µl of each fraction was loaded onto an SDS-PAGE gel for
Western blot analysis. To deplete membrane cholesterol, αTC6 cells were incubated with 10 mM
methyl-β-cyclodextrin (MβCD) for 30 min at 37°C.
3.3.7 Glucagon Secretion Assay
Krebs-Ringer bicarbonate (KRB) buffer containing (in mM) 129 NaCl, 5 NaHCO3, 4.8 KCl, 1.2
KH2PO4, 2.5 CaCl2, 2.4 MgSO4, 10 HEPES and 0.1% BSA was used for glucagon secretion
assay from mouse pancreatic islets. The isolated islets were cultured overnight in RPMI 1640
media containing 11 mM glucose supplemented with 10% fetal bovine serum. The following day,
15-30 islets were washed once with KRB and preincubated for 30 min in 500 μl KRB
supplemented with 16.7 mM glucose with or without 10 mM MβCD. After the preincubation
98
period, islets were washed once and then stimulated with 1 mM glucose (in 500 μl KRB) for 1 h
at 37°C, and the supernatants containing stimulated glucagon were then separated from the islets.
Islets were washed with ice-cold PBS, harvested, lysed with 1% Triton X-100, and determined
for protein concentration. Samples were kept at –20°C until assayed for glucagon using a RIA kit
(Linco Research, Inc., St. Charles, MO, USA), and the values of the released glucagon in the
supernatants normalized to the total protein in the cell lysate.
3.3.8 Electrophysiology
MIP-GFP mice, transgenic mice where β-cells express GFP, were recently characterized
electrophysiologically for their normal α- and β-cells (Leung et al., 2005a). Primary α-cells in
these MIP-GFP mice were selected from dispersed islet cells by being non-green cells, with a
size of 3 pF or less, and displayed characteristic voltage-gated Na+ currents at a holding potential
of –80 mV (Gopel et al., 2000b). Single α-cells were voltage clamped in the whole-cell
configuration using an EPC-10 amplifier and Pulse software (HEKA Electronik, Lambrecht,
Germany). Patch electrodes were fabricated from 1.5 mm thin-walled borosilicate glass and
polished to a tip resistance of 3-4 MΩ when filled with intracellular solution. The pipette
solution for KV current measurements contained (in mM): 140 KCl, 1 MgCl2, 5 EGTA, 5
MgATP and 10 HEPES (pH 7.2, adjusted with KOH). This pipette solution was also used for
KATP current measurement while MgATP was reduced to 0.1 mM. The bath solution for KV
current measurements consisted of (in mM): 140 NaCl, 4 KCl, 2 CaCl2, 1 MgCl2, 5 D-glucose
and 10 HEPES (pH 7.4, adjusted with NaOH). TEA-chloride (20mM) was included when
measuring KATP current. For the measurement of CaV currents, pipettes were filled with (in mM):
120 CsCl, 20 tetraethylammonium (TEA) chloride, 5 EGTA, 5 MgATP, 1 MgCl2 and 10 HEPES
(pH 7.2, adjusted with CsOH). The external solution for CaV currents comprised of (in mM): 100
99
NaCl, 20 BaCl2, 20 TEA, 4 CsCl, 1 MgCl2, 5 D-glucose and 10 HEPES (pH 7.4, adjusted with
NaOH). TEA was used to block KV currents. Current recordings were performed at room
temperature (~22°C), and normalized to cell capacitance. To elicit KV current, cells were held at
–80 mV and depolarized from –80 mV to +60 mV in 10 mV increments using 500-msec step
pulses. CaV currents were triggered by depolarizing voltage pulses (-70 mV to +70 mV, 500-
msec) with membrane potential held at –80 mV. To measure KATP current, cells were held at -80
mV and stimulated by a series of voltage pulses from -140 to -20 mV (500 ms) at 20 mV
increments to obtain the current-voltage relationship.
3.3.9 Membrane Capacitance Measurement
Exocytosis of primary mouse α-cells from MIP-GFP mice was detected by the measurement of
changes of cell capacitance. Recording electrodes were coated with orthodontic wax (Butler,
Guelph, ON) close to the tips and fire-polished. Pipette resistance ranged from 3-5 MΩ when
pipettes were filled with the intracellular pipette solution, which contained (in mM): 125 K-
glutamate, 10 KCl, 10 NaCl, 1 MgCl, 5 HEPES, 0.08 EGTA, 0.1 cAMP, and 4 MgATP (pH 7.1,
adjusted with KCl). The extracellular solution consisted of (in mM): 140 NaCl, 4 KCl, 2 CaCl2, 1
MgCl2, 10 HEPES, and 5 D-glucose (pH 7.3, adjusted with NaOH). Some α-cells were
preincubated with the exracellular solution containing 10 mM MβCD for 30 min at 37°C before
recordings. Membrane capacitance (Cm) was estimated by the Lindau-Neher technique (Lindau
& Neher, 1988), implementing the “sine + DC” feature of lock-in model (40 mV peak to peak
and a frequency of 500 Hz) in the standard whole cell configuration. Recordings were conducted
using an EPC-10 patch clamp amplifier and Pulse software. Exocytotic events were elicited by a
train of eight 500-msec depolarizing pulses (1-Hz stimulation frequency) from –70 to 0 mV. All
recordings were performed at 30°C.
100
3.3.10 Statistical Analysis
Data points represent mean ± SEM. An unpaired Student’s t-test was used to compare control
values from MβCD treated-groups. P < 0.05 was considered statistically significant.
3.4 Results
3.4.1 Expression of Caveolin in Pancreatic α-Cells
In the previous chapter, I observed the presence of caveolin-2 in non-β islet cells (Xia et al.,
2004), and this motivated me to examine the function of caveolin and lipid rafts in α-cells. I first
demonstrated the expression of caveolin-2 in the mouse clonal α-cell line αTC6 by Western blot
(Figure 13A), and in primary rat pancreatic α-cells by confocal immunofluorescence microscopy
(Figure 13B). In dispersed rat islet cells, caveolin-2 co-localized with glucagon in α-cells, and is
also present in β-cells. I did not observe caveolin-1 or muscle-specific caveolin-3 in either αTC6
or primary rat α-cells. Since caveolin-1 is required for caveolae biogenesis (Parton et al., 2006),
the existence of the subtype of lipid rafts caveolae remains to be further examined. I speculate
that the microdomains in alpha cells could be either planner lipid rafts lacking the typical
structure of caveolae or organized by flollilin, another structural protein of lipid rafts.
101
Figure 13. Expression of caveolin in αTC6 cells and rat primary α-cells
A, Western blot detection of caveolin-2 in αTC6 cells. Lysates from αTC6 cells (50 μg protein) and rat brain (25 μg protein) were loaded in each lane. B, Confocal microscopy of dispersed rat islet cells. Caveolin-2 (green) co-localized with glucagon (red), indicating the expression of caveolin-2 in α-cells. Note: β-cells (the larger non-glucagon staining cells) also express caveolin-2. Scale bars, 20 μm.
102
3.4.2 Expression of Ion Channels and SNARE Proteins in α-Cells
Because the characterization of α-cell ion channels has been based primarily by
electrophysiological measurements, I first directed my effort to determine the molecular
identities of α-cell voltage-gated K+ (KV) and Ca2+ (CaV) channels in αTC6 cells. Firstly,
quantitative PCR (qPCR) evaluation of αTC6 cells revealed high levels of KV2.1, KV3.3, KV3.4,
and KV6.3 mRNA (normalized to β-actin levels), with lower abundance of KV4.1 and KV4.3
(Figure 14A). Barely detectable levels of KV1 family of the channels were observed. Using
Western blot, I confirmed the qPCR data showing the presence of KV3.2, KV3.3, KV4.1 and
KV4.3 channel protein (Figure 14B). Interestingly, KV2.1 and KV3.4 protein was not detected by
Western blot analysis. One possibility is that either the protein expression level is not high
enough to be detected by Western blot or these two channel proteins in αTC6 cells were not
recognized by the antibodies used. Another reason could be due to translational inhibition of
these channels. Genomic and proteomic studies have recently indicated that there is a large
discrepancy between mRNA and protein levels (Tian et al., 2004). Lastly, I showed that both
CaV1.2 (L-type Ca2+ channels) and CaV2.2 (N-type Ca2+ channels) are expressed in these cells
(Figure 14C), as has been demonstrated in primary mouse α-cells (Gopel et al., 2004;Rorsman,
1988).
I detected the expression of SNARE proteins syntaxin 1A, SNAP-25 and VAMP-2 in the αTC6
cells, which is consistent with a later publication by McGirr and colleagues (McGirr et al., 2005).
In addition, I also found the presence of SNARE associated proteins, Munc-13-1 and Munc-
18a/b (Figure 14D). The expression of these exocytotic proteins implicates the important roles
they may play in α-cell exocytosis, as has been well established in β-cells (Wheeler et al., 1996).
103
Figure 14. Expression of KV and CaV channels, and SNARE proteins in αTC6 cells
A, Quantitative PCR (qPCR) results of KV channel mRNA levels in αTC6 cells normalized to message levels of β-actin. Results are the mean ± SEM from 4 – 9 experiments from 3 independent RNA samples. B-D, Western blot analysis of KV (B), CaV (C), and SNARE (D) protein expression in αTC6 cells (50 μg of cell lysate per lane). Rat brain (2.5-25 μg) was used as a positive control. Experiments in A were performed by Alpana Bhattacharjee.
104
3.4.3 KV4.1/4.3, CaV1.2 and SNARE Proteins Target to Lipid Rafts in α-Cells
Cholesterol-rich lipid rafts are characterized by their resistance to cold Triton X-100
solubilization. Discontinuous sucrose gradient ultra-centrifugation and Western blot were
performed to isolate and verify the presence of targeted proteins to Triton X-100 resistant
cholesterol-rich lipid rafts in αTC6 cells. Caveolin-2 migrated to the 5% and 30 % sucrose
interface (Figure 15A), confirming its existence in cholesterol-rich lipid raft domains of α-cells.
KV4.1/4.3, CaV1.2 and SNARE proteins syntaxin 1A, SNAP-25, and VAMP-2 were also targeted
to the cholesterol-rich lipid rafts (Figure 15B and Figure 16). In contrast, KV3.2, KV3.3, CaV2.2,
and the SNARE-associated proteins Munc-13-1 and Munc-18a/b are not associated with lipid
rafts (Figure 15B and Figure 16). To verify this membrane compartmentalization of ion channels
and SNARE proteins with lipid rafts, cells were preincubated at 37°C for 30 min with 10 mM
MβCD, a cyclic oligosaccharide that is highly specific for cholesterol removal from membranes
(Kilsdonk et al., 1995). Remarkably, MβCD treatment shifted KV4.1/4.3, CaV1.2, syntaxin 1A,
SNAP-25 and VAMP-2 out of the Triton X-100 resistant fraction (Figure 15 and Figure 16, lower
panels of each blot pair).
105
Figure 15. Targeting of ion channels to lipid rafts in αTC6 cells
αTC6 cells were lysed with 1% Triton X-100, and lipid rafts fractions were isolated from a 5%−40% of discontinuous sucrose gradient ultracentrifugation followed by Western blot for the detection of the targeted caveolin-2 (A), and ion channels (B). The interface between 5% and 30% sucrose denotes the Triton X-100 resistant lipid raft fractions. Western blots on cells treated with 10 mM MβCD for 30 min at 37°C are shown in the lower panels of each blot pair to confirm targeting to cholesterol-rich lipid rafts.
106
Figure 16. Targeting of SNARE proteins to lipid rafts in αTC6 cells
Cells were treated as described in Figure 15, and cell lysate was subjected to ultracentrifugation on a discontinuous sucrose gradient. Membranes were probed with antibodies for the different SNARE and SNARE-associated proteins. Confirmation of SNARE protein targeting to lipid rafts (with MβCD treatment) was performed as described in Figure 15.
107
3.4.4 Depletion of Membrane Cholesterol Causes Elevated Basal Glucagon Secretion and α-Cell Exocytosis
Depletion of cholesterol from the plasma membrane using MβCD was performed to determine
the roles of lipid rafts in regulating glucagon secretion from α-cells. MIP-GFP mouse islets were
treated with 10 mM MβCD for 30 min prior to measuring glucagon secretion under low glucose
conditions. Remarkably, MβCD pretreatment caused an elevated basal glucagon secretion (at 1
mM glucose) from 7.2 ± 0.8 pg/hr/µg protein to 15.0 ± 0.9 pg/hr⋅µg protein (n = 5; P < 0.01)
after MβCD pretreatment (Figure 17A). Given that high glucose stimulates insulin secretion,
which itself will modulate glucagon release (Ishihara et al., 2003;Xu et al., 2006), I did not
perform the experiments in the presence of high glucose. The elevated glucagon secretion by
MβCD was further investigated by a direct measurement of single α-cell exocytosis as changes
of cell membrane capacitance (ΔCm). The dispersed single mouse α-cells from MIP-GFP mice
were evoked by a train of eight 500-msec depolarizing pulses (1-Hz stimulation frequency) from
-70 to 0 mV, a protocol which reveals the initial size of primed immediately releasable pool (first
2 pulses) and extent of refilling of this pool from the reserve pool (third to eighth pulses)
(Olofsson et al., 2004). 10 mM MβCD significantly increased α-cell exocytosis of glucagon
granules from the readily releasable pool (first pulse) (n = 5 – 9, P < 0.05) (Figure 17B). The
capacitance increase from second to eighth pulse showed a trend for an increase, but was not
significantly different from control group, indicating that MβCD elevated basal glucagon
secretion only. Since ion channels and SNARE proteins are critical for regulating stimulus-
secretion coupling in endocrine cells, I therefore proceeded to examine if the α-cell ion channels
and SNARE proteins are modulated by lipid rafts to influence glucagon secretion.
108
Figure 17. Glucagon secretion and single-cell exocytosis measured from primary mouse α-cells
A, Glucagon secretion under low glucose (1 mM) is significantly enhanced after pretreatment of the mouse islets with 10 mM MβCD for 30 min (∗, P < 0.01 compared to control). B, Exocytosis of single α-cells from mouse pancreatic islets was measured by changes in membrane capacitance (Cm). Pretreatment of the dispersed islet cells with10 mM MβCD significantly increased exocytosis at the first pulse (*, P < 0.05 compared to control). Yuk-Man Leung helped with B.
109
3.4.5 Cholesterol Depletion Inhibits KV4 Current Amplitude but not CaV Currents
Since KV4.1/4.3 and CaV1.2 channels are associated with lipid rafts, I next examined if the
depletion of membrane cholesterol with MβCD affected the properties of KV4.1/4.3 and CaV1.2
channels in MIP-GFP mouse α-cells. Whole-cell recordings revealed robust KV currents from
control α-cells, displaying both inactivating TEA-insensitive (A-type) and non-inactivating
(delayed rectifying) TEA-sensitive KV currents (Figure 18A). Depletion of membrane cholesterol
from α-cells resulted in a disappearance of the A-type KV currents, while the delayed rectifying
KV currents were not affected (Figure 18B). Current-voltage relationship showed a significant
reduction in peak outward KV currents after cholesterol depletion with MβCD at all voltages
between -60 and +60 mV (n = 6, P < 0.05) compared to control group (Figure 18C). To verify
whether the decreased A-type KV current amplitude was associated with the elevated glucagon
secretion, I tested the effects of heteropodotoxin, a highly specific toxin blocker of KV4 family
channels (Sanguinetti et al., 1997). However, using this toxin (500 nM) on isolated mouse islets,
I observed a reduction in static glucagon release by 47% (n = 5, P < 0.05). This is similar to the
findings with the non-selective A-type K+ channel blocker, 4-aminopyridine, which decreased
glucagon secretion from mouse islets (Gromada et al., 2004). These results suggest the impaired
A-type KV current function does not contribute to the increased glucagon release of mouse islets
following cholesterol depletion.
110
Figure 18. Effects of MβCD on KV currents in isolated mouse primary α-cells
Whole-cell currents were measured from dispersed islets cells from MIP-GFP mice. Cells were held at –80 mV, and currents were elicited by 10-mV depolarizing steps (500-msec) from -80 to +60 mV. A, Whole-cell recordings from a control α-cell shows robust KV currents displaying both inactivating (A-type) and non-inactivating (delayed rectifying) KV currents. B, Incubation of islet cells with 10 mM MβCD for 30 min at 37ºC prior to whole-cell recordings resulted in the disappearance of the A-type KV currents. The insets of A and B show KV currents measured from -80 to -20 mV. No A-type currents are observed at the more negative step potentials when pretreated with MβCD. C, Current-voltage relationship of control and MβCD-treated α-cells. There is a significant reduction of peak KV currents from -60 to +60 mV, following cholesterol depletion. * P < 0.05 compared to MβCD group.
111
Glucagon secretion is highly dependent upon the activity of CaV and ATP-sensitive K+ (KATP)
channels. To determine if the elevated basal glucagon release following membrane cholesterol
depletion is associated with increased CaV channel activity and a possible change of KATP
channels, I also recorded CaV and KATP currents from MIP-GFP mouse α-cells. However, I was
unable to observe a significant change in CaV current amplitude following treatment with MβCD
(Figure 19A), or a change of KATP currents (Figure 19B). These results are similar to the
observations with β-cells (Chapter Two), suggesting changes in the surrounding lipid
environment do not influence CaV and KATP channel properties in either of these pancreatic islet
cells.
112
Figure 19. Cholesterol depletion has no effect on CaV or KATP currents in mouse α-cells
Whole-cell currents were measured from MIP-GFP mouse α-cells. A, whole-cell current-voltage relationship of CaV channels from control (n = 12) and MβCD-treated α-cells (n = 9). B, Current-voltage relationship of KATP channels (n = 3 for both control and MβCD-treated α-cells).
113
3.4.6 The integrity of SNAP-25 and Syntaxin 1A Clusters Depends on Membrane Cholesterol
The demonstration of the targeting of the SNARE proteins to α-cell lipid rafts prompted me to
further investigate a role that lipid rafts may play on regulating these membrane proteins. SNAP-
25 and syntaxin 1A are important plasma membrane proteins of SNARE protein exocytotic
machinery. Confocal immunofluorescence microscopy was performed to visualize SNAP-25 and
syntaxin 1A on the plasma membrane (Figure 20). αTC6 cell lines and dispersed pancreatic islet
cells from MIP-GFP mice were labeled with anti-SNAP-25 and anti-syntaxin 1A antibodies and
fluorescent secondary antibodies. Primary α-cells were distinguished from the green β-cells of
the dispersed MIP-GFP mouse islet cells and the smaller cell size. Both SNAP-25 and syntaxin
1A demonstrated punctate labeling on the plasma membrane. Similar clustering patterns have
been previously observed in β-cells (Ohara-Imaizumi et al., 2004a;Takahashi et al., 2004). To
examine the role of cholesterol on the integrity of SNAP-25 and syntaxin 1A membrane
distribution, cells were incubated with 10 mM MβCD at 37°C for 30 min. MβCD treatment led to
a significant change in the labeling patterns of SNAP-25 and syntaxin 1A in both αTC6 cells and
primary mouse islet cells. The punctate spots on the membranes became less apparent, leading to
a more uniform labeling pattern on the membranes. This might be caused by the break-up of the
existing SNAP-25 and syntaxin 1A clusters, as has been observed in pancreatic β-cells (Ohara-
Imaizumi et al., 2004a;Takahashi et al., 2004). These data, together with the Triton X-100
insolubility data, demonstrate that both SNAP-25 and syntaxin 1A were targeted to lipid rafts,
and dissociation of SNARE protein clusters on the plasma membranes may contribute in part to
the elevated glucagon secretion. This is consistent with the observation from pancreatic β-cells
(Takahashi et al., 2004) as well as PC12 cells (Salaun et al., 2005b;Salaun et al., 2005a), where
114
cholesterol depletion or decreased lipid raft association of SNAP-25 have been shown to increase
exocytosis.
115
Figure 20. Integrity of SNAP-25 and syntaxin 1A clusters depends on cholesterol of plasma membranes
Confocal immunofluorescence microscopy shows the clustering (punctate labeling) of SNAP-25 (A) and syntaxin 1A (B) on the plasma membranes. αTC6 cell lines and dispersed pancreatic islet cells from MIP-GFP mice were labeled with anti-SNAP-25 or anti-syntaxin 1A antibodies, followed by the antibodies labeled with FITC (green, for αTC6 cells) or with TRITC (red, for primary mouse islet cells). Treatment of the cells with 10 mM MβCD led to significant change in the labeling patterns of both SNAP-25 and syntaxin 1A in both αTC6 cells (top panels of A and B) and primary mouse α-cells (lower panels of A and B). Scale bar, 10 μM.
116
3.5 Discussion
3.5.1 KV and CaV Channels in α-Cells
The mechanism underlying glucose-dependent α-cell stimulus-secretion coupling has not been
fully elucidated, and most of the data on α-cell ion channels have been based on
electrophysiological characterization. I focused my attention on the expression of KV and CaV
channels, and how changes in membrane cholesterol regulate the function of these channels and
impact on glucagon secretion. KV channels play an important role in regulating stimulus-
secretion coupling in α-cells (Barg et al., 2000;Gopel et al., 2000b;Gromada et al., 2004).
Whereas two types of KV currents, A-type TEA-resistant transient KV currents and TEA-
sensitive delayed rectifier outward KV currents, have been measured (Barg et al., 2000;Gopel et
al., 2000b;Gromada et al., 2004), the precise identities of these KV channels in α-cells have not
been elucidated. Using Western blot, I detected the protein expression of KV4.1 and KV4.3 in
αTC6 cells, suggesting possible heterotetramerization of these channel subunits. This is
consistent with the immunocytochemical identification of KV4.3 in mouse pancreatic α-cells
(Gopel et al., 2000a). I therefore speculate that KV4 subunits are the primary carrier of A-type
KV currents in α-cells. I further show KV3.2 and KV3.3 to be the major KV isoforms contributing
to the delayed rectifying KV currents in mouse α-cells. The delayed rectifying KV currents in α-
cells are highly sensitive to TEA blockade (IC50 = 0.25 ± 0.10 mM, n = 4). Such high TEA
sensitivity is a characteristic of KV3 family channels compared to KV1 and KV2 channels.
I detected the protein expression of CaV1.2 (L-type Ca2+ channels) and CaV2.2 (N-type Ca2+
channels) in α-cells, which is consistent with the electrophysiological characterization of Ca2+
currents in these cells (Barg et al., 2000;Barg, 2003;Gopel et al., 2004;Gromada et al., 1997). It
has been proposed glucagon secretion depends principally on Ca2+ influx through N-type CaV
117
channels (Gopel et al., 2004). L-type CaV channels can regulate glucagon secretion after
activation of protein kinase A (Gromada et al., 1997). Interestingly, I have determined the
selective targeting of CaV1.2 but not CaV2.2 to cholesterol-rich lipid rafts. Moreover, removal of
membrane cholesterol did not affect voltage-gated CaV currents. The difference in the membrane
localization of these CaV channel isoforms is not known. CaV2.2 channels are modulated by both
cholesterol and caveolin in neuroblastoma cells (Lundbaek et al., 1996;Toselli et al., 2005).
Furthermore, the closely related CaV2.1 channel is also associated with lipid rafts, but only in
synaptosomal membranes and not cell soma membranes (Taverna et al., 2004). Therefore, there
appears to be selective association of the CaV channel isoforms to cholesterol-rich domains in α-
cells. The importance of this selective membrane targeting remains to be determined.
3.5.2 Significance of Ion Channels and SNARE Proteins Targeting to Lipid Rafts
I demonstrated that the related channel subunit, KV4.1/4.3, targets to lipid rafts in α-cells.
Moreover, removal of membrane cholesterol has profound effects on KV4 channel function
resulting in the absence of KV4-associated currents (A-type currents). Similarly, Wong and
Schlichter reported that targeting of KV4.2 channels to lipid rafts in hippocampal neurons (Wong
& Schlichter, 2004). Changes in lipid composition or stiffness can have profound influences on
channel gating or amplitude (Lundbaek et al., 1996;Oliver et al., 2004). It is not known at this
time whether the changes in KV4 currents are due to a decrease in surface protein levels or
impaired channel activity. Additional studies are required to delineate the exact mechanisms by
which cholesterol modulates KV4 channels. Interestingly, my data indicated the reduction in KV4
A-type K+ currents caused by lipid raft disruption is not responsible for the observed increase in
glucagon release. More surprisingly, specific blockade of KV channels with heteropodatoxin
reduced glucagon secretion from MIP-GFP mouse islets. This is in contrast to the role of KV
118
channels in pancreatic β-cells, which enhance insulin secretion after genetic suppression or
pharmacological blockade (Macdonald et al., 2002b). These results suggest factors other than
KV4 channel activities have a greater contribution in regulating stimulus-secretion coupling of α-
cells.
I initially speculated that cholesterol-rich lipid rafts were the sites of exocytosis in β- and α-cells.
However, my present study on pancreatic α-cells, as well as the previous study on β-cells
(Chapter Two) (Xia et al., 2004), indicated that disruption of cholesterol by depleting cholesterol
from the plasma membrane caused elevated basal insulin and glucagon secretion and enhanced
single-cell exocytosis of both β- and α-cells. Those data suggested association of SNARE
proteins with lipid rafts could restrict them for an efficient exocytosis under basal conditions, and
removal of SNARE proteins from cholesterol-rich domains facilitates hormone secretion. This is
consistent with the recent observation in pancreatic β-cells and PC12 cells, where the decreased
association of SNAP-25 was thought to account for the enhanced exocytosis (Salaun et al.,
2005b;Salaun et al., 2005a;Takahashi et al., 2004).
In summary, I have identified the molecular isoforms of KV and CaV channels in pancreatic α-
cells, and showed for the first time that KV4.1/4.3 are targeted to lipid raft microdomains in
addition to CaV1.2 and SNARE proteins syntaxin 1A, SNAP-25 and VAMP-2. More importantly,
I demonstrated that membrane compartmentalization of SNAP-25 and syntaxin 1A with lipid
rafts play an important role in regulating the function of this SNARE proteins and the regulated
exocytosis of pancreatic α-cells. In this chapter and the previous chapter (Chapter Two), acute
membrane cholesterol depletion with MβCD was performed to study the role of cholesterol-rich
lipid rafts in pancreatic β- and α-cells. However, this chemical can only deplete cholesterol from
the plasma membrane since it is membrane impermeable. An approach of chronically inhibiting
119
endogenous cholesterol synthesis has been employed to further study the role of cellular
cholesterol and its homeostasis on regulating β-cell insulin secretion (next chapter).
120
4 Chapter Four: Essential Role of Endogenous Cholesterol in β-Cell Insulin Secretion
The following chapter was published online in Endocrinology from:
Xia F, Xie L, Mihic A, Gao X, Chen Y, Gaisano HY and Tsushima RG. Inhibition of cholesterol
biosynthesis impairs insulin secretion and voltage-gated calcium channel function in pancreatic
β-cells. Endocrinology Epub July 3, 2008
Xiaodong Gao helped in islet isolation. Contributions by other co-authors to the figures
presented are stated in the figure legends.
121
4.1 Abstract Insulin secretion from pancreatic β-cells is mediated by the opening of voltage-gated Ca2+
channels (CaV) and exocytosis of insulin dense core vesicles facilitated by the secretory SNARE
protein machinery. In the previous two chapters, I have characterized the association of ion
channels and SNARE proteins with lipid raft microdomains in the plasma membrane of β- and
α-cells and exocytosis in both cell types is sensitive to the acute removal of cholesterol from the
plasma membranes. However, less is known about the effect of chronic changes in endogenous
cholesterol and its biosynthesis in regulating β-cell stimulus-secretion coupling. In this chapter, I
present my examination on the effects of inhibiting endogenous β-cell cholesterol biosynthesis
by using the squalene epoxidase inhibitor, NB598. The expression of squalene epoxidase in
primary and clonal β-cells was confirmed by RT-PCR. Cholesterol reduction of 36 - 52% was
observed in MIN6 cells, mouse and human pancreatic islets after a 48 h incubation with 10 µM
NB598. A similar reduction in cholesterol was observed in the subcellular compartments of
MIN6 cells. I found that NB598 significantly inhibits both basal and glucose-stimulated insulin
secretion from mouse pancreatic islets. CaV channels were markedly inhibited by NB598. Rapid
photolytic release of intracellular caged Ca2+ and simultaneous measurements of the changes in
membrane capacitance revealed that NB598 also inhibited exocytosis independently from CaV
channels. The inhibitory effects of NB598 on insulin secretion and ion channels were reversed
by cholesterol repletion. Those observations indicated that endogenous cholesterol in pancreatic
β-cells plays a critical role in regulating insulin secretion. Dysregulation of cellular cholesterol
and its homeostasis may cause impairment in β-cell function, a possible pathogenesis leading to
the development of type 2 diabetes.
122
4.2 Introduction
Pancreatic β-cells secrete insulin in response to elevated glucose to maintain blood glucose
homeostasis. Defects in β-cell insulin secretion lead to hyperglycemia and development of type 2
diabetes. The distal events underling stimulus-secretion coupling of insulin secretion have been
well documented and are characterized by two major events (Rorsman & Renstrom, 2003). The
first involves changes in electrical activity of β-cell ion channels, and the second, the function of
exocytotic machinery regulated by the SNARE proteins.
Uptake of glucose by β-cells enhances mitochondrial oxidation and ATP production. The
elevation of ATP/ADP ratio closes ATP-sensitive K+ (KATP) channels, leading to membrane
depolarization, the opening voltage-gated Ca2+ (CaV) channels, and fusion of insulin-containing
secretory granules with the plasma membrane. Voltage-gated K+ (KV) channels play an
important role in repolarizing the membrane potential to suppress the entire process of glucose-
stimulated insulin secretion (Macdonald et al., 2001). In this sequential glucose-stimulated
insulin secretion, influx of Ca2+ through CaV channels and subsequent increase in intracellular
Ca2+ concentration ([Ca2+]i) causes interaction of SNARE proteins to initiate exocytosis (Barg et
al., 2001;Brunger, 2000;Li & Chin, 2003).
SNARE proteins play an essential role in the fusion of insulin granules with plasma membranes.
VAMP-2 is a SNARE protein located on donor vesicles (v-SNARE), whereas syntaxin 1A and
SNAP-25 are SNARE proteins located on target plasma membranes (t-SNARE). Based on the
current view, SNARE proteins facilitate exocytosis by binding v-SNARE proteins to their
cognate t-SNARE proteins, giving rise to a tight complex that fuses secretory granules to plasma
membranes (Bruns & Jahn, 2002;Weber et al., 1998). SNARE protein conformational changes
are believed to provide energy for membrane fusion. It is well established that glucose-
123
stimulated insulin secretion is characterized by a biphasic pattern consisting of a transient first
phase followed by a sustained second phase secretion (Curry et al., 1968). This is reflected by
the sequential release of distinct pools of insulin granules; a limited readily releasable pool (RRP)
and a larger reserve pool (RP), respectively (Neher, 1998;Rorsman et al., 2000). Granules from
the RRP can undergo exocytosis right after stimulation, whereas granules from the RP undergo
mobilization and/or priming to gain release competence, and both involve the formation of
SNARE complexes (Rettig & Neher, 2002;Xu et al., 1999). Type 2 diabetes from human
(Ostenson et al., 2006) and animal models (Zucker fa/fa and Goto-Kakizaki rats) (Chan et al.,
1999;Gaisano et al., 2002) manifest a reduced expression of SNARE proteins, which is partially
accountable for the reduction of first-phase insulin secretion (Ohara-Imaizumi et al., 2004b).
Constituting about 20% of the total membrane lipid, cholesterol is involved in several subcellular
functions, such as influencing the thickness and fluidity of membranes and insulating membranes
(Haines, 2001;Ohvo-Rekila et al., 2002). Cholesterol is tightly packed with sphingolipids to form
specific membrane microdomains termed lipid rafts (Inokuchi, 2006;Michel & Bakovic, 2007).
Numerous membrane proteins are found to be associated with lipid rafts, in which the normal
function of targeted proteins is regulated. Caveolins are constituent proteins of lipid rafts (Parton,
2003). In the previous two chapters, I have demonstrated that ion channels (CaV1.2, KV2.1) and
SNARE proteins (syntaxin 1A, SNAP-25 and VAMP-2) are targeted to these cholesterol-rich
lipid raft microdomains in both pancreatic β- and α-cells (Xia et al., 2004;Xia et al., 2007).
Acute depletion of cholesterol from the plasma membrane with methyl-β-cyclodextrin (MβCD)
modifies KV channel function and membrane distribution of SNARE proteins, resulting in
changes in insulin and glucagon secretion. However, less is known about the role of endogenous
cholesterol on β-cell function. Squalene epoxidase (a flavoprotein mono-oxidase located on the
124
endoplasmic reticulum) is the second enzyme in the committed cholesterol biosynthesis pathway
(Chugh et al., 2003). In this chapter, I demonstrated that the squalene epoxidase inhibitor,
NB598, significantly inhibits endogenous cholesterol biosynthesis, resulting in impaired β-cell
insulin secretion. Furthermore, I demonstrated that the mediators of this effect involve the
inhibition of CaV channels and the impairment of the exocytotic machinery.
4.3 Materials and Methods
4.3.1 Cell Culture
Mouse MIN6 cells (kindly provided by S. Seino, Chiba University, Japan) were grown in
monolayer and maintained in Dulbecco’s modified Eagle’s medium (DMEM, Sigma, Oakville, ON)
containing 25 mM glucose and supplemented with 10% fetal bovine serum, 100 units/ml
penicillin, 100 μg/ml streptomycin, 2 mM L-glutamine, and 0.05 mM 2-mercaptoethanol at 37°C
in a humidified atmosphere (5% CO2). Cells were passaged every 4-5 days at 80% confluence.
4.3.2 Pancreatic Islet Isolation and Dispersion
Mouse pancreatic islets from MIP-GFP-transgenic mice (kindly provided by Dr. M. Hara,
University of Chicago, USA) were isolated by collagenase digestion as described previously
(Xia et al., 2004). Human islets were isolated (Shapiro et al., 2000) and kindly supplied by Dr.
Jonathan Lakey (JDRF Human Islet Distribution Program, University of Alberta, AB). Upon
arrival, islets were immediately hand-picked. For electrophysiological studies, islets were
dispersed into single cells with 0.25% trypsin in Ca2+- and Mg2+-free Hanks’s Balanced Salt
Solution (Invitrogen, Burlington, ON), placed onto coverslips, and cultured overnight prior to
commencement of patch clamp experiments. Both intact islets and dispersed islet cells were
cultured in Roswell Park Memorial Institute (RPMI 1640, Sigma) media containing 11 mM
glucose supplemented with 10% fetal bovine serum, 0.25% HEPES, 100 units/ml penicillin and
125
100 µg/ml streptomycin. The cultured islet cells were used within 3 days. Mice were maintained
in the pathogen-free animal facility at the University of Toronto and all experiments were
approved by the University of Toronto Animal Care Committee, and conducted in accord with
accepted standards of humane animal care.
4.3.3 RNA Preparation and RT-PCR
Total RNA was isolated from cultured INS-1 and MIN6 cells and the pancreatic islets from rat,
mouse and human using Tri Reagent (Sigma) following the manufacturer’s protocol. Subsequent
DNase I (Ambion, Austin, TX, USA) treatment was performed to remove any residual DNA
contamination. One µg of isolated RNA was reverse-transcribed using Omniscript RT Kit
(QIAGEN, Mississauga, ON) according to the manufacturer’s instructions. PCR was performed
using Hot Start Taq DNA polymerase (Fermentas, Burlington, ON) with the primer pair
targeting the squalene epoxidase gene (forward: 5’-AGCTATGGCAGAGCCCAAT-3’; reverse:
5’-TGGTAGATGAGAACTGGACT-3’). PCR protocol employed was as follows: heat
activation of polymerase at 94°C for 5 min, followed by 35 cycles of: 94°C for 30-sec, 53°C for
30-sec and 72°C for 60-sec. The amplified DNA from squalene epoxidase mRNA transcripts
was visualized as a 280bp band in a 2% agarose gel.
4.3.4 Subcellular Fractionation of Plasma Membranes, Endoplasmic Reticulum, and Insulin Secretory Granules
About 4 × 108 MIN6 cells were cultured in four 100mm dishes for 48 h at 37°C in the culture
medium supplemented with 10% delipidated FBS (Cocalico Biological Inc, Reamstown, PA), in
the absence or presence of 10 µM NB598. The cells were washed once with cold PBS, and
harvested by centrifugation at 2500 rpm for 10 min. They were then suspended in 5 ml of
fractionation buffers: 50 mM MES, 250 mM sucrose, pH7.2 for plasma membrane (PM) and
126
endoplasmic reticulum (ER); 10 mM MOPS-Tris, 270 mM sucrose, pH 6.8 for insulin secretory
granules (SG). Homogenizations were performed following the method of Brunner et al
(Brunner et al., 2007). Briefly, cells were passed through a 21-gauge needle for three times
followed by another three times through a 25-gauge needle. The supernatant was collected after
centrifugation at 1000g for 5 min. The remaining pellet was homogenized in 5 ml of the
fractionation buffer by three strokes through a 21-gauge needle followed by five strokes through
a 25-gauge needle. After centrifugation at 1000g for 5 min, the supernatant was collected and
pooled with the first one. Ten ml of pooled supernatant was centrifuged at 1000g for 10 min to
obtain the postnuclear supernatant (PNS).
Fractionations for plasma membranes (PM) and endoplasmic reticulum (ER) were performed by
sucrose density gradient ultracentrifugation (Ramanadham et al., 1993). Five ml of PNS was
centrifuged at 20,000g for 20 min with Beckman MLS-50 rotor to generate supernatant and
pellet (P1). The resulting supernatant was transferred to a centrifuge tube and centrifuged at
150,000g for 90 min to yield a pellet, which is enriched in ER (the supernatant is the cytosol).
The pellet was suspended with 100 μl of PBS and used for protein assay and cholesterol
extraction. The pellet from the first ultracentrifugation (P1) was suspended with 1ml of 10mM
MES with 1 mM EGTA and homogenized by passing through a 25-gauge needle for 5 times.
The resulting homogenate was loaded on a discontinuous sucrose gradient containing 1ml each
of sucrose at densities of 1.14, l.16, l.18, and 1.20. Centrifugation was performed at 150,000g for
90 min, and the bands above the sucrose density of 1.14 and 1.16 are enriched in PM (the bands
above the density of 1.18 and 1.20 are enriched in mitochondria and insulin granules). The two
PM-enriched bands (0.5ml each) were combined and suspended in 4 ml of 10 mM MES with 1
127
mM EGTA, and centrifuged at 150,000g for 60 min to remove sucrose. The PM pellet was
suspended in 100μl PBS, and used for protein assay and cholesterol extraction.
Fractionation of insulin secretory granules (SG) was performed based on the method established
by Brunnert et al (Brunner et al., 2007). The PNS prepared above for granule isolation was
centrifuged at 24,700g for 25 min. The resulting pellet was suspended in 0.4 ml fractionation
buffer and homogenized by passing through a 25-gauge needle for 5 times. The homogenate was
then loaded on discontinuous Histodenz (Sigma) gradient containing 23.4, 8.8, and 4.4%
Histodenz, and centrifuged at 107,000g for 75minutes. The Histodenz-enriched insulin granules
(the layer between 8.8% and 23.4%) were collected and the fractionation buffer was added to 2
ml and loaded on 27% Percoll solution (GE Healthcare, Baie d'Urfe, Quebec, Canada). After
centrifugation at 35,000g for 45 min, the Percoll-enriched SG (bottom fraction) was collected
and washed for 2 times with fractionation buffer at 24,700g for 20 min. After a second wash, 100
μl of the fractionation buffer was left on the insulin granule fraction, which was used for protein
assay and cholesterol extraction.
4.3.5 Cholesterol Content Assay
MIN6 cells (5 × 105) or 20 pancreatic islets from mouse or human were cultured for 48 h at 37°C
in the relative culture media supplemented with 10% delipidated FBS, in the absence or presence
of 10 µM cholesterol biosynthesis inhibitor NB598 (Sigma). Cells and islets were collected and
washed with PBS. Cholesterol was extracted by adding 50 µl of 2:1 chloroform-methanol
mixture, followed by 100 µl of PBS. To extract cholesterol from subcellular fractions, 50 μl of
2:1 chloroform-methanol mixture was added to different compartments. The top water phase was
removed after spinning the samples for 3 min at 10,000 rpm. The cholesterol sample was dried
with a DNA Speed Vac (Savant Instruments Inc, Farmingdale, NY, USA), and dissolved in 10 –
128
40 µl of immunoprecipitation buffer containing (in mM) 150 NaCl, 20 Tris-HCl, 5 MgSO4, 1
EDTA, 1 EGTA, and 1% triton X-100. Cholesterol content was measured using a fluorescence
assay kit (Cayman Chemical Company, Ann Arbor, MI, USA), following the manufacturer’s
instructions.
4.3.6 Insulin Secretion Assay
Krebs-Ringer bicarbonate (KRB) buffer containing (in mM) 129 NaCl, 5 NaHCO3, 4.8 KCl, 1.2
KH2PO4, 2.5 CaCl2, 2.4 MgSO4, 10 HEPES and 0.1% BSA was used for insulin secretion assay
from mouse pancreatic islets. The isolated islets were cultured for 48 h at 37 °C in the islet
culture medium supplemented with 10% delipidated FBS, in the absence or presence of different
doses of NB598. Three h prior to the secretion assay, the glucose concentration in the culture
medium was changed to 2.8 mM to recover the islets to a basal condition. For cholesterol
repletion experiments, the 10 μM NB598-treated islets were incubated for 1 h at 37°C with 10
mM soluble cholesterol (Sigma) in culture medium (with 2.8 mM glucose).15-30 islets were
washed once with KRB and preincubated for 30 min in 1 ml of KRB supplemented with 1 mM
glucose. The islets were then incubated for 1 h with 1 ml of fresh KRB supplemented with 1 mM
glucose, and the supernatants collected for the assay of basal insulin secretion. One ml KRB
supplemented with 16.7 mM glucose was changed to incubate the islets for 1 h at 37°C, and the
supernatants collected for the assay of glucose-stimulated insulin secretion. The islets were
washed with ice-cold PBS and lysed with 1 ml of 75% ethanol / 0.03 N HCl, and the tissue
lysates were kept for the determination of total insulin concentration. All samples were kept at –
20°C until assayed for insulin using a radioimmunoassay (RIA) kit (Millipore Corporation, St.
Charles, MO, USA), and values for released insulin in the supernatants were normalized to total
islet insulin.
129
4.3.7 Electron Microscopy
The isolated islets from MIP-GFP mice were cultured for 48 h at 37 °C in islet culture medium
supplemented with 10% delipidated FBS, in the absence or presence of 10 µM NB598. They
were then fixed with a Karnovsky style fixative (4% paraformaldehyde + 2.5% glutaraldehyde in
a 0.1 M cacodylate buffer with 5 mM CaCl2, pH 6.8) for 1 h, postfixed with 1% osmium
tetroxide for 30 min, and treated with 2.5% uranyl acetate for 30 min. The islets were then
dehydrated using a graded series of ethanol, and infiltrated with epoxy 812 resins in polyethylene
capsules. A complete polymerization of the epoxy resin occurs for 48 h at 60°C. The solid epoxy
resin blocks containing the islet samples were sectioned on a Reichert Ultracut E microtome to
70 – 90 nm thickness and collected on 200 mesh copper grids. The sections were counterstained
for 15 – 20 min using saturated uranyl acetate, followed by Reynold’s lead citrate and then
examined and photographed in a Hitachi H7000 transmission electron microscope at an
accelerating voltage of 75 kV.
4.3.8 Electrophysiology
The dispersed islet cells were cultured for 48 h at 37°C in islet culture medium supplemented
with 10% delipidated FBS, in the absence or presence of different doses of NB598. Cholesterol
repletion experiments were performed by incubating the 10 μM NB598-treated islet cells for 1 h
at 37°C with 10 mM soluble cholesterol prior to patching. Pancreatic β-cells can be easily
recognized as being green due to the expression of GFP in MIP-GFP mice, which have been
recently characterized as possessing normal physiological function (Leung et al., 2005a). Single β-
cells were voltage clamped in the whole-cell configuration using an EPC-10 amplifier and Pulse
software (HEKA Electronik, Lambrecht, Germany). Patch electrodes were fabricated from 1.5
mm thin-walled borosilicate glass and polished to a tip resistance of 3-4 MΩ when filled with
130
intracellular solution. For the measurement of CaV currents, pipettes were filled with (in mM):
120 CsCl, 20 tetraethylammonium (TEA) chloride, 5 EGTA, 5 MgATP, 1 MgCl2 and 10 HEPES
(pH 7.2, adjusted with CsOH). The external solution for CaV currents comprised of (in mM): 100
NaCl, 20 BaCl2, 20 TEA, 4 CsCl, 1 MgCl2, 5 D-glucose and 10 HEPES (pH 7.4, adjusted with
NaOH). TEA was used to block KV currents. The pipette solution for KV current measurements
contained (in mM): 140 KCl, 1 MgCl2, 5 EGTA, 5 MgATP and 10 HEPES (pH 7.2, adjusted
with KOH). This pipette solution was also used for KATP current measurement while MgATP
was reduced to 0.1 mM. The bath solution for KV current measurements consisted of (in mM):
140 NaCl, 4 KCl, 2 CaCl2, 1 MgCl2, 5 D-glucose and 10 HEPES (pH 7.4, adjusted with NaOH).
TEA-chloride (20mM) was included when measuring KATP current. Current recordings were
performed at room temperature (~22°C), and normalized to cell capacitance. CaV currents were
triggered by depolarizing voltage pulses (–70 mV to +70 mV, 500-msec) with membrane
potential held at –80 mV. To elicit KV current, cells were held at –80 mV and depolarized from –
80 mV to +60 mV in 10 mV increments using 500-msec step pulses. To measure KATP current,
cells were held at –80 mV and stimulated by a –140 mV hyperpolarizing voltage step (500-msec)
every 10 sec. Once KATP currents reached maximum, the cell was subjected to a series of voltage
pulses from –140 to –20 mV (500-msec) at 20 mV increments to obtain the current-voltage
relationship.
4.3.9 Photolysis of Caged Ca2+ and Cm Measurement
Patch electrodes were pulled from 1.5-mm thin-walled borosilicate glass, coated close to the tip
with orthodontic wax (Butler, Guelph, ON), and polished to a tip resistance of 2-4 MΩ when
filled with intracellular solution. Standard bath solution for the experiments contained (in mM)
138 NaCl, 5.6 KCl, 1.2 MgCl2, 2.6 CaCl2, 5 D-glucose, 5 HEPES (pH 7.4, adjusted with NaOH).
Intracellular solution for flash experiments contained (in mM) 112 Cs-Glutamate, 5 NP-EGTA,
131
3.7 CaCl2, 2 Mg-ATP, 0.3 Na2-GTP and 0.2 fura-6F (pH 7.2, adjusted with CsOH). NP-EGTA
and fura-6F were purchased from Molecular Probes (Invitrogen, Burlington, ON). Cm was
measured using an EPC-10 patch-clamp amplifier (HEKA, Lambrecht, Germany) controlled by
the lock-in module of PULSE software. The capacitance traces were imported to IGOR Pro
software (WaveMetrics, Lake Oswego, OR, USA) for analysis. Flashes of ultraviolet light and
fluorescence-excitation light were generated as described previously (Xu et al., 1998). In the
flash experiments, exocytosis was elicited by photorelease of caged Ca2+ preloaded into the cell
via the patch pipette. [Ca2+]i was measured with the Ca2+ indicator dyes fura-6F. [Ca2+]i was
determined from the ratio (R) of the fluorescence signals excited at the two wavelengths
(340/380nm), following the equation (Grynkiewicz et al., 1985): [Ca2+]i = Keff * (R-Rmin) / (Rmax-
R), where Keff, Rmin and Rmax are constants obtained from intracellular calibration as previously
described (Xu et al., 1998).
4.3.10 Immunoblotting
Western blot was performed to detect the changes of protein expression of ion channels and
SNARE proteins, and lipid raft structure protein caveolins. MIN6 cells were cultured without
and with 10 µM NB598 for 48 h and cell lysates were subjected to SDS-PAGE and transferred to
polyvinylidene difluoride-plus membranes (Fisher Scientific Ltd, Nepean, ON). Membranes
were probed with the indicated primary antibodies; anti-CaV1.2, and KV2.1 from Alomone
Laboratories (Jerusalem, Israel), anti-syntaxin 1A and SNAP-25 (Sigma), anti-VAMP-2
generated as described previously (Wheeler et al., 1996), anti-Munc-13-1 was kindly provided to
us by Dr. N. Brose (Max-Planck-Institut für Experimentelle Medizin, Göttingen, Germany), and
anti-caveolin-1 and caveolin-2 from BD Biosciences (Mississauga, ON). The bound primary
antibodies were detected with the appropriate peroxidase-conjugated secondary anti-mouse or
anti-rabbit antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA, USA), and then
132
visualized by chemiluminescence (ECL-Plus, GE Healthcare, Mississauga, ON) and exposure to
X-ray films (Eastman Kodak Co, Rochester, NY, USA).
4.3.11 Statistical Analysis
Data points represent mean ± SEM. An unpaired Student’s t-test or a one-way ANOVA followed
by a Student-Newman-Keuls test was used to compare control values from NB598 treated-
groups. P < 0.05 was used to denote statistical significance.
4.4 Results
4.4.1 Inhibition of Squalene Epoxidase Significantly Decreases Endogenous Cholesterol Levels in β-Cells
Cholesterol biosynthesis is initiated from the reduction of 3-hydroxy-3-methylglutaryl coenzyme
A (HMG CoA), undergoing over 30 steps until the final cholesterol product. HMG CoA
reductase is the target for the inhibition of cholesterol synthesis by the clinically used statins.
However, inhibition of this enzyme has numerous side effects due to the blockade of secondary
synthetic pathways upstream from cholesterol biosynthesis (Chugh et al., 2003). Squalene
epoxidase is the second enzyme in the committed sterol biosynthesis, and inhibition of this
enzyme only affects cholesterol synthesis. To confirm the cholesterol synthesis pathway in
pancreatic β-cells, I first determined the expression of squalene epoxidase. RT-PCR detected the
mRNA transcripts of this enzyme in pancreatic islets from rat, mouse and human, as well as the
clonal INS-1 and MIN6 β-cells (Figure 21A). The squalene epoxidase inhibitor, NB598, was
used to reduce endogenous cholesterol biosynthesis in β-cells (Horie et al., 1990). The inhibition
efficiency of this compound on cholesterol biosynthesis was then examined in β-cells.
Delipidated FBS was used for this and subsequent protocol instead of normal FBS in order to
prevent cholesterol uptake from the culture medium. Incubation with 10 µM NB598 for 48 h
133
caused a 36 ± 7% reduction in total cholesterol level of MIN6 cells (n = 6, P < 0.01). A similar
reduction in total cholesterol content in mouse and human islets was observed; 40 ± 16% (n = 4,
P < 0.05) and 52 ± 1% (n = 4, P < 0.01), respectively (Figure 21B). To further examine the
inhibitory effect of NB598 on cholesterol levels in different cellular compartments, I isolated
plasma membranes (PM), endoplasmic reticulum (ER), and insulin secretory granules (SG) from
MIN6 cells. NB598 caused a significant decrease in cholesterol by 49 ± 2%, 46 ± 7%, and 48 ±
2% from PM, ER, and SG respectively (n = 3, P < 0.05) (Figure 21C). This demonstrated
comparable reduction in cholesterol reduction throughout the cell.
134
Figure 21. Inhibition of squalene epoxidase significantly decreases endogenous cholesterol levels in β-cells
A, RT-PCR detected the mRNA transcripts of the committed cholesterol biosynthesis enzyme squalene epoxidase in INS-1 and Min6 β-cells, as well as in pancreatic islets from rat, mouse and human. Lower panel shows the GAPDH internal loading control. B, MIN6 cells, mouse and human islets were cultured with and without 10 µM NB598 in delipidated FBS medium for 48 h, and total cholesterol was extracted with chloroform-methanol and measured using a fluorescence assay kit. Squalene epoxidase inhibitor NB598 significantly decreased the cholesterol levels from MIN6 cells, mouse islets and human islets (*, P < 0.05, **, P < 0.01 compared to controls). C) Cholesterol levels of plasma membranes, endoplasmic reticulum (ER) and insulin secretory granules from MIN6 cells. Incubation of the cells with 10 µM NB598 for 48 h caused a significant decrease in cholesterol levels in the respective subcellular compartments (*, P < 0.05 compared to controls).
135
4.4.2 Inhibition of Cholesterol Biosynthesis Perturbs Insulin Secretion of Mouse Islets
The effect of inhibiting endogenous cholesterol on β-cell function was first examined by
glucose-stimulated insulin secretion of mouse islets. Pancreatic islets isolated from MIP-GFP
mice were incubated for 48 h with and without NB598. Prior to all experiments, pancreatic islets
or dispersed islet cells were washed thoroughly to minimize any possible direct effects of the
compound. NB598 was found to dose-dependently inhibit insulin secretion under both basal (1
mM glucose) and glucose-stimulated (16.7 mM glucose) conditions (Figure 22A). NB598 (2 µM
and 10 µM) caused reductions in basal insulin secretion by 36% (n = 9, P < 0.01) and 51% (n = 9,
P < 0.001), respectively, compared to controls. The glucose-stimulated insulin secretion was
reduced by 34% (n = 9, P < 0.01) and 75% (n = 9, P < 0.001) under the same concentrations of
NB598, respectively. To preclude the possible direct effect of NB598 on insulin synthesis, I also
measured the total insulin content of pancreatic islets. NB598 at all doses used for the above
insulin secretion studies did not cause any change in the total insulin content of the islets (Figure
22B). In order to examine the specificity of NB598 on insulin secretion, I added back cholesterol
to the NB598-treated cells by incubating them with 10 mM soluble cholesterol at 37°C for 1 h
(Hao et al., 2007). Insulin secretion at low glucose condition was fully restored by cholesterol
repletion, while glucose-stimulated insulin secretion was restored by 57% (n = 6, P < 0.01)
compared to control (n = 3) (Figure 22C).
136
Figure 22. Inhibition of cholesterol synthesis perturbs insulin secretion of mouse islets
Pancreatic islets isolated from MIP-GFP mice were incubated for 48 h without and with increasing doses of squalene epoxidase inhibitor NB598 in culture medium supplemented with delipidated FBS. Basal insulin secretion (1 mM glucose) and glucose-stimulated insulin secretion (16.7 mM glucose) were measured. A, NB598 dose-dependently inhibits insulin secretion from mouse islets under both basal and high glucose conditions (*, P < 0.01; **, P < 0.001 compared to controls). B, Total insulin of mouse islets was measured from the same samples corresponding to A. NB598 does not cause a significant change in total insulin level. C, Insulin secretion measured in mouse islets incubated without (control) or with 10 μM NB 598 alone (NB) or following 1 h incubation with 10 mM soluble cholesterol (NB+Chol). Cholesterol overloading fully restored basal insulin secretion at 1 mM glucose, and partially restored glucose-stimulated insulin secretion (*, P < 0.05; **P < 0.01).
137
To study the ultrastructure of insulin secretory granules, electron microscopic analysis was
performed on mouse islets cultured for 48 h without and with 10 μM NB598. No gross change in
insulin granule size or density was observed (Figure 23). These results suggest that the observed
impaired insulin secretion by NB598 is the result of a deficiency in cellular cholesterol unrelated
to changes in insulin content or granule morphology. Since ion channels and SNARE proteins
play an essential role on β-cell stimulus-secretion coupling, I next explored the possible changes
in channel activity and single-cell exocytosis after endogenous inhibition of cholesterol
biosynthesis by NB598.
138
Figure 23. Electron microscopic analysis of insulin granules
Pancreatic islets isolated from MIP-GFP mice were treated as Figure 22. Insulin granules from the islets incubated with 10 µM NB598 (right panel) displayed similar gross morphology and density as those from control islets (left panel). White scale bar, 500nm.
139
4.4.3 Inhibition of Cholesterol Biosynthesis Blocks CaV Channels
Opening of CaV channels and the subsequent increase in [Ca2+]i are critical for triggering insulin
secretion. In Chapter Two, I have previously detected the association of CaV channels with
cholesterol-rich lipid rafts in pancreatic β-cells (Xia et al., 2004). Therefore, impairment of
insulin secretion caused by the inhibition of cholesterol biosynthesis with NB598 could be
mediated by a dysfunction of CaV channels. Dispersed islet cells from MIP-GFP mice were
cultured with different concentrations of NB598 for 48 h, followed by repeated drug washout
before electrophysiological measurements were made. The β-cells were identified by the
expression of GFP. Consistent with the reduction in insulin secretion, NB598 caused a dose-
dependent decrease in CaV currents (Figure 24A and B). The peak CaV current amplitude
measured at +10 mV was –13.3 ± 1.0 pA/pF (n = 9) in control cells, –3.7 ± 1.2 pA/pF (n = 4, P <
0.001) and –2.1 ± 0.1 pA/pF (n = 10, P < 0.001) in 2 µM and 10 µM NB598 treated cells,
respectively. To preclude any possible direct effects of the drug on CaV channels, I added 10 μM
NB598 acutely into the bath solution and observed no effect on CaV currents. Furthermore,
cholesterol repletion experiments restored CaV current amplitude to 78% of control (n = 6),
which was not statistically different from control (Figure 24C). I speculate the resultant decrease
in CaV currents following cholesterol reduction is one of the primary mediators for the observed
inhibition of insulin secretion by NB598.
140
Figure 24. NB598 inhibits mouse β-cell CaV channels
Pancreatic islet cells isolated from MIP-GFP mice were incubated for 48 h without and with different doses of NB598 in culture medium supplemented with delipidated FBS. β-Cells were recognized by GFP marker. A, Representative traces showing Ca2+ currents triggered by a series of pulses (from -70 to +70 mV, 500-msec) from a holding potential of -80 mV in a control β-cell and a β-cell treated with 10 µM NB598, indicating a significant inhibition on CaV currents by 10 µM NB598. B, Current-voltage relationship of CaV channels under different concentrations of squalene epoxidase inhibitor NB598. 2 µM and 10 µM NB598 does-dependently inhibited CaV currents at depolarizing voltages from -40 mV to +50 mV (P < 0.001). C) Peak CaV currents at -10 mV for control and β-cells treated with 10 μM NB598 alone (NB) or following 1 h incubation with 10 mM soluble cholesterol (NB+Chol) prior to recording. Cholesterol repletion significantly restored the decreased CaV currents (*, P < 0.05; **P < 0.001). Anton Mihic helped with C.
141
4.4.4 NB598 Increases KV Channel Inactivation
KV channels regulate membrane potential repolarization and finely tune insulin secretion
(Macdonald et al., 2001). In Chapter Two, I have reported that KV2.1 channels are associated
with lipid raft domains in β-cells and the currents are regulated by the surrounding lipid
environment (Xia et al., 2004). To examine if chronic endogenous cholesterol inhibition exerts a
similar effect on KV channels, pancreatic β-cells from MIP-GFP mice were incubated with
NB598 for 48 h. β-Cells were held at –80 mV and whole cell KV currents were elicited following
depolarizations from –80 mV to +60 mV in 10 mV increments using 500-msec step pulses.
NB598 at concentrations up to 10 µM did not affect peak outward KV currents, but increased
current inactivation (Figure 25A). A longer (12-sec) depolarization at +70 mV was performed to
clearly display this inactivation effect on KV channels (Figure 25B). Increasing concentrations of
NB598 accelerated the inactivation rate of KV channels. Steady-state inactivation was measured
after a 5-sec conditioning depolarization from –120 mV to +20 mV followed by 500-msec test
steps at +60 mV. No hyperpolarizing shift in the steady-state inactivation curve was observed,
but the slope factor decreased from 15.4 ± 1.2 mV (control) to 9.2 ± 0.7 mV (10 µM NB598
treated cells; n = 4, P < 0.01) (Figure 25C). Furthermore, the relative amount of non-inactivating
currents was significantly different. Control cells displayed 45 ± 1% non-inactivating KV
currents at 0mV, whereas the cells cultured with 10 µM NB598 displayed only 11 ± 1% non-
inactivating KV currents (n = 4; P < 0.05) (Figure 25C). Cholesterol repletion fully restored the
inactivated KV currents (Figure 25B and C), confirming that the effect of NB598 on KV channels
was a result of reduced membrane cholesterol levels. Lastly, 10 µM NB598 did not change peak
KV current amplitude (Figure 25D) or the voltage dependence of KV channel activation (Figure
25E). Besides KV channels, 10 μM NB598 also decreased KATP current density at -140 mV by 57
± 4% (n = 7, P < 0.01) (Figure 26). However, I do not believe the changes in either KV or KATP
142
channels played a role on the reduced insulin release observed above, since it has been well
established that reductions in either KV or KATP currents enhances insulin secretion (Ashcroft,
2005;Macdonald et al., 2001;Macdonald et al., 2002b).
143
Figure 25. NB598 increases the steady-state inactivation of KV channels in mouse β-cells
Pancreatic β-cells from MIP-GFP mice were held at –80 mV and whole cell KV currents were measured following depolarization from –80 mV to +60 mV in 10 mV increments using 500-msec step pulses. A, Representative traces of KV currents from a control β-cell and a β-cell cultured for 48 h in the presence of 10 µM NB598, demonstrating that NB598 does not affect peak KV currents, but enhances current inactivation. B, Longer depolarizations (12-sec) at +70 mV were performed to display this inactivation effect. Increasing concentrations of NB598 accelerated the inactivation rate of KV channels. The effect of 10 µM NB598 treatment on KV current inactivation was fully reversed following 1 h cholesterol repletion with 10 mM soluble cholesterol (10 µM NB + Chol). C, Steady-state inactivation of KV channels was measured after 5-sec conditioning depolarization pulses at voltages from -120 mV to +20 mV. No left shift in the inactivation curve was observed, but the slope factors for all NB598 doses decreased (P < 0.01). The relative amount of non-inactivating current measured at 0 mV was also significantly decreased from cells cultured with NB598 (P < 0.05). The inactivation curve fully recovered after cholesterol repletion (10 µM NB + Chol). D, Current-voltage relationship of KV channels from control cells and NB598-treated cells indicates 10 µM NB598 does not change peak KV currents. E, Activation curves of KV channels show 10 µM NB598 does not change the voltage dependence of KV channel activation.
144
Figure 26. NB598 decreases the density of KATP currents
Pancreatic β-cells from MIP-GFP mice were held at -80 mV and stimulated by a –140 mV hyperpolarizing voltage step (500-msec) every 10 sec. Once KATP currents reached maximum, the cell was subject to a series of voltage pulses from -140 to -20 mV (500-msec) at 20 mV increments to obtain the current-voltage relationship. A, representative current traces of KATP channels from a control β-cell and a 10 µM NB598 treated β-cell indicate a significant inhibition in KATP current. B, Current voltage relationship of KATP channels shows 2 µM and 10 µM NB598 produced a dose–dependent decreased density of KATP currents.
145
4.4.5 Inhibition of Cholesterol Biosynthesis by NB598 Impairs β-Cell Exocytosis
The effect of cholesterol synthesis inhibition on β-cell exocytosis was next investigated. To
exclude the dependency of Ca2+ influx from Ca2+ channels, exocytosis was elicited by flash
photolysis of caged Ca2+ (NP-EGTA) (Neher, 1998). Exocytosis was monitored as an increase in
whole-cell membrane capacitance (Cm). In response to the step-like elevation in [Ca2+]i
generated by the uncaging of Ca2+ by flash photolysis, capacitance traces displayed a rapid,
burst-like increase within the first 0.5-sec after the flash followed by a slower sustained phase of
exocytosis. Changes in Cm typically consists of three components, which have been termed the
fast burst, slow burst and sustained components as previously reported (Voets et al., 1999;Xu et
al., 1999). The fast and slow burst components are generally interpreted as the fusion of docked
and primed vesicles from the rapidly and slowly releasable pools, respectively, whereas the
sustained component represents refilling of the releasable pools from a large depot pool of
vesicles (Sorensen, 2004). Flash photolysis of NP-EGTA induced a step-like homogenous
increase in [Ca2+]i from 200-300 nM to 5-10 µM. The averaged Cm traces were compared from
control and NB598-treated cells responding to similar step-like [Ca2+]i elevations (Figure 27).
The amplitude of the fast burst in NB598-treated cells was reduces from 282 ± 30 fF (control) to
212 ± 16 fF, but was not significantly different. However, there is a dramatic reduction in the
size of the slow burst component from 513 ± 42 fF (control, n = 13) to 158 ± 3 fF (P < 0.01) in
NB598-treated cells (n = 14). Furthermore, a significant decrease in the sustained component
was also observed. The amplitude of the sustained component from NB598-treated cells is 192 ±
27 fF vs. 365 ± 30 fF in control cells. These results suggest that inhibition of cholesterol
synthesis with NB598 markedly impaired β-cell exocytosis from both fusion vesicle pool and
refilling of releasable pool.
146
Figure 27. NB598 inhibits β-cell exocytosis independently on CaV channels
Exocytosis was elicited by flash photolysis and was monitored by whole-cell membrane capacitance measurement. 10 µM NB598 treatment powerfully reduced exocytosis from mouse pancreatic β-cells. A, Averaged [Ca2+]i and capacitance changes from control (black) and 10 µM NB598-treated (grey) cells. Arrow indicates the initial flash. Capacitance increase in the cells treated with 10 μM NB598 is significantly inhibited compared to control cells, indicating an inhibition of NB598 on β-cell exocytosis independently from CaV channels. B, Mean amplitudes of the exocytotic burst and sustained components from control (grey) and 10 µM NB598 treated (white) cells, respectively. The Cm response was fitted with a triple exponential function and the amplitudes of the two fast components were taken as the size of the fast burst and slow burst components, respectively. The slow component represents the sustained phase of secretion. NB598 inhibited both slow burst and sustained components of exocytosis, indicating the inhibition of cholesterol synthesis not only affects the release of docked and primed granules, but also affects the refilling of granules. *, P < 0.01 compared to controls. Li Xie helped with this experiment.
147
4.4.6 NB598 does not Affect Variability of MIN6 Cells
Since incubation of pancreatic islets with NB598 caused impairment not only of static insulin
secretion and single β-cell exocytosis, but also of ion channel function, it is critical to examine if
this drug could exert any toxic effect on cell viability. MIN6 cells were cultured for 48 h in
culture medium with 10 μM NB598 or 6 μM staurosporine, a protein kinase C inhibitor that
causes cell death. The cells were then stained with propidium iodide, a fluorescence dye that can
penetrates dying cells to stain nucleus. The cells cultured with 10 μM NB598 displayed similar
morphology as controls under DIC light microscope, and no fluorescence staining was observed,
whereas treatment of the cells with 6 μM staurosporine caused significant change on the cell
morphology and strong propidium iodide staining (Figure 28). These data indicate that NB598
does not affect the cell viability, supporting that its actions on insulin secretion and ion channel
functions were indeed through its cholesterol lowering effect.
148
Figure 28. NB598 treated-MIN6 cells display normal cell viability
Propidium iodide (PI) staining was performed on MIN6 cells cultured with 10 μM NB598 or 6 μM staurosporine (SP). Cells treated with NB598 display a similar morphology as control cells, and no PI fluorescence is observed. However, incubation of the cells with SP causes a significant change on cell morphology and strong PI fluorescence staining.
149
4.4.7 NB598 Selectively Inhibits the Expressions of Lipid Raft Structural Protein Caveolin-1
I found that inhibition of endogenous cholesterol causes a significant impairment in the function
of both CaV and KV channels and the exocytotic machinery in β-cells. I therefore explored
whether the effects of NB598 were caused by changes in protein expression of those
corresponding ion channels and SNARE proteins, as well as lipid raft structural protein caveolin.
MIN6 β-cells were cultured for 48 h in the absence and presence of 10 µM NB598, and protein
expression was determined by Western blot analysis. NB598 treatment did not have any
significant effect on the protein expression of the channel proteins CaV1.2 or KV2.1 (Figure 29A).
This compound also did not alter the expression of SNARE proteins syntaxin 1A, SNAP-25,
VAMP-2, and the SNARE-associated protein Munc-13-1 (Figure 29B). These data indicate that
the observed inhibition of NB598 on CaV channels and reduced β-cell exocytosis is not due to
the down-regulation of protein expression, but may be caused by altered interactions of ion
channels or SNARE proteins with the surrounding lipid environment. Surprisingly, NB598
selectively and dose-dependently suppressed the expression of lipid raft-associated protein
caveolin-1 but not cavolin-2 (Figure 30). It is interesting that inhibition of endogenous
cholesterol synthesis selectively blocks only one of the lipid raft structural proteins, caveolin-1.
Caveolin-1, has recently been shown to regulate β-cell insulin secretion (Nevins & Thurmond,
2006), therefore down-regulation of caveolin-1 could be another mediator for the inhibitory
effect of NB598 on insulin secretion. However, further investigations are warranted to delineate
the mechanism and action of the altered expression of caveolin-1.
150
Figure 29. NB598 does not cause any change in the protein expression of ion channels and SNARE proteins
MIN6 β-cells were cultured for 48 h without and with 10 µM NB598. Western blot was performed to detect the expression of specific ion channels and SNARE proteins. A, Inhibition of endogenous cholesterol synthesis with 10 µM NB598 does not affect the protein expression of CaV and KV channels. B, NB598 does not affect the expression of SNARE proteins syntaxin 1A, SNAP-25, VAMP-2, and the SNARE associated protein Munc-13-1.
151
Figure 30. Inhibition on endogenous cholesterol causes a down-regulation of caveolin-1 in β-cells
MIN6 cell lysate was prepared as Figure 29. A, Western blot indicates NB598 dose-dependently suppresses the expression of caveolin-1. The lower panel shows the densitometry normalized to β-actin (*, P < 0.001 compared to controls). B, NB598 does not affect the protein expression of cavolin-2.
152
4.5 Discussion
4.5.1 Chronic Cholesterol Biosynthesis Inhibition vs. Acute Cholesterol Depletion
Cholesterol is important in the organization of lipid bilayers, and disorders of cholesterol can
cause severe consequences (Maxfield & Tabas, 2005). The majority of the studies examining the
role of cholesterol-rich lipid rafts have been based on acute cholesterol depletion with MβCD, a
commonly used chemical that can effectively sequester cholesterol from the plasma membrane
(Christian et al., 1997). However, since MβCD is membrane impermeable, treatment of cells
with MβCD is expected to only deplete cholesterol and disrupt lipid rafts on the outer leaflet of
the plasma membrane. Alternatively, it has been suggested that cholesterol depletion with MβCD
may affect intracellular cholesterol stores due to the trafficking and efflux of cholesterol to the
plasma membrane (Hao et al., 2007). The short incubation (30 min) used in my previous study
may not have been long enough to cause an efficient depletion of intracellular cholesterol. The
present study illustrates that chronic inhibition of cholesterol biosynthesis reduces cholesterol at
the plasma membranes as well as the intracellularly endoplasmic reticulum (ER) and insulin
secretory granular membranes.
Cholesterol is synthesized in the endoplasmic reticulum (ER) and transported to the plasma
membranes via two pathways (Maxfield & Wustner, 2002). The major pathway is via energy-
dependent non-vesicular transport against a concentration gradient (Chang et al., 2006). About
20% of the de novo synthesized cholesterol is transported to the plasma membranes through
vesicular transport via the Golgi apparatus (Heino et al., 2000). Although this vesicular pathway
is not a major route of cholesterol export, some cholesterol exported from the ER may become
confined to lipid rafts before reaching the plasma membranes (Heino et al., 2000). Therefore, the
passage of cholesterol through the ER-Golgi apparatus might play an important role in raft-
153
dependent sorting of proteins in the trans-Golgi network (Simons & Ikonen, 1997;Helms &
Zurzolo, 2004). Inhibition of endogenous cholesterol biosynthesis may cause an inappropriate
sorting and functioning of the membrane proteins such as ion channels and SNARE proteins in
pancreatic β-cells, resulting in impaired insulin secretion.
I was initially surprised by my observations in this study, as they were in contrast to my previous
work (Xia et al., 2004), where I observed acute membrane cholesterol depletion with MβCD did
not affect CaV currents and caused an elevated basal insulin secretion (Chapter Two). I
concluded in the previous study that the enhanced insulin secretion could be partially mediated
by strong inhibition of the amplitude of KV currents. However, it is not unexpected that acute and
chronic manipulations in membrane cholesterol could elicit markedly different cellular changes.
Inhibiting cholesterol synthesis would affect membrane cholesterol, as well as cholesterol-
mediated processes. Cholesterol and cholesterol-interacting proteins (e.g. caveolin) regulate the
trafficking and targeting of proteins, including ion channels, to membrane rafts (Kong et al.,
2007;Pediconi et al., 2004) and are important in coordinating the assembly of calcium channels
with SNARE proteins in the exocytotic domains (Cho et al., 2007;Nevins & Thurmond, 2006).
Given these possible explanations, I was even more astonished that acute cholesterol repletion
restored much of the defects in CaV channel activity and insulin secretion. Therefore, further
investigations are warranted into determining the precise mechanisms mediating the alterations
in channel activity and exocytosis following chronic cholesterol depletion.
4.5.2 Roles of Endogenous Cholesterol in Regulating KV Channel Function
Inhibition of squalene epoxidase significantly increased the steady-state inactivation of KV
channels in β-cells, while not affecting current density or the voltage dependence of channel
154
activation. KV channel inactivation is described by a “ball-and-chain” model, a process by which
the N-terminal cytoplasmic domain of KVα or KVβ subunit occludes the inner open channel pore
(Zagotta et al., 1990) This cytoplasmic domain of KV channels was found to interact strongly
with membrane lipids. KV channels, as well as other ion channels, are regulated by the lipid
composition of plasma membranes (Hilgemann, 2004). Modulation of membrane lipids have
been shown to result in rapid inactivation (A-type currents) of non-inactivating KV channels, and
conversely, endow non-inactivating delayed rectifying properties to A-type KV currents (Oliver
et al., 2004). Inhibiting endogenous cholesterol biosynthesis could have profoundly altered the
membrane lipid composition, channel-lipid interaction, and the conformational changes of the
channel proteins, all of which could have contributed to the observed enhancement of KV
channel inactivation by NB598. The consequence of the enhanced inactivation of KV channels on
β-cell function remains to be further investigated. However, I speculate these effects do not
contribute to the observed inhibition on insulin secretion, since inhibition of KV channels are
known to enhance insulin secretion (Macdonald et al., 2001;Macdonald et al., 2002b).
4.5.3 Role of Endogenous Cholesterol on β-Cell Exocytotic Machinery
CaV channels play a critical role in the release of neurotransmitter and hormone, and have been
suggested to be an integral component of the exocytotic process (Mochida et al., 1996). Chronic
cholesterol synthesis inhibition markedly reduced CaV currents. The link between the inhibition
of cholesterol synthesis and the impairment in CaV channels is not clear. No effect of NB598 on
protein expression of CaV channels was observed. Therefore, the decreased CaV currents could
be caused by a possible inappropriate membrane localization of the CaV channels on the plasma
membrane or changes in the interactions of the different auxiliary CaV channel subunits.
155
Secondly, reduced membrane cholesterol may lead to conformational changes of the channel
protein due to disruption of the channel-lipid interaction as suggested with KV channels.
SNARE proteins constitute the core of exocytotic machinery in neuroendocrine cells. Recent
studies implicate that cholesterol-rich membrane rafts could play an important role in regulated
exocytosis through compartmentalizing SNARE proteins at defined sites on the plasma
membrane. I and others have previously shown that the SNARE proteins syntaxin1A, SNAP-25
and VAMP-2 are associated with cholesterol-rich membrane rafts in pancreatic β- and α-cells
(Xia et al., 2004;Xia et al., 2007;Ohara-Imaizumi et al., 2004a;Takahashi et al., 2004). The t-
SNAREs, syntaxin 1 and SNAP-25 were found both to cluster in plasma membranes of β-cells
and PC12 cells, and their integrity is dependent on membrane cholesterol (Chamberlain et al.,
2001;Lang et al., 2001;Ohara-Imaizumi et al., 2004a;Takahashi et al., 2004). Therefore,
cholesterol being a major constituent of membrane rafts could play an essential role in regulating
exocytosis through maintaining the function of exocytotic machinery. Single-cell membrane
capacitance measurement indicated that NB958 treatment impaired exocytosis independently
from the dysfunction of CaV channels. Cholesterol could regulate exocytosis through protein
accumulation or exclusion in the membrane raft domains, or reduce the energetic barrier for
vesicular-plasma membrane lipid fusion (Churchward et al., 2005).
In summary, I have demonstrated a critical role for endogenous cholesterol in the normal
function of pancreatic β-cells. Using NB598, a cholesterol biosynthesis inhibitor, I have found
there are two major roles that endogenous cholesterol may play in β-cell exocytosis. Firstly,
endogenous cholesterol maintains normal function of CaV channels. Secondly, cholesterol is
critical in the mobilization and fusion of insulin granules with plasma membranes. Dysregulation
156
of cellular cholesterol may cause impairment in β-cell function, a possible pathogenesis leading
to the development of type 2 diabetes.
157
5 Chapter Five: Summary, Discussion and Future Directions
158
5.1 Summary
Pancreatic β-cell insulin secretion and α-cell glucagon secretion are critically regulated by
excitatory machinery (i.e. KATP, CaV, and KV channels) and exocytotic machinery (i.e. SNAP-25,
syntaxin 1A, and VAMP-2). However, the mechanisms mediating the compartmentalization and
regulation of the excitatory and exocytotic machinery are fundamentally unknown. While the
elevated plasma levels of free fatty acids have been extensively studied and recognized as
lipotoxicity on β-cells in the development of type 2 diabetes, the roles of cholesterol (which is
often elevated in obese patients) and the cholesterol-rich lipid rafts in β-cell insulin secretion and
α-cell glucagon secretion had not been reported when I started my PhD studies.
I have detected the protein expression of lipid raft structural proteins caveolin-1/2 in
pancreatic β-cells, and caveolin-2 in α-cells, implicating the existence of lipid rafts in β- and
α-cells.
I detected the protein expression of potassium channels, KV3.2/3.3 and KV4.1/4.3, and
calcium channels CaV1.2 and CaV2.2 from αTC6 cells.
I found that αTC6 cells express the same set of SNARE proteins (syntaxin 1A, SNAP-25,
VAMP-2) and SNARE-associated proteins (Munc-13-1, Munc-18a/b) as that in pancreatic
β-cells.
Using discontinuous sucrose gradient ultracentrifugation and Western blot analysis, I found that
the potassium channels KV2.1 and calcium channels CaV1.2 are targeted to lipid rafts in HIT-
T15 β-cells.
Potassium channels KV4.1/4.3 and calcium channels CaV1.2 target to lipid raft microdomains
in αTC6 α-cells. SNARE proteins syntaxin 1A, SNAP-25, and VAMP-2 were found to be
targeted to lipid rafts in both β- and α-cells.
159
Using static hormone secretion assays and single cell membrane capacitance measurements, I
found that cholesterol depletion with MβCD caused a significant elevation of basal hormone
secretion of both pancreatic β- and α-cells.
Cholesterol depletion significantly inhibited the currents of KV channels in both β- and α-cells,
an effect that could have partially contributed to the elevated hormone secretion by MβCD.
Using confocal immunofluorescence microscopy, I found that treatment with MβCD led to a
redistribution of SNAP-25 and syntaxin 1A clusters in αTC6 cells and dispersed islet cells.
I therefore speculate that lipid rafts could participate in the regulated exocytosis through
associating and regulating SNAP-25 and syntaxin 1A.
To further explore the role of endogenous cholesterol in β-cell insulin secretion. I have used
the squalene epoxidase inhibitor, NB598, to inhibit endogenous cholesterol biosynthesis in
β-cells.
I detected strong expression of squalene epoxidase mRNA transcripts in pancreatic islets and
β-cell lines.
I found that NB598 caused a significant reduction in cholesterol levels from pancreatic islets
and MIN6 β-cells, as well as a reduction in cholesterol levels of cellular compartments from
MIN6 cells, indicating an efficient inhibition of NB598 on cholesterol synthesis.
Inhibition of cholesterol synthesis by NB598 dose-dependently impaired insulin secretion
from mouse islets under both basal and glucose-stimulated conditions, which can be partially
recovered by adding back cholesterol into the culture medium.
I found that NB598 dose-dependently inhibited CaV currents of isolated mouse β-cells,
which could be restored by cholesterol repletion as well. The decreased CaV currents could
be one of the major mediators for the observed inhibition on insulin secretion by NB598.
160
Single cell membrane capacitance measurement on mouse β-cells revealed that NB598 also
inhibited exocytosis independently from CaV channels.
I found that NB598 dose-dependently caused a down-regulation of the lipid raft constituent
protein caveolin-1, another possible contributing factor to the impaired insulin secretion.
The work presented in this thesis provided clear evidence that cholesterol-rich lipid rafts
play a critical role for the function of pancreatic ion channels and SNARE proteins to
regulate β- and α-cells stimulus-secretion coupling.
5.2 Discussion My PhD thesis has focused on the role of cholesterol-rich lipid rafts in stimulus-secretion
coupling of both pancreatic islet β- and α-cells. Cholesterol is a very important membrane
component and forms the basis of membrane lipid rafts, which is involved in many cellular
functions, such as signal transduction and release of neurotransmitter and hormone. However,
elevated blood cholesterol in obese individuals is harmful to human health, and is related to the
development of type 2 diabetes. Therefore, cholesterol homeostasis in pancreatic islet cells is
critical for maintaining normal function of both β- and α-cells, and manipulation of cholesterol
level could be an alternative way for a therapeutic intervention of type 2 diabetes. I have
addressed my studies by asking the following questions. Do cholesterol-rich lipid raft
microdomains exist in pancreatic β- and α-cells? Are the functions of the ion channels and the
SNARE proteins regulated by lipid rafts in β- and α-cells? How does manipulation of cellular
cholesterol affects the stimulus–secretion coupling of pancreatic β- and α-cells?
161
5.2.1 Characterization of Lipid Rafts and the Raft-Associated Proteins in Pancreatic β- and α-Cells
The idea of lipid rafts was established and a detergent extraction method was developed more
than a decade ago (Brown & Rose, 1992;Varma & Mayor, 1998;Simons & Ikonen, 1997). Since
then, considerable evidence has been accumulated to show that lipid rafts play an important role
in regulating the raft-associated membrane proteins in many cell types, such as endothelial cells,
muscle cells, and neuronal cells (Chamberlain et al., 2001;Lang et al., 2001;Maguy et al.,
2006;Rizzo et al., 1998). However, there was no report on the detection of lipid rafts in both
pancreatic β- and α-cells when I started my PhD studies. Therefore, I began my PhD project by
characterizing lipid rafts and the raft-associated membrane proteins in these two major groups of
islet cells for their role in regulating stimulus-secretion coupling of pancreatic β- and α-cells.
5.2.1.1 Identification of lipid rafts
Since caveolin proteins are constituent proteins of special types of lipid rafts, I therefore initiated
my studies of lipid rafts by detecting caveolin proteins in pancreatic β- and α-cells. Three
members of caveolin family are expressed in mammalian cells (Parton, 2003). Caveolin-1 and
caveolin-2 are widely expressed in many tissues, such as adipocytes, endothelial cells, fibroblasts
and smooth muscle (Scherer et al., 1996), whereas the caveolin-3 expression is highly restricted
to cardiac and skeletal muscle (Tang et al., 1996;Way & Parton, 1995). I have detected the
expression of both caveolin-1 and caveolin-2 in β-cell lines, INS-1, MIN6, and HIT-T15, as well
as in rat pancreatic islets (Xia et al., 2004), which was later confirmed by Kowluru and
colleagues (Veluthakal et al., 2005). I found that in the α-cell line αTC6 and in dispersed
primary rat α-cells only caveolin-2 is expressed. The detection of caveolin proteins in β- and α-
cells suggested the existence of caveolar lipid rafts in these two types of islet cells, and that
caveolin may play an important role in regulating insulin and glucagon secretion. The detection
162
of caveolin-1 by immunogold electron microscopy in HIT-T15 cell further provided
ultrastructural evidence for the existence of caveolae in the plasma membrane of β-cells
(Veluthakal et al., 2005). Since it is technically difficult to purify caveolae away from other
planar membrane rafts, and to dissect the function of caveolae, this thesis does not attempt to
subdivide caveolae and non-caveolar membrane rafts.
Lipid raft membranes are traditionally defined as being insoluble in cold non-ionic detergent,
such as Triton X-100, and a detergent extraction method was established (Brown & Rose, 1992).
Later on, non-detergent isolation of lipid rafts based on pH and carbonate resistance method was
also developed (Song et al., 1996). For both methods, the fractions of detergent or carbonate-
resistant membranes (lipid rafts) float into the buoyant fractions between 5% and 30% sucrose
gradient after ultracentrifugation. The proteins of interest specifically associated with the lipid
raft membrane can be identified by the analysis of these sucrose fractions. I have applied the
carbonate-resistant method to isolate lipid rafts from β-cell line, HIT-T15 cells (Chapter Two),
and Triton X-100 method to isolate lipid rafts from α-cell line, αTC6 cells (Chapter Three). In
HIT-T15 β-cells, both caveolin-1 and -2 were found to be localized to the interface of 5% and
30% sucrose gradient, the fractions denoting lipid rafts. Caveolin-2 was found localized in the
lipid raft fraction in αTC6 cells. Those findings support the existence of lipid rafts in both
pancreatic β- and α-cells. I next focused on the lipid raft association of two types of membrane
proteins (ion channels and SNARE proteins) critical for stimulus-secretion coupling of
pancreatic β- and α-cells.
5.2.1.2 Targeting of KV channels to lipid rafts in pancreatic β- and α-cells
Activation of KV channels in pancreatic β- and α-cells after each action potential results in efflux
of K+, membrane repolarization, and suppression of insulin and glucagon secretion. In pancreatic
163
β-cells, KV2.1 has been well documented as the major KV channels, contributing 60 – 85 % of
voltage-dependant outward K+ currents in rat and mouse (Macdonald & Wheeler, 2003). In
Chapter Three, I have demonstrated that KV3.2 / KV3.3 (delayed rectifying current) and KV4.1 /
KV4.3 (A-type current) were the major KV channels in pancreatic α-cells (Xia et al., 2007). I
then further explored lipid raft association of the KV channels in both islet β- and α-cells.
I found that the major functional KV channels, KV2.1, associated with lipid raft microdomains in
β-cells. This is in accordance with the first report on the ion channel association with lipid rafts,
from which KV2.1 was localized preferentially into the low buoyant-density fraction in the
transfected Ltk-cells and rat brain (Martens et al., 2000). Both my study (Xia et al., 2004) and
the previous report (Martens et al., 2000) demonstrated that membrane cholesterol depletion with
MβCD resulted in a significant hyperpolarization shift of the steady-state inactivation curve of
KV2.1 channels. Furthermore, MβCD pretreatment caused a dramatic decrease in KV2.1 current
amplitude (Chapter Two). The reduction in KV currents could partially account for the observed
increase in insulin secretion. Knock-down of KV2.1 channel expression or selective
pharmacological blockade of these channels in β-cells markedly enhanced glucose-induced
insulin secretion (Macdonald et al., 2001;Macdonald et al., 2002b). Taken together, I have
determined that the major KV channels in β-cells, KV2.1, target to lipid rafts in β-cell plasma
membrane. The lipid raft association of KV channels could play an important role in regulating
β-cell excitability and insulin secretion.
In pancreatic α-cells, I found that KV4.1 and KV4.3, the KV channels carrying A-type currents in
α-cells, were localized to the Triton X-100 resistant fraction (Xia et al., 2007), indicating their
targeting to lipid rafts. In contrast, the KV3.2 and KV3.3 (carrying delayed rectifying current)
were not associated with lipid rafts in α-cells. Consistently, removal of membrane cholesterol
164
with MβCD has profound effects on the function of KV4 channels, resulting in the absence of
KV4-associated A-type currents in mouse α-cells. This suggests that targeting of the KV4
channels could play an important role for the channel regulation and α-cell excitability. Another
subtype of KV4 channels, KV4.2, was reported to be targeted to lipid rafts in rat hippocampal
neurons and transfected HEK 293 cells (Wong & Schlichter, 2004). Therefore, the KV4 family of
KV channels seems to be preferentially associated with lipid raft membrane microdomains. This
could be due to the interaction of the channel proteins with K+ channel-interacting proteins
(KChIPs) (Pike, 2004;Wong & Schlichter, 2004). KChIP was found to profoundly affect KV4.2
and KV4.3 intracellular trafficking and function (Shibata et al., 2003;Takimoto et al., 2002).
Palmitoylation of KChIPs is required to efficiently enhance the cell surface expression of KV4
channels (Takimoto et al., 2002). I speculate that KChIPs could play an important role in
mediating the preferential targeting of KV4.1 and KV4.3 to lipid rafts in pancreatic α-cells. The
significance of the targeting of KV4.1 and KV4.3 to lipid rafts in pancreatic α-cells remains to be
further investigated due to the contradictory data reported on the role of KV channels in
regulating α-cell stimulus-secretion coupling (Gromada et al., 2004;Olsen et al., 2005).
5.2.1.3 Targeting of CaV channels to lipid rafts in pancreatic β- and α-cells
CaV channels in pancreatic β- and α-cells take a center stage in hormone secretion and regulation
of glucose homeostasis. In pancreatic β-cells, there is a consensus now that L-type CaV channels,
CaV1.2, play a critical role in stimulus-secretion coupling. Compared with β-cells, the roles of
CaV channels in pancreatic α-cells have been less clear. I have detected the protein expression of
both CaV1.2 (L-type) and CaV2.2 (N-type) Ca2+ channels in αTC6 cells by Western blot, and
165
confirmed the CaV currents with patch clamp recording in MIP-GFP mouse α-cells (Chapter
Three).
The association of CaV channels with lipid rafts is poorly investigated. The α1 subunit of L-type
CaV channels were found preferentially in caveolin-rich detergent-resistant membranes of
smooth muscle and cardiomyocytes (Darby et al., 2000;O'Connell et al., 2004). Cholesterol
depletion in cardiomyocytes causes a decrease in the frequency, amplitude and width of Ca2+-
sparks (Lohn et al., 2000). It has been reported that the function of CaV2.1 channels was
regulated by cholesterol-rich lipid rafts in neurons (Taverna et al., 2004;Davies et al., 2006).
CaV2.2 channels are modulated by both cholesterol and caveolin in neuroblastoma cells
(Lundbaek et al., 1996;Toselli et al., 2005). I have detected the localization of L-type Ca2+
channel CaV1.2 in lipid rafts of both pancreatic β- and α-cells (Chapter Two and Three).
Although N-type (CaV2.2) Ca2+ channels are thought to play an important role in α-cell glucagon
secretion, I did not find them to be associated with lipid rafts in α-cells. Furthermore, acute
cholesterol depletion with MβCD did not cause a significant change in the properties of CaV
channels of either pancreatic β- or α-cells, indicating the relative resistance of CaV channels to
changes in the lipid milieu. See the section 5.2.3 for a further discussion on the regulation of
endogenous cholesterol on CaV channel function.
5.2.1.4 Targeting of SNARE proteins to lipid rafts in pancreatic β- and α-cells
The release of neurotransmitters and hormones from neuronal and endocrine cells is through
regulated exocytosis, a process whereby the membranes of vesicles or secretory granules fuse
with plasma membranes. Vesicle proteins and lipids are incorporated into plasma membrane
through exocytosis. SNARE proteins are a superfamily of small membrane associated proteins,
166
and play an essential role for intracellular membrane fusion steps. The spatial regulation of
SNARE proteins and SNARE protein complex remains unclear.
Localization of SNAREs in lipid rafts was first reported in canine kidney cells (Lafont et al.,
1999). Then, another group reported that ~20% of syntaxin 1A and SNAP-25 were localized in
detergent resistant membranes (DRMs) of PC12 cells (Chamberlain et al., 2001), and cholesterol
depletion caused an inhibition in regulated exocytosis. In both HIT-T15 β-cells and αTC6 α-
cells, I found the exact same set of SNARE proteins targeting to lipid rafts, which are syntaxin
1A, SNAP-25, and VAMP-2 (Chapter Two and Three). This is not surprising since SNARE
proteins are the conserved exocytotic proteins in neuronal and endocrine cells, and were recently
found to be associated with lipid rafts in many other cell types, such as in rat brain (Gil et al.,
2005), in alveolar epithelial cells (Chintagari et al., 2006), in macrophages (Kay et al., 2006) and
mast cells (Puri & Roche, 2006), supporting SNARE proteins are generally associated with lipid
raft microdomains. I found that disruption of lipid rafts by cholesterol depletion altered insulin
and glucagon exocytosis (to be discussed in the section 5.2.2).
5.2.1.5 Controversies, challenges and new approaches in lipid raft studies
Despite the wide acceptance of lipid rafts among cell biologists as signaling platforms of many
cellular processes, the basic hypothesis that lipid rafts exist in membranes of living cells remains
controversial (Shaw, 2006). This mainly comes from the lack of consensus regarding the
definition of lipid rafts and techniques applied for the studies of these lipid microdomains.
Although the definition of lipid rafts is physical (as membrane domains), and is with specific
functions (as signaling and intracellular trafficking), the working definition is biochemical (Shaw,
2006). For example, proteins are deemed to be targeted to lipid rafts if they are insoluble in
167
certain detergent and float into the lighter fractions of sucrose gradient. Since cholesterol is
proposed to be enriched in lipid rafts, sensitivity to cholesterol depletion with drugs like MβCD
is also widely used as a criterion for lipid raft association. However, different detergents, as well
as the duration of incubation or temperature, generate variable results. The proportion of proteins
needed to be detergent-insoluble to be conferred as residents of lipid rafts is also variable,
ranging from less than 10% to over 50% (Shaw, 2006). Treatment with detergent has been even
reported to induce artificial changes in protein solubility (Giocondi et al., 2000). In my studies,
both the carbonate resistance method (Chapter Two) and Triton X-100 method (Chapter Three)
were used for the characterization of lipid rafts in pancreatic β-cells and α-cells respectively. I
found the same pattern of the types of the proteins targeted to lipid rafts between the two
methods. It should be noted that two or more methods for lipid raft isolations should be used to
analyze the same type of cells for a better and more reliable comparison. Failure to appreciate the
above issues can lead to over-interpretation or misinterpretation of experimental results
(Hancock, 2006).
The challenges to prove the existence of lipid rafts would require a direct visualization of the
rafts in cell membranes. Unequivocal existence of the subtypes of lipid rafts caveolae has been
both defined by the presence of caveolins and confirmed morphologically by electron
microscopy, and characterized to be 50 – 100 nm in size (Allen et al., 2007;Parton, 2003).
However, characterization of planar lipid rafts has been proved more difficult than caveolae. The
nanometer diameter of these microdomains is below the resolution of light microscopy, making
the study of these structures in intact, living cells complicated (Allen et al., 2007).
Morphological identification of lipid rafts with electron microscopy was limited by issues of
tissue preparation and fixation, and the lack of an obvious morphologically distinct structure that
168
unequivocally defines these microdomains (Shaw, 2006). So far, the strongest evidence for these
non-caveolae nanodomains comes from immunogold electron microscopy of distinct
components such as T cell receptor (Parton & Hancock, 2004;Schade & Levine, 2002), and the
dimension of these lipid nanodomains in the outer leaflet of plasma membranes is defined to be
the size of 50 – 200 nm (Jacobson et al., 2007b). The direct visualization of lipid rafts and/or
caveolae in pancreatic β- or α-cells remains to be further investigated.
Regardless of the controversies and the challenges mentioned above, numerous data accumulated
over the past 10 – 15 years have indicated that lipid rafts provide both spatial and temporal
platforms for some critical cellular process in signaling and vesicular trafficking. More
sophisticated approaches are being developed for studying these membrane raft nanodomains
and have addressed some of the controversial issues (Allen et al., 2007). These approaches focus
on imaging intact plasma membranes, including single particle tracking (SPT), single
fluorophore video tracking (SFVT), and fluorescence resonance energy transfer (FRET)
(Hancock, 2006). Employing those approaches, the existence of raft membrane domains have
been confirmed by the biophysical studies of model membranes (Hancock, 2006).
5.2.2 Lipid Rafts in the Plasma Membrane Regulate Exocytosis of Pancreatic β- and α-Cells
Lipid rafts were proposed to be membrane platforms for critical cellular function such as signal
transduction and vesicular trafficking (Brown & Rose, 1992;Varma & Mayor, 1998;Simons &
Ikonen, 1997). The early studies in PC12 cells favored the hypothesis that lipid rafts are the sites
of exocytosis (Chamberlain et al., 2001;Lang et al., 2001). They demonstrated that disruption of
lipid rafts by cholesterol depletion with MβCD caused an inhibition in regulated exocytosis of
PC12 cells. Therefore, I hypothesized that association of SNARE proteins with lipid rafts in the
169
plasma membrane of pancreatic β- and α-cells facilitated spatial separation of the protein
complex essential for exocytosis. I observed that depletion of membrane cholesterol with MβCD
caused an elevation of basal β-cell insulin secretion (Chapter Two) and α-cell glucagon secretion
(Chapter Three), but a loss of glucose-stimulated insulin secretion. This suggested that lipid raft
in the plasma membrane play an important role in regulating exocytosis of pancreatic β- and α-
cells.
5.2.2.1 SNARE protein clusters and cholesterol dependence
One of my interesting observations in Chapter Three is that the plasma membrane-associated
SNAREs (t-SNAREs) SNAP-25 and syntaxin 1A are in concentrated spotty structures on the α-
cell plasma membranes. This structure was termed a “cluster” as previously reported in PC12
cells (Lang et al., 2001). The SNARE protein clusters were also recently reported in pancreatic
β-cells (Ohara-Imaizumi et al., 2004a;Takahashi et al., 2004) and epithelial cells (Low et al.,
2006). A recent study with nanoscale resolution STED (stimulated emission depletion)-
microscopy revealed that the syntaxin spots visualized by conventional microscopy are
composed of several individual clusters (Sieber et al., 2006), indicating that the SNARE clusters
observed under the microscope represent the cholesterol-rich lipid rafts, in a size of 10 – 200 nm
as defined recently for membrane rafts (Pike, 2006).
The integrity of SNARE clusters on the plasma membrane is dependent on cholesterol. When I
depleted the membrane cholesterol from α-cells with MβCD, the spotty clusters on the plasma
membrane became dispersed, implicating a redistribution of SNAP-25 and syntaxin 1A in the the
plasma membrane (Chapter Three). A similar observation was also previously reported by others
(Lang et al., 2001;Ohara-Imaizumi et al., 2004a;Takahashi et al., 2004). The close proximity of
syntaxin 1 and cholesterol in the plasma membrane was supported by the crosslink of
170
photoactivatable cholesterol and syntaxin 1 (Lang et al., 2001). Depletion of membrane
cholesterol not only disrupts the integrity of SNARE clusters, but also was found to inhibit the
release of neurotransmitter in neuroblastoma cells (Chamberlain et al., 2001;Lang et al., 2001).
Therefore, cholesterol and the integrity of SNAP-25 and syntaxin 1A clusters seemed important
for regulating exocytosis.
5.2.2.2 Cholesterol depletion at the plasma membrane causes a loss of regulated hormone secretion of both β- and α-cells
One of my observations is that depletion of membrane cholesterol with MβCD caused a
significant elevation of β-cell insulin secretion and α-cell glucagon secretion under basal
conditions, but a loss of glucose-stimulated insulin secretion. Association of SNAP-25 and
syntaxin 1A with lipid rafts could restrict them from going to the exocytotic sites under basal
condition, and disruption of lipid rafts in the plasma membrane could facilitate the redistribution
of these SNARE proteins, causing an elevated hormone secretion. This was supposed by the
observation that disruption of lipid rafts with sphingomyelinase activates GLUT4 translocation
in 3T3-L1 adipocytes (Liu et al., 2004a). Using two-photon excitation microscopy, Takahashi et
al demonstrated that depletion of membrane cholesterol with MβCD facilitated the diffusion of
SNAP-25 along the plasma membrane and enhanced its redistribution into fused granules, which
resulted in more than 3-fold increase of the proportion of sequential exocytosis of pancreatic β-
cells (Takahashi et al., 2004). The Chamberlain group later reported that the increased
association of SNAP-25 with lipid rafts decreased exocytosis in PC12 cells (Salaun et al., 2005a).
They demonstrated that less SNAP-25 was associated in lipid raft fractions (20% of total SNAP-
25) compared to a closely related protein, SNAP-23 (54% of total SNAP-23). This difference
was due to the presence of an additional cysteine residue in SNAP-23 in its palmitoylated
membrane targeting region, which would enhance its insertion into lipid rafts. Mutation of the
171
corresponding phenylalanine residue in SNAP-25 to cysteine increased its association to lipid
rafts, and more importantly, reduced exocytosis from PC12 cells (Salaun et al., 2005a). However,
this is in contrast to the previous model, by which cholesterol-rich lipid rafts of plasma
membranes were proposed to be the sites for fusion and exocytosis (Chamberlain et al.,
2001;Lang et al., 2001). Further more, using total internal reflection fluorescence (TIRF)
microscopy, Ohara-Imaizumi and colleagues found that insulin exocytosis occurs at the site of
syntaxin 1 clusters in MIN6 β-cells (Ohara-Imaizumi et al., 2004a). It should be noted that the
elevated basal hormone secretion could be due the pleiotropic effect of MβCD as well. The
massive basal increment of GLUT4 vesicle exocytosis in 3T3-L1 adipocytes after cholesterol
depletion with MβCD at the concentration of above 5 mM was suggested due in part to a
damaging effect (Liu et al., 2004a). Therefore, the role of lipid raft regulation of hormone and
neurotransmitter secretion is still contradictory and remains to be further investigated.
Since MβCD causes a strong elevation of basal insulin secretion, under higher glucose condition,
pancreatic β-cells does not further secrete insulin, indicating a loss of glucose-stimulated insulin
secretion. This is consistent with the studies of the Thurmond group, who observed that depletion
of lipid raft constituent protein caveolin-1 with RNAi caused elevated basal insulin secretion
from MIN6 β-cells and pancreatic islets, losing glucose-stimulated insulin secretion. Therefore,
lipid rafts could play a critical role in regulating hormone secretion from pancreatic β- and α-
cells. Disruption of lipid rafts by depleting cholesterol in the plasma membrane with MβCD
could have modified the function of the SNARE proteins as well as ion channels, leading to a
loss of regulated exocytosis. However, additional approaches are required to rule out any
possible direct effects of MβCD on different aspects of exocytosis, and to further understand the
dynamic movement of the raft-associated proteins in pancreatic β- and α-cells. Thus, the
172
accumulation / exclusion of SNAREs into lipid rafts offer a possible novel mechanism to
regulate exocytosis (Figure 31).
173
Figure 31. Lipid raft regulation on ion channels and SNARE proteins
A, CaV channels and KV channels, as well as SNARE proteins syntaxin 1A, SNAP-25 and VAMP-2 are found targeted to cholesterol-rich lipid raft microdomains in the plasma membrane or secretory granule (SG) membranes in pancreatic β- and α-cells. Targeting of syntaxin 1A and SNAP-25 to lipid rafts could restrict them from going to exocytotic sites to interact with VAMP-2 under basal conditions. B, Disruption of lipid rafts in the plasma membrane with MβCD could facilitate the redistribution of syntaxin 1A and SNAP-25 in the plasma membrane, leading to an elevated basal hormone secretion. MβCD may cause cellular stress, leading to a loss of regulated exocytosis. Disruption of lipid rafts also caused an inhibition on KV currents, another effect that could contribute to the elevated hormone secretion as well.
174
5.2.2.3 Complexity of lipid raft regulation on exocytosis
Lipid rafts could be involved in modulating exocytosis in a variety of ways. In the simplest
scenario, membrane rafts act as signaling platforms, in which membrane proteins such as ion
channels and SNARE proteins are colocalized. Upon activation of neuronal or endocrine cells,
exocytosis would occur rapidly and efficiently due to the spatial proximity of the exocytotic
proteins. However, the regulation of lipid rafts on cellular signaling could be more complicated
(Pike, 2003). Some types of exocytosis could be exclusively in nonraft domains. Membrane rafts
might be involved in negative regulation of signal transduction (Zajchowski & Robbins, 2002)
by sequestering signaling molecules in an inactive state. In this case, protein association with
rafts is not for activation of a signaling pathway. In contrast, the rafts could modify the intrinsic
activities of the proteins and make them inactive, or could provide a physical separation of
proteins that would otherwise interact with the signaling pathway. This makes cellular signaling
more regulated and restricts unwanted signal transductions. The conflict observations on the role
of lipid rafts in regulating hormone secretion of neuroendocrine cells are in consistence with this
postulated complex regulatory mechanism.
5.2.3 Cellular Cholesterol and its Homeostasis is Critical for Pancreatic β-Cell Stimulus-Secretion Coupling
In Chapters Two and Three, I have focused on the identification of lipid rafts and the associated
ion channels and SNARE proteins in pancreatic β- and α-cells. An approach of membrane
cholesterol depletion with MβCD was used to examine the role of plasma membrane lipid rafts
in stimulus-secretion of pancreatic β- and α-cells. Since MβCD is membrane impermeable,
depletion of cholesterol with MβCD can only disrupt lipid rafts on the plasma membranes.
However, in addition to plasma membrane, cholesterol is also widely distributed in subcellular
membranes, such as membranes of the ER-Golgi networks and secretory vesicles, and therefore
175
exerts many important roles including protein sorting/trafficking and vesicle mobilization
(Simons & Ikonen, 1997;Helms & Zurzolo, 2004). I therefore have further explored the role of
endogenous cholesterol on β-cell stimulus-secretion coupling (Chapter Four).
5.2.3.1 Inhibition of endogenous cholesterol biosynthesis perturbs β-cell insulin secretion
Squalene epoxidase is the second enzyme in the committed sterol biosynthesis, and inhibition of
this enzyme would only affect cholesterol synthesis. I have detected the strong expression of this
enzyme in primary mouse β-cells and β-cell lines. The squalene epoxidase inhibitor, NB598, was
used to chronically inhibit endogenous cholesterol biosynthesis in β-cells, and to examine the
role of endogenous cholesterol on β-cell insulin secretion.
I have found that chronic inhibition of endogenous cholesterol biosynthesis with NB598
markedly impaired insulin secretion from mouse pancreatic islets under both basal and high
glucose conditions (Chapter Four). However, acute cholesterol depletion with MβCD at the
plasma membrane caused a loss of glucose-stimulated insulin secretion only (Chapter Two). This
is not surprising since blockade of endogenous cholesterol has profound effects on the function
of cholesterol in subcellular membranes, such as endoplasmic reticulum (ER) and insulin
secretory granules. Cholesterol is an abundant lipid in cellular membranes and is a crucial player
at the subcellular level in defining functional membrane microdomains for cellular activity
(Holthuis et al., 2003;Schrader, 2004). Trans-Golgi network (TGN) has been reported to contain
cholesterol- and sphingolipid-rich microdomains, from which the neuropeptides- or hormone-
containing dense core granules bud (Loh et al., 2004;Tooze, 1998;Wang et al., 2000). Thus,
inhibition of endogenous cholesterol could severely affect the cholesterol not only in the plasma
membrane but also in the subplasmalemmal membranes, such as ER and insulin granules,
176
resulting in a dysfunction of the sorting of membrane proteins and the trafficking and/or fusion
of secretory granules.
5.2.3.2 Endogenous cholesterol is essential for the normal function of CaV channels and SNARE protein exocytotic machinery
Ca2+ influx through CaV channels and SNARE protein secretory machinery are the two most
critical elements for the regulated exocytosis of pancreatic β-cells. More importantly, both CaV
channels (CaV1.2) and SNARE proteins (syntaxin 1A, SNAP-25, and VAMP-2) were found to
be associated with lipid raft microdomains (Chapters Two and Three). Blockade of endogenous
cholesterol synthesis caused a marked inhibition of CaV currents (Chapter Four), which is clearly
a major contribution to the observed impairment of insulin secretion by squalene epoxidase
inhibitor NB598. Studies with flash photorelease of calcium/capacitance measurements further
demonstrated that NB958 treatment also caused a perturbation of exocytosis independently from
CaV channels, resulting in dysfunction in primed release of the readily-releasable pool (RRP) of
insulin granules and also subsequent mobilization to replenish the RRP (Chapter Four).
Therefore, the impairment of insulin secretion after inhibition of endogenous cholesterol
biosynthesis could be mediated by impaired function of both CaV channels and SNARE protein
exocytotic machinery.
Both CaV channels and SNARE proteins are membrane proteins, which are processed and
transported through ER-Golgi network to the plasma membrane. No change on the protein
expression of CaV channels and SNAREs were detected, therefore the impaired function of CaV
channels and SNARE proteins is not due to a down-regulation of the protein synthesis. Part of
ER-exported cholesterol has been reported to become confined to lipid rafts before reaching the
plasma membranes (Heino et al., 2000). Therefore, the passage of cholesterol through the ER-
177
Golgi apparatus might play an important role in raft-dependent sorting of proteins in the trans-
Golgi network (Simons & Ikonen, 1997;Helms & Zurzolo, 2004). Inhibition of endogenous
cholesterol biosynthesis may cause an inappropriate protein sorting / localization of membrane
proteins such as ion channels and SNARE proteins in pancreatic β-cells. Therefore, the
dysfunction of ion channels and SNARE proteins caused by the inhibition of endogenous
cholesterol biosynthesis with NB598 could be a result of the disruption of cholesterol not only in
plasma membranes but also in ER-Golgi network and insulin secretory vesicles (Figure 32).
Furthermore, the conformational changes of CaV channels and SNARE proteins and/or a possible
change of protein-protein or protein-lipid interaction may also be factors for the dysfunction of
the membrane proteins. Finally, disruption of lipid rafts in secretory vesicles could directly affect
the granule mobilization and fusion with the plasma membranes, especially considering that the
vesicle SNARE protein VAMP-2 is targeted to lipid rafts within secretory granule membranes
(Chapters Two and Three), and the function of the vesicle-anchored synaptotagmin might also be
affected due to its interaction with membrane lipids via C2 domains (Brunger, 2005), and the
association with lipid rafts on synaptic vesicles (Lv et al., 2008).
178
Figure 32. Inhibition of endogenous cholesterol biosynthesis perturbs β-cell insulin secretion
Differently from the effect of MBCD, which deplete cholesterol only at the plasma membrane, inhibition of cholesterol biosynthesis with BN598 depletes cholesterol in the subcellular compartments as well, such as cholesterol in insulin granules and ER. This would affect the sorting and surfacing of membrane proteins, such as Cav channels and SNARE proteins (syntaxin 1A, SNAP-25, and VAMP-2). Cholesterol deficiency may also directly affect granule mobilization and fusion.
.
179
5.2.3.3 Endogenous cholesterol is essential for the expression of caveolin-1 in β-cells
I and others have found that both caveolin-1 and caveolin-2 are expressed in pancreatic β-cells
(Chen et al., 2003;Uhles et al., 2003;Xia et al., 2004;Veluthakal et al., 2005). However, the role
of caveolin proteins in regulating β-cell insulin secretion has not been fully elucidated.
Surprisingly, I have observed that inhibition of endogenous cholesterol biosynthesis strongly and
selectively down-regulated the expression of caveolin-1 in β-cells (Chapter Four). The
mechanism of caveolin-1 down-regulation could be a result of both increased degradation and
decreased transcription / translation of the protein. It was reported that caveolin expression was
down-regulated by inhibition of endogenous cholesterol synthesis with HMG-CoA reductase
inhibitor atorvastatin (Feron et al., 2001). This effect could be due to the inhibition in caveolar
turnover, since statins can limit caveolar endocytosis (Maguy et al., 2006). On the other hand,
cellular cholesterol could regulate caveolin expression at the transcription level. Sterol regulatory
element (SRE) binding protein (SREBP) transcription factors are up-regulated when cellular
cholesterol is low (Goldstein et al., 2006). The caveolin-1 gene has been identified as having
SRE-like domains, and binding of SREBP transcription factors with these sequences inhibits
caveolin gene transcription (Bist et al., 1997). This was supported by the experiment that the
expression of caveolin-1 can be strongly suppressed by a nonspecific SREBP catabolism
inhibitor ALLN (cysteine protease inhibitor N-acetyl-leu-leu-norleucinal) (Bist et al., 1997;Feron
et al., 2001). However, it is not clear why the inhibition in cholesterol synthesis down-regulated
the expression of only caveolin-1, since caveolin-2 gene also contains SRE-like sequences
resembling those described in caveolin-1 gene, and thus expected to also have been regulated by
cellular cholesterol (Fra et al., 2000). Therefore, further investigations are warranted to elucidate
the mechanism of caveolin-1 down-regulation by cholesterol inhibition.
180
Two mechanisms could be involved in mediating the down-regulation of caveolin-1 and the
impairment in insulin secretion. The first is through an impact on CaV channel function. CaV2.2
channels in neuroblastoma cells have been reported to be regulated by caveolin (Lundbaek et al.,
1996;Toselli et al., 2005). I speculate that down-regulation of caveolin-1 expression could result
in a dysregulation of CaV1.2 channels in β-cells leading to impairment in insulin secretion.
However, further studies are needed to support this hypothesis. Secondly, the down-regulation of
caveolin-1 could cause impaired insulin secretion through a disturbance on insulin granule
mobilization. In pancreatic β-cells, Thurmond and colleagues have recently demonstrated that
caveolin-1 binds to the small Rho family GTPase Cdc42, which in turn binds to the v-SNARE
protein VAMP-2 to form a caveolin-1 / Cdc42 / VAMP-2 complex (Nevins & Thurmond, 2006).
This indicates that caveolin-1 could play an important role in targeting insulin granules to the
exocytotic sites during regulated exocytosis. Therefore, down-regulation of caveolin-1 could
affect granule mobilization and fusion with plasma membrane. The impaired basal insulin
secretion observed in my study could be due to the strong inhibitory effect of NB598 on both
CaV channels and exocytotic machinery. The link between caveolin-1 down-regulation and
impairment of insulin secretion remains to be further investigated.
5.2.3.4 Cholesterol accumulation in β-cells is toxic to insulin secretion
Although cholesterol is an essential constituent of lipid raft microdomains, too much cholesterol
could be harmful to β-cell function as well. Whereas the roles of triglyceride and saturated free
fatty acid on β-cell dysfunction have been well documented, there were very few reports about
the role of cholesterol on β-cell function. Two very recent observations demonstrated that
cholesterol accumulation in β-cells (Brunham et al., 2007) or elevated plasma cholesterol level
(Hao et al., 2007) are toxic to β-cell insulin secretion. Studies from Hayden’s group indicated
181
that the mice with specific ablation of ABCA1 (ATP-binding cassette transporter A1, a plasma
membrane protein mediating cellular cholesterol efflux) in β-cells displayed a marked increase in
total cholesterol, free cholesterol and cholesterol ester levels in islets (Brunham et al., 2007).
They found that accumulated cholesterol in β-cells caused a significant defect in insulin
secretion, leading to impaired glucose tolerance. The Piston group (Hao et al., 2007) reported
that mice with the double mutation of leptin and apoE (ob/ob:apoE-/-) have a significant increase
in total plasma cholesterol and a dramatic reduction of insulin secretion under both basal and
high glucose conditions. More importantly, they found that cholesterol depletion with MβCD can
partially restore the impaired insulin secretion. This is consistent with my early observation that
depletion of membrane cholesterol with MβCD enhanced β-cell insulin secretion and single cell
exocytosis (Chapter Two), as well as with the studies from the Thurmond group, who found that
knocking out of caveolin-1 with siRNA in MIN6 cells and mouse islets enhanced basal insulin
secretion (Nevins & Thurmond, 2006).
Furthermore, LDL receptors are highly expressed in β-cells but not in α-cells (Grupping et al.,
1997). The β-cells from aging humans have been reported to display significant increased LDL
uptake (the major source of exogenous cholesterol), implicating prolonged exposure to high
lipoprotein levels could causally be related to the higher risk for type 2 diabetes with aging
(Cnop et al., 2000). The observation that α-cells do not express LDL receptor could explain why
α-cells are relatively resistant to lipotoxicity compared to β-cells in the pathogenesis of type 2
diabetes. Therefore, cholesterol toxicity to β-cells may be an important component of
lipotoxicity in the development of type 2 diabetes. Manipulation of β-cell cholesterol level might
be beneficial for improving the function of β-cells in type 2 diabetes.
182
5.2.4 Study Approaches and Their Limitations
5.2.4.1 Cell lines and primary cells
Several cell lines have been used as study materials in this thesis, including HIT-T15, INS-1,
MIN6 (pancreatic β-cell lines) and αTC6 (a pancreatic α-cell line). HIT-T15 cell line was
established by simian virus 40 (SV40) transformation of hamster pancreatic β-cells (Santerre et
al., 1981), and has been extensively used since established. Later on, Asfari and coworkers
established insulinoma INS-1 cell line from cells isolated from an x-ray-induced rat
transplantable insulinoma (Asfari et al., 1992). MIN-6 cell line was isolated from transgenic
C57BL/6 mice expressing SV40 T-antigen driven by insulin promoter (Miyazaki et al., 1990).
The pancreatic α-cell line αTC6 was cloned from an adenoma created in transgenic mice
expressing the SV40 large T-antigen oncogene under control of the rat preproglucagon promoter
(Hamaguchi & Leiter, 1990). Different from primary cells that die in a few days after culturing,
cell lines are modified cells, with the immortal growing property outside. The modification
could cause any changes that may affect the nature of the original cells. Therefore they can not
represent the primary cells. However, they do have some properties of the original cells, such as
hormone secretion and expression of the proteins found in primary cells. They facilitate
biochemical studies, which need much amount of cellular proteins. In this thesis, HIT-T15 βcells
and αTC6 α-cells were used for characterization of lipid rafts and raft-associated membrane
proteins. INS-1 and MIN6 β-cells were also examined for the expression of lipid raft constituent
protein caveolins, as well as ion channels and SNARE proteins. The limitation of the studies
with cell lines were addressed by using pancreatic islets or dispersed islet cells (primary β- and
α-cells) from rat and mouse. Due to the limited availability of large amount of pancreatic islets,
the isolated islets or islet cells were used for the functional studies, such as insulin and glucagon
183
secretion, single cell capacitance measurements, and ion channel recording. Most of the above
experiments were performed by using pancreatic islets isolated from MIP-GFP mice, which has
greatly facilitated my studies due to an easy recognition of the green pancreatic β-cells.
5.2.4.2 Manipulation of membrane cholesterol with MβCD and NB598
In order to examine the roles of cholesterol-rich lipid rafts in regulating stimulus-secretion
coupling of pancreatic β- and α-cells, cellular cholesterol was manipulated by acute cholesterol
depletion from the plasma membrane with MβCD and chronic cholesterol synthesis inhibition
with NB598. MBCD is cyclic oligosaccharides with 7 glucose units. It is water-soluble and
contains a hydrophobic cavity (5 - 8Å). Therefore it is capable of dissolving hydrophobic
compounds (like cholesterol) and enhancing their solubility in aqueous solutions. MBCD have a
higher affinity for sterol than other lipids, and it sequesters cholesterol from the plasma
membrane (Kilsdonk et al., 1995). MβCD has been used extensively as drug delivery vehicles
(Pitha et al., 1988). Soluble cholesterol is a mixture of cholesterol with MBCD. If concentration
of cholesterol in culture medium is higher, MBCD can add back cholesterol to the plasma
membrane. Although MβCD was used extensively for depleting cholesterol from the plasma
membrane and disrupting lipid rafts, it has effects other than the ability to extract cholesterol
from the plasma membrane. Disturbance of the actin cytoskeleton and inhibition of clathrin-
mediated endocytosis are probably directly related to effect of cholesterol depletion (Kwik et al.,
2003;Pichler & Riezman, 2004;Subtil et al., 1999). MβCD may have other effects that are
unrelated to cholesterol depletion, such as global inhibition of the lateral mobility of plasma-
membrane proteins, irrespective of their association with lipid rafts (Goodwin et al., 2005).
184
Since MβCD is membrane impermeable, treatment of cells with MβCD is expected to only
deplete cholesterol and disrupt lipid rafts on the outer leaflet of the plasma membrane. Inhibition
of endogenous cholesterol biosynthesis is an alternative approach to examine the critical role of
cholesterol and lipid rafts in both plasma membrane and subcellular compartments. The NB598
compound is a potent competitive inhibitor of squalene epoxidase, the secondary rate limiting
enzyme in the committed sterol biosynthesis (Horie et al., 1990). Blockade of cholesterol
synthesis at this step may result in accumulation of only squalene which is known to be stable
and non toxic (Chugh et al., 2003). In Chapter 3, I have examined the effect cholesterol
inhibition with NB598 on pancreatic β-cell insulin secretion and ion channel function. To
preclude possible pleiotropic effects of NB598, three aspects were taken into considerations.
Firstly, I found a significant cholesterol lowering effect of NB598 not only on the plasma
membrane, but also on the subcellualr compartments. Secondly, acutely added NB598 does not
have the same effect as that observed after 48 h chronic incubation. Most importantly, adding
back of cholesterol restored much of the impaired insulin secretion and ion channel function.
Therefore, although the pharmacological approach of using NB598 may have its pleiotropic
effects, the observed inhibitory effects of NB598 on insulin secretion and ion channel function
are most likely due to the specific cholesterol lowering effect of this drug.
5.2.4.3 Complementary approaches are required to study lipid rafts due to the limitation of individual techniques
In this thesis, several approaches have been applied to study lipid rafts and their role in
regulating cellular process, such as hormone secretion. Each the individual technique has its
limitation and combination of the individual approaches will be informative to determine the role
of lipid rafts in cell signaling. Biochemical isolation of lipid raft membranes and their subsequent
analysis is a useful and simple method to determine if membrane proteins are located in raft
185
microdomains. However, both detergent-resistant based method and non-detergent based method
(based on pH and sodium carbonate resistance) have received criticism, such as that Triton X-
100 can solubilize proteins that are only weakly associated with lipid raft membranes, and that
sodium carbonate is pro to generating artificial raft association. Although cholesterol
manipulation with chemicals like MβCD or NB598 as discussed above provides evidence for a
requirement of raft compartmentalization of signaling proteins, there are always issues of
pleiotropic effects of using drugs. Genetic manipulation such as knocking out of the lipid raft
constituent protein caveolin-1 (Razani et al., 2001) and of the enzyme of cholesterol biosynthesis,
7-dehydrocholesterol reductase (Gondre-Lewis et al., 2006) is also an alternative approach for in
vivo studies, though compensatory effects can be sometime observed. Functional studies of
cellular process such hormone secretion and ion channel currents are particularly informative,
while combined with the above complementary approaches. The restoration of cholesterol
provides an important experimental control.
5.3 Conclusions These studies provided clear evidence for the important role of cholesterol-rich lipid rafts in
regulating stimulus-secretion coupling of pancreatic β- and α-cells. I have identified the
expression of lipid raft constituent proteins, caveolin-1/2 in pancreatic β-cells; caveolin-2 in α-
cells. Two major ion channels (CaV and KV) and SNARE proteins (syntaxin 1A, SNAP-25 and
VAMP-2) were identified to target to lipid raft microdomains in both β- and α-cells. The
property of KV2.1 and KV4.1/4.3 channels were found closely regulated by the environment of
cholesterol-rich lipid rafts in β- and α-cells, respectively. I found that acute depletion of plasma
membrane cholesterol per se with MβCD elevated basal hormone secretion from both β- and α-
cells and caused a loss of regulated exocytosis. Further studies by chronic pharmacological
186
inhibition of endogenous cholesterol biosynthesis clearly demonstrated that cellular cholesterol is
critical for the normal function of pancreatic β-cells. Inhibition of endogenous cholesterol
biosynthesis by a squalene epoxidase inhibitor perturbs β-cell insulin secretion and CaV channel
function. Adding-back of cholesterol was found to restore much of this inhibitory effect of
cholesterol deficiency. Therefore, cholesterol-rich lipid rafts could play a critical role in
regulating stimulus-secretion coupling of pancreatic β- and α-cells. Manipulation of cellular
cholesterol could be a potential target for a therapeutic intervention in the treatment of type 2
diabetes.
5.4 Future Directions Since no effect of NB598 on protein expression of ion channels and SNAREs were observed,
further experiments on membrane surfacing and subcellular localization of those proteins
will help to determine the mechanism involved in the dysfunction of the ion channels and
exocytotic machinery, especially to elucidate the discrepancy between the effects of acute
cholesterol depletion and chronic cholesterol synthesis inhibition.
Inhibition of squalene epoxidase with siRNA interference will be an alternative strategy to
verify the specific cholesterol lowering effect by NB598. Transduction of adenoviral
particles packaged with EGFP encoding squalene epoxidase siRNA into mouse islets and
combination of the experiments used for NB598 treatment will preclude any possible toxic
effect of the chemical compound on β-cell function.
Investigation on the role of caveolin-1 in β-cell stimulus-secretion coupling. Since I have
seen a selective down-regulation of caveolin-1 in MIN6 β-cells cultured with cholesterol
synthesis inhibitor NB598, over expression of caveolin-1 in MIN6 β-cells or mouse
pancreatic islets by a transduction of adenoviral particles packaged with EGFP encoding
187
caveolin-1 is expected to partially rescue the impaired insulin secretion and/or CaV channel
function caused by cholesterol inhibition with NB598. This will provide further information
on the role of caveolin-1 in regulating β-cell insulin secretion.
188
6 Appendix: Generation of Knockout Mice with β-Cell Specific Cholesterol Deficiency
This section contains work that requires additional data in order to be considered complete.
Xiaodong Gao helped to isolate mouse islets.
189
6.1 Abstract Pancreatic β-cell dysfunction is one of the major contributors to the development of
hyperglycemia in the pathogenesis of type 2 diabetes. Although triglyceride and saturated free
fatty acids have been well recognized in the progress of β-cell dysfunction, much less is known
about the role of cholesterol on the β-cell function. Using Western blot, I have detected the
strong expression of the first enzyme of the committed sterol synthesis pathway, squalene
synthase (SQS) from clonal β-cell lines (HIT-T15, INS-1 and MIN6) and pancreatic islets from
rat and mouse, suggestng the importance of cholesterol biosynthesis in pancreatic β-cells. In
order to perform in vivo studies for the role of endogenous cholesterol, I have generated β-cell
specific SQS knockout (βSQS-/-) mice that lack the ability to synthesize cholesterol in pancreatic
β-cells. βSQS-/- mice were characterized by β-cell specific loxP/Cre recombination of SQS gene
and the reduced SQS protein expression in pancreatic islets. Although βSQS-/- mice displayed
trends of both glucose intolerance and impaired glucose-stimulated insulin secretion in vivo, the
change of in vivo insulin secretion is not statistically significant compared to wild type mice. I
speculate that βSQS-/- mice could have compensated for their defective cholesterol synthesis
through cholesterol uptake from other neighboring islet cells or circulation, and therefore
maintain certain degree of cholesterol homeostasis and β-cell function. However, further in vivo
and ex vivo studies are needed to examine the phenotypes of βSQS-/- mice and the critical role of
endogenous cholesterol in β-cell stimulus-secretion coupling.
6.2 Introduction Type 2 diabetes is caused by a combination of relative insufficient insulin secretion from
pancreatic β-cells and insulin resistance in glucose disposal tissues such as skeletal muscle,
adipose and the liver. Although much effort has been focused on understanding the mechanism
190
of insulin resistance, the essential role of β-cell function in the development of hyperglycemia is
only recently gaining much attention. It has been recognized that the impaired β-cell function
even occurs long before the development of hyperglycemia (Kahn, 2001). However, the
mechanism of β-cell dysfunction in the pathogenesis of type 2 diabetes has not been fully
understood (Porte, Jr. & Kahn, 2001). Whereas the role of triglyceride and circulating free fatty
acids on β-cell dysfunction has been extensively studied (Yaney & Corkey, 2003), there were
very few reports about the role of cholesterol on the β-cell function.
Cholesterol is essential for growth and viability of mammalian cells (Chang et al., 2006). It is
one of the major constituents of cellular membranes and is involved in several subcellular
functions, such as influencing the thickness and fluidity of membranes and insulating membranes
(Ohvo-Rekila et al., 2002). Accumulated evidence has supported a critical role of cholesterol in
forming membrane raft microdomains (Epand, 2006;Simons & Ehehalt, 2002). Cholesterol,
sphingolipids and certain membrane proteins like caveolins have been proposed to form a
platform termed lipid rafts for protein sorting and signal transduction (Allen et al., 2007;Brown
& London, 2000;Simons & Toomre, 2000). Ion channels and SNARE proteins are the two
families of membrane proteins critical for the release of neurotransmitter and hormone from
neuronal and endocrine cells (Ashcroft & Rorsman, 1989;Weber et al., 1998). In Chapters Two
and Three, I have demonstrated that some of the critical ion channels and SNARE proteins are
associated with cholesterol-rich lipid raft microdomains in both pancreatic β- and α-cells (Xia et
al., 2004;Xia et al., 2007). Disruption of lipid rafts by acute cholesterol depletion from plasma
membranes modifies insulin and glucagon secretion of both types of pancreatic islet cells. In
Chapter Four, I have further demonstrated the critical role of endogenous cholesterol on β-cell
insulin secretion by chronical pharmacological inhibition on cholesterol biosynthesis (Xia et al.,
191
2008). Two mediators that could have been involved in the impaired insulin secretion are the
dysfunction of voltage-gated Ca2+ (CaV) channels and SNARE protein exocytotic machinery.
To further investigate the essential function of cholesterol in regulating insulin secretion in vivo,
I have now generated mice with pancreatic β-cell specific knockout of squalene synthase (SQS)
gene. SQS is the first enzyme in the committed sterol synthesis pathway (Bradfute et al., 1992),
therefore mutation of SQS gene does not affect the pathways prior to squalene, such as protein
prenylation (farnesyl and geranylgeranyl moieties), mitochondrial electron transport
(ubiquinone/Q10 coenzyme), and protein N-glycosylation (dolichol) (Ikonen, 2006). Besides
endogenous biosynthesis, another source of cellular cholesterol is via exogenous uptake from the
circulation or the other neighboring islet cells through low-density lipoprotein (LDL) receptor
(Matter et al., 1993). I found that mice with β-cell specific deficiency of the SQS gene displayed
trends of glucose intolerance and impaired glucose-stimulated insulin secretion in vivo, though
the change of insulin secretion was not statistically significant. I speculate that pancreatic β-cells
may compensate for the loss of endogenous cholesterol via cholesterol uptake from other
neighboring islet cells.
6.3 Materials and Methods
6.3.1 Generation of β-cell Specific SQS Gene Knockout (βSQS-/-) Mice
The mice with conditional allele of SQS gene (Fdft1), referred to SQS-flox mice, were
generously provided by Dr. Klaus-Armin Nave (Department of Neurogenetics, Max Planck
Institute of Experimental Medicine, Goetingen, Germany). Two loxP sites were introduced
flanking exon 5 of SQS gene (Saher et al., 2005). The transgenic mice expressing Cre
recombinase under the control of rat insulin promoter (RIP) -2, referred to RIP-Cre mice, were
kindly provided by Dr Minna Woo (Ontario Cancer Institute, University of Toronto, ON), and
192
were originally from Jackson Laboratory. The background strains of both SQS-flox mice and
RIP-Cre mice are C57BL/6. SQS-flox mice were crossed with RIP-Cre mice to generate mice
with β-cell selective knockout of SQS gene, referred to βSQS-/- mice. The wild type littermates
(βSQS+/+) were used as control. The heterozygous (βSQS+/-) mice were also examined. Mice
were maintained in the pathogen-free animal facility at the University of Toronto and all
experiments were approved by the University of Toronto Animal Care Committee.
6.3.2 DNA Isolation and Genotyping
Tail biopsies from 2 ~ 3-week-old mice were digested at 55°C with vigorous shaking for 1 h in
20 µl digestion buffer containing (in mM) 50 Tris-HCl (pH 8.0), 20 NaCl, 1 EDTA, 1% SDS,
and 3 mg/ml proteinase K. The digested samples were then incubated at 100ºC for 5 min to
inactivate proteinase K. 500 µl of double distilled water was added and 2 µl was taken for PCR
analysis. For DNA analysis of pancreatic islets, 50 islets isolated from βSQS+/+, βSQS+/- and
βSQS-/- mice were digested following the same protocol as tail DNA preparation except 10 µl
digestion buffer and 200 µl double distilled water were used. PCR analysis was performed using
the primers shown in Table 2. Hot Start Taq DNA polymerase (Fermentas, Burlington, ON) was
used for PCR amplification following the thermal cycling, SQS gene: heat activation of
polymerase at 95°C for 5 min, followed by 35 cycles of: 95°C for 30-sec, 58°C for 30-sec and
72°C for 45-sec; Cre gene: heat activation of polymerase at 95°C for 5 min, followed by 35
cycles of: 95°C for 30-sec, 60°C for 30-sec and 72°C for 45-sec. The amplified DNA was
visualized with bands of different sizes on 2% agarose gel.
193
Table 2. Primers used for genotyping of βSQS-/- mice
SQS Forward (Primer1) ACTTGTGGAAGGAAGTTCCAACCAGA
SQS Reverse (Primer2) CAGTCATCGGTGGCGAAAAAGGTGTT
SQS Reverse (Primer3) GAGGAAATCCTGGCATGAACACAGT
Cre Forward GGCAGTAAAACTATCCAGCAA
Cre Reverse GTTATAAGCAATCCCCAGAAATG
Note: SQS Primer 1/2: detection of wild type (360bp) and SQS-flox alleles (420bp)
SQS Primer 1/3: detection of SQS recombined alleles (600bp)
Cre Primer: detection of Cre recombinase (260bp)
194
6.3.3 Pancreatic Islet Isolation
Pancreatic islets from βSQS+/+, βSQS+/- and βSQS-/- mice were isolated by collagenase digestion
and hand-picked as described previously in Chapter Two.
6.3.4 Intraperitoneal Glucose Tolerance Test (IPGTT)
Glucose (1 g/kg body wt) was dissolved in 0.9% NaCl and delivered by intraperitoneal injection
into 12-week-old βSQS+/+, βSQS+/- and βSQS-/- mice after a 16-h fasting period. Blood samples
were obtained from tail veins at the times indicated following glucose injection. Blood glucose
concentrations were measured with a FreeStyle Mini glucose meter (TheraSense, Alameda, CA,
USA).
6.3.5 In vivo Insulin Secretion Measurements
One week after glucose tolerance tests, the mice (13-week-old) were given another
intraperitoneal glucose injection (1 g/kg body wt) after 16-h fasting. Blood samples were
obtained from saphenous vein before injection (0 min), 3 and 15 min after the glucose load.
Serum was separated by centrifugation at 2500 g for 15 min and stored at –20°C until assayed.
Serum insulin concentrations were determined using ultrasensitive mouse insulin ELISA assay
kit (Mercodia AB, Uppsala, Sweden) following the manufacturer’s instruction.
6.3.6 Immunoblotting
Western blot was performed to detect the changes of SQS protein expression. The isolated
pancreatic islets from βSQS+/+, βSQS+/- and βSQS-/- mice were lysed and the protein
concentrations determined. 20 µg of islet lysates were subjected to SDS-PAGE and transferred to
polyvinylidene difluoride-plus membranes (Fisher Scientific Ltd, Nepean, ON). Membranes
were probed with anti-SQS monoclonal antibody (BD Biosciences, Mississauga, ON). The
195
bound primary antibodies were detected with the peroxidase-conjugated secondary anti-mouse
antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA, USA), and then visualized
by chemiluminescence (ECL-Plus, GE Healthcare, Mississauga, ON) and exposed to X-ray films
(Eastman Kodak Co, Rochester, NY, USA).
6.3.7 Statistical analysis
Data points represent mean ± SEM. An unpaired Student’s t-test was used to compare βSQS-/- or
βSQS+/- mice with βSQS+/+ control mice. P < 0.05 was considered statistically significant.
6.4 Results
6.4.1 Expression of SQS in β-Cells
Essentially all cells of the body can synthesize cholesterol de novo. 3-hydroxy-3-methylglutaryl
CoA (HMG-CoA) is the starting material for the biosynthesis of cholesterol molecule, involving
a series of over 30 enzymatic reactions (Figure 33A). Squalene synthase (SQS) is the first
enzyme in the committed sterol biosynthesis. Animals deficient in SQS will display a specific
blockade of cholesterol synthesis without affecting other synthetic pathways. To confirm the
expression of SQS in pancreatic β-cells, Western blot was performed on different β-cell lines
(HIT-T15, INS-1, and MIN6) and pancreatic islets from rat and mouse. I found that all of the β-
cell lines and pancreatic islets strongly expressed SQS protein (Figure 33B), implicating the
importance of cholesterol biosynthesis in pancreatic β-cells. I therefore generated mice with
pancreatic β-cell selective knockout of SQS gene to study the role of SQS and endogenous
cholesterol on β-cell insulin secretion in vivo.
196
Figure 33. Cholesterol biosynthesis pathway and expression of squalene synthase in β-cells
A, Cholesterol biosynthesis starts from the reduction of HMG CoA, undergoing series of over 30 enzymatic reactions until the final cholesterol products. Squalene synthase (SQS) is the first enzyme in the committed sterol biosynthesis. Animals deficient in SQS will display a specific blockade of cholesterol synthesis without affecting other synthetic pathways. B, Western blot on β-cell lines (HIT-T15, INS-1, and MIN6) and pancreatic islets from rat and mouse is done by anti-SQS monoclonal antibodies. 50 μg of cell lysates for the different samples were loaded for each lane. I have detected the strong expressions of SQS from both β-cell lines and pancreatic islets.
197
6.4.2 Conditional Inactivation of SQS Gene in Pancreatic β-Cells
Exon 5 of SQS gene (Fdft1) encodes the active site of SQS (Gu et al., 1998). Global inactivation
of SQS gene by removing Exon 4 and Exon 5 with conventional knockout strategy is lethal
during embryonic development (Tozawa et al., 1999). To circumvent embryonic lethality and to
study the role of SQS in pancreatic β-cells, I used the loxP/Cre recombination system to
selectively inactivate SQS gene in pancreatic β-cells by knocking out Exon 5 of SQS gene
(Figure 34A). SQS-flox (SQSfl/fl) mice were crossed with RIP-Cre mice, and the first generations
are heterozygous for SQS (SQS+/fl) gene and either Cre-positive or Cre-negative. SQS+/fl with
Cre-positive (SQS+/flCre+) mice are the mice with one allele of SQS gene being knocked out in
pancreatic β-cells, therefore are referred to βSQS+/- mice thereafter. Crossing between βSQS+/-
mice generates three different genotypes of mice, wild type (βSQS+/+), heterozygous (βSQS+/-)
and homozygous (βSQS-/-) mice. By genotyping mouse tail biopsies with primer1/2 of SQS gene,
βSQS+/+ mice show a 360bp band; βSQS-/- mice show a 420bp band due to the insertion of loxP
sequence; and βSQS+/- mice show both bands of 360bp and 420bp (top panel of Figure 34B). All
these three types of mice are Cre-positive, with a band of 260bp while genotyped with Cre
primers (middle panel of Figure 34B).
Using SQS primer1/3, pancreatic β-cell specific loxP/Cre recombination of SQS gene was
determined by PCR analysis (a band of 600bp) of DNA isolated from pancreatic islets of
βSQS+/+, βSQS+/- and βSQS-/- mice (lower panel of Figure 34B). To verify the successful tissue-
selective ablation of SQS gene in pancreatic β-cells, I performed Western blot to determine the
amount of SQS protein in pancreatic islets as well as other tissues such as the brain, liver, kidney
and lung. The protein expression of SQS is significantly reduced in pancreatic islets from mutant
βSQS+/- and βSQS-/- mice compared to the wild type control βSQS+/+ mice (Figure 34C). To
ascertain the equal protein loading, the SQS bands were normalized to Na+/K+-ATPase internal
198
control, indicating a 51% (n = 4, P < 0.001) reduction of SQS protein in βSQS+/- mouse islets
compared to wild type βSQS+/+. A protein reduction of 72% (n = 4, P < 0.001) was found in
βSQS-/- mouse islets (Figure 34D). The 28% of the SQS protein left from the βSQS-/- mouse
islets could be from non-β-cells, such as α- and δ-cells. No changes in SQS protein expression
were found in other tissues.
199
Figure 34. Inactivation of SQS gene in pancreatic β-cells
(See next page for the figure legend)
200
Figure 34. Inactivation of SQS gene in pancreatic β-cells.
A, top panel shows part of SQS gene with two loxP sites flanking exon 5 (referred to SQS-flox mice). Crossing a SQS-flox mouse with a Cre transgenic mouse driven by rat insulin promoter (referred to RIP-Cre mice) generates mice with a β-cell specific deletion of exon 5 of SQS gene (referred to βSQS-/- mice). Positions of genotyping primers are indicated. B, top panel shows the genotypes of SQS gene determined with PCR using primer 1/2 from mouse tail samples. The wild type (βSQS+/+) is distinguished by a 360bp band. Whereas the homozygous (βSQS-/-) displays a band of 420bp due to an introduction of loxP sequence. The heterozygous shows both bands of 360bp and 420bp. Middle panel is the genotypes of RIP-Cre from the same sample as the top panel, indicating the existence of Cre transgenes (with a PCR amplified fragment of a 260bp). The lower panel is the genotyping of pancreatic islets. A PCR amplification band of 600bp indicates the recombination and deletion of exon 5 of SQS gene in pancreatic β-cells. C, Western blot of pancreatic islets from mice with different genotypes as indicated. 20 µg of protein lysate was loaded for each lane, and blotted with anti-SQS monoclonal antibody, indicating inactivation of SQS protein expression in pancreatic β-cells. D, quantitative analysis of SQS protein expression normalized to Na+/K+-ATPase internal control. βSQS+/- mouse islets show a 51% reduction of SQS protein compared to βSQS+/+. A protein reduction of 72% was found in βSQS-/- mouse islets (*P < 0.001).
201
6.4.3 Normal Development of βSQS-/- Mice
Mutant mice (βSQS+/- and βSQS-/-) were born at expected Mendelian ratio and were
indistinguishable from wild type control mice (βSQS+/+). Body weight was measured at 12 weeks
of age. Nine mice were measured for each group. There is no significant change in the body
weight of both βSQS+/- (27.75 ± 1.05 g, P = 0.24) and βSQS-/- (27.52 ± 1.29 g, P = 0.34) mice
compared to the wild type βSQS+/+ mice (25.76 ± 1.26 g) (Figure 35). Neither change in activity
of mutant mice was observed, suggesting that hypothalamic function was not affected.
202
Figure 35. Body weight of βSQS+/+, βSQS+/- and βSQS-/- mice
Body weight was measured at 12 weeks of age. There is no significant change in the body weight of βSQS+/- and βSQS-/- mice compared to the wild type βSQS+/+ mice. Nine mice were measured for each group.
203
6.4.4 βSQS-/- Mice Display a Trend towards Glucose Intolerance
Using a cholesterol biosynthesis inhibitor, I have previously demonstrated in vitro that
endogenous cholesterol plays an essential role in β-cell insulin secretion (Chapter Four).
Generation of βSQS-/- mice provides an animal model for in vivo study on roles of cholesterol in
regulating insulin secretion. I then determined the consequences of β-cell selective ablation SQS
gene on systemic glucose homeostasis and insulin secretion in vivo. Intraperitoneal glucose
tolerance tests (IPGTT) indicated that βSQS-/- mice show a trend of glucose intolerance
compared to wild type βSQS+/+ mice (Figure 36A), although statistical significance was observed
only at 2 h after glucose challenge (1 g/kg body wt) with an increased blood glucose level from
6.67 ± 0.39 mmol/L in wild type control to 9.67 ± 0.89 mmol/L in βSQS-/- mice (n = 9, P < 0.05).
This trend of glucose intolerance was also shown when the glucose tolerance data were analyzed
by the area-under-curve, although it is not statistically significant (P= 0.11) (Figure 36B). This
could be due to the lower glucose amount used (1 g/kg body wt). A future experiment to
challenge the mice with 2 g/kg body wt is expected to achieve statistical significance.
204
Figure 36. Glucose intolerance in βSQS-/- mice
Intraperitoneal glucose (1 g/kg body wt) tolerance tests were performed on 16-h–fasted βSQS+/+, βSQS+/-, and βSQS-
/- mice and glucose levels measured as described under materials and methods. Values are means ± SEM of 9 animals per group. A, the βSQS-/- mice display a trend of glucose intolerance compared to wild type βSQS+/+ mice, although statistical significance was observed only at 120 min time point (* P < 0.05 for βSQS-/- vs. βSQS+/+ mice). B, Area under curve from A, showing that βSQS-/- mice display a trend of glucose intolerance compared to wild type littermate, but not statistically significant (P = 0.11).
205
6.4.5 βSQS-/- Mice Exhibit a Trend of Impaired in vivo Glucose-Stimulated Insulin Secretion
To further determine β-cell function of the βSQS-/- mice, in vivo insulin secretion was measured
after glucose challenge (1 g/kg body wt). No change of the blood insulin levels was found for the
heterozygous βSQS+/- mice and the homozygous βSQS-/- mice at basal condition (before glucose
challenge) and 15 min after glucose load comparing to control wild type βSQS+/+ mice (n = 9)
(Figure 37). At the time point of 3 min after glucose load, βSQS mutant mice exhibit an obvious
trend of impaired glucose-stimulated insulin secretion, although it is not statistically significant.
This seems due to the big variation of the data even if I have measured 9 mice for each group. It
could also be due to a possible compensatory increase in cholesterol uptake by the mutant β-cells
to maintain their cholesterol homeostasis and function. As proposed for IPGTT experiments,
higher glucose at 2 g/kg body wt should be tested for a stronger glucose-stimulated insulin
secretion. Furthermore, 2 min time point should be examined in order to catch the first phase
insulin secretion, since the peak of insulin secretion may be missed at 3 min time point.
206
Figure 37. in vivo insulin secretory response of βSQS-/- mice to a glucose challenge
Intraperitoneal glucose (1 g/kg body wt) challenge test was performed on 16-h-fasted βSQS+/+, βSQS+/-, and βSQS-/- mice and serum insulin levels measured with ELISA insulin assay kit. A mean ± SEM of 9 animals per group was shown. βSQS mutant mice displayed a trend of impaired glucose-stimulated insulin secretion at 3 min after glucose challenge, however it is not statistically significant.
207
6.5 Discussion
6.5.1 General Considerations on Generating β-Cell Specific SQS Null Mice
Here I have aimed to investigate the effect of depleting endogenous cholesterol biosynthesis in
pancreatic β-cell insulin secretion in vivo. I have generated β-cell specific SQS knockout mice by
loxP/Cre recombination system. The SQS-floxed mice with conditional allele of SQS gene have
been previously characterized and develop normally (Saher et al., 2005). A recent report
suggested that RIP-Cre mice alone exhibited glucose intolerance, possibly due to impaired
insulin secretion (Lee et al., 2006). The RIP-Cre mice used in my loxP/Cre recombination
system were provided by Dr. Minna Woo’s laboratory and have been characterized as having
normal glucose tolerance and in vivo insulin secretion (Liadis et al., 2007). However, a
precaution still was taken by using the control mice with RIP-Cre background. Specifically, all
three different genotypes of the mice (βSQS+/+, βSQS+/- and βSQS-/-) are Cre-positive, precluding
any possible impact from Cre transgenic mice. Some neurons in hypothalamus have insulin
promoter, and therefore can express Cre recombinase as well, resulting in a possible deletion of
the SQS gene in these insulin secreting neurons. Both βSQS+/- and βSQS-/- mice developed
normally. I did not observe any changes in body weight and activity in mutant mice, suggesting
there is no effect on hypothalamic function.
6.5.2 Role of Endogenous β-Cell Cholesterol in Maintaining Normal Insulin Secretion
In Chapter Four, I have demonstrated a critical role of endogenous β-cell cholesterol on insulin
secretion by in vitro pharmacological blockade of cholesterol biosynthesis (Xia et al., 2008). In
vivo studies indicated that SQS null mice displayed both a trend of glucose intolerance and a
trend of impaired in vivo glucose-stimulated insulin secretion. The fact that I only observed a
208
significant change of glucose tolerance at 120 min after glucose challenge and no statistically
significant change of insulin secretion could be due to two reasons. The first is that the amount of
glucose used to challenge mice is low. To further determine the phenotypes of βSQS-/- mice,
IPGTT and glucose-stimulated insulin secretion should be performed by using higher amount of
glucose, such as 2 g/kg body wt. The second is that β-cells could have compensated for
cholesterol deficiency via an increased cholesterol uptake. Cellular cholesterol comes from two
sources, endogenous biosynthesis and exogenous uptake. It has been estimated that humans
synthesize ~1 g and ingest ~0.4 g of cholesterol per day (Grundy, 1983). Knocking out of β-cell
SQS gene only blocks the pathway of endogenous cholesterol biosynthesis. The cells can still
take up more cholesterol from the circulation or other neighboring islet cells to compensate for
the loss of endogenous cholesterol (Figure 38). Receptor-mediated uptake of lipoprotein particles
is the major pathway of exogenous cholesterol entering cells. Low-density lipoprotein (LDL)
binds to the LDL receptor on the plasma membrane, being internalized and cholesterol is freed
from LDL particles (Matter et al., 1993;Sugii et al., 2003). LDL receptor has been found to be
expressed in pancreatic β-cells from mouse, rat and human (Grupping et al., 1997;Roehrich et al.,
2003). This in vivo study with the β-cell specific SQS mutant mouse model suggests that
cholesterol uptake by pancreatic β-cells may play an important role for cellular cholesterol
homeostasis.
209
Figure 38. βSQS-/- mice compensate for the loss of endogenous cholesterol through cholesterol uptake
Cholesterol of pancreatic β-cells comes from two sources, 1) endogenous cholesterol synthesis in ER and 2) exogenous cholesterol uptake via LDL receptor.3) Knockout of SQS causes an ablation of endogenous cholesterol, 4) which can be compensated by the increased exogenous cholesterol uptake from the circulation or the neighboring α- and δ-cells. Therefore, β-cells can maintain normal function of cholesterol / lipid rafts, ion channels and SNARE proteins necessary for insulin exocytosis.
210
Animal models of whole body cholesterol synthesis deficiency were recently generated by
globally knocking out the genes responsible for the last two steps of cholesterol synthesis (7-
dehydrocholesterol reductase for Dhcr7-/- mice; lathosterol-5-desaturase for Sc5d-/- mice)
(Gondre-Lewis et al., 2006). They demonstrated that global blockade of cholesterol synthesis
caused not only impaired secretion in vivo, but also aberrant granule formation in both exocrine
and endocrine pancreas. The major difference between the β-cell specific knockout of
cholesterol biosynthesis (βSQS-/- mice) in my study and the global knockout of this pathway by
Gondre-Lewis et al (Dhcr7-/- and Sc5d-/- mice) is that cholesterol in the circulation and other
tissues are normal in βSQS-/- mice, whereas Dhcr7-/- and Sc5d-/- mice lack cholesterol globally
(Gondre-Lewis et al., 2006). Therefore, β-cells from βSQS-/- mice could have developed normal
function through an increased cholesterol uptake from the normal neighboring islet cells or the
circulation, implicating indirectly the redundant capability of β-cells to maintain cholesterol
homeostasis required for normal function of insulin granule biogenesis and exocytosis.
6.5.3 Further in vivo and ex vivo Studies on βSQS-/- Mice to Reveal Critical Roles of Endogenous Cholesterol on β-Cell Exocytosis
It should be noted that the present study generated and made a preliminary characterization of
the βSQS knockout mice, and that further investigations are required to determine the critical
role of endogenous cholesterol on β-cell stimulus-secretion coupling. Both further in vivo and ex
vivo studies will be very informative for roles of endogenous cholesterol on maintaining normal
function of pancreatic β-cells and regulating insulin secretion. Firstly, I hypothesize that βSQS-/-
mice could be more resistant to an elevated plasma or cellular cholesterol. Double mutant of
apolipoprotein E-deficient (apoE-/-) mice crossed with leptin-deficient (ob/ob) mice have recently
been reported to display an elevated cholesterol level in plasma and pancreatic islets, causing
211
impaired insulin secretion due to the toxicity of cholesterol (Hao et al., 2007). Crossing of these
apoE-/- x ob/ob mice with βSQS-/- mice is expected to generate mice resistant to cholesterol
toxicity on β-cells. Alternatively, βSQS-/- mice are expected to be more resistant to a high
cholesterol diet. Secondly, ex vivo studies on βSQS-/- mice are warranted to delineate an essential
role of endogenous cholesterol on β-cell stimulus-secretion coupling. All of the experiments on
the pharmacological inhibition of cholesterol synthesis were performed by an in vitro incubation
of β-cells or islets with the drug in lipid-free FBS culture medium, therefore precluding
exogenous cholesterol uptake from the medium (Chapter Four). β-Cells isolated from βSQS-/-
mice are expected to display impaired insulin secretion due to the loss of compensatory
cholesterol uptake ex vivo. Capacitance measurement and ion channel recordings on the β-cells
isolated from βSQS-/-, when cultured under lipid-free FBS medium, are also expected to show a
possibly impaired function of CaV and KV channels and exocytotic machinery as observed by in
vitro pharmacological blockade of cholesterol biosynthesis. Furthermore, measurement of islet
cholesterol level will confirm the effect on knocking out the cholesterol synthesis pathway of β-
cells.
Taken together, I have generated and made a preliminary characterization of β-cell specific SQS
knockout mice by loxP/Cre recombination system. βSQS-/- mice develop normally, and display a
trend of glucose intolerance and a trend of impaired glucose-stimulated insulin secretion. The
statistically insignificant change of in vivo insulin secretion could be a result of the larger
variation of the data collected or a possible compensatory increase of exogenous cholesterol
uptake. Generation of SQS null mice provides a novel model for further in vivo and ex vivo
studies on critical roles of endogenous cholesterol in maintaining normal function of β-cell
stimulus-secretion coupling.
212
Reference List Aguilar-Bryan, L., Nichols, C. G., Wechsler, S. W., Clement, J. P., Boyd, A. E., III, Gonzalez, G., Herrera-Sosa, H., Nguy, K., Bryan, J., & Nelson, D. A. (1995). Cloning of the beta cell high-affinity sulfonylurea receptor: a regulator of insulin secretion. Science 268, 423-426.
Alberti, K. G. & Zimmet, P. Z. (1998). Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet.Med. 15, 539-553.
Allen, J. A., Halverson-Tamboli, R. A., & Rasenick, M. M. (2007). Lipid raft microdomains and neurotransmitter signalling. Nat.Rev.Neurosci. 8, 128-140.
Anderson, J. W., Kendall, C. W., & Jenkins, D. J. (2003). Importance of weight management in type 2 diabetes: review with meta-analysis of clinical studies. J Am.Coll.Nutr. 22, 331-339.
Arikkath, J. & Campbell, K. P. (2003). Auxiliary subunits: essential components of the voltage-gated calcium channel complex. Curr.Opin.Neurobiol. 13, 298-307.
Asfari, M., Janjic, D., Meda, P., Li, G., Halban, P. A., & Wollheim, C. B. (1992). Establishment of 2-mercaptoethanol-dependent differentiated insulin-secreting cell lines. Endocrinology 130, 167-178.
Ashcroft, F. M. (2005). ATP-sensitive potassium channelopathies: focus on insulin secretion. J Clin.Invest 115, 2047-2058.
Ashcroft, F. M. & Gribble, F. M. (2000). New windows on the mechanism of action of K(ATP) channel openers. Trends Pharmacol.Sci. 21, 439-445.
Ashcroft, F. M., Harrison, D. E., & Ashcroft, S. J. (1984). Glucose induces closure of single potassium channels in isolated rat pancreatic beta-cells. Nature 312, 446-448.
Ashcroft, F. M., Kakei, M., Gibson, J. S., Gray, D. W., & Sutton, R. (1989). The ATP- and tolbutamide-sensitivity of the ATP-sensitive K-channel from human pancreatic B cells. Diabetologia 32, 591-598.
Ashcroft, F. M. & Rorsman, P. (1989). Electrophysiology of the pancreatic beta-cell. Prog.Biophys.Mol.Biol. 54, 87-143.
213
Ashcroft, F. M. & Rorsman, P. (1990). ATP-sensitive K+ channels: a link between B-cell metabolism and insulin secretion. Biochem.Soc.Trans. 18, 109-111.
Atlas, D. (2001). Functional and physical coupling of voltage-sensitive calcium channels with exocytotic proteins: ramifications for the secretion mechanism. J.Neurochem. 77, 972-985.
Avruch, J. (1998). Insulin signal transduction through protein kinase cascades. Mol.Cell Biochem. 182, 31-48.
Barg, S. (2003). Mechanisms of exocytosis in insulin-secreting B-cells and glucagon-secreting A-cells. Pharmacol.Toxicol. 92, 3-13.
Barg, S., Galvanovskis, J., Gopel, S. O., Rorsman, P., & Eliasson, L. (2000). Tight coupling between electrical activity and exocytosis in mouse glucagon-secreting alpha-cells. Diabetes 49, 1500-1510.
Barg, S., Ma, X., Eliasson, L., Galvanovskis, J., Gopel, S. O., Obermuller, S., Platzer, J., Renstrom, E., Trus, M., Atlas, D., Striessnig, J., & Rorsman, P. (2001). Fast exocytosis with few Ca(2+) channels in insulin-secreting mouse pancreatic B cells. Biophys.J 81, 3308-3323.
Baron, A. D., Schaeffer, L., Shragg, P., & Kolterman, O. G. (1987). Role of hyperglucagonemia in maintenance of increased rates of hepatic glucose output in type II diabetics. Diabetes 36, 274-283.
Beaven, S. W. & Tontonoz, P. (2006). Nuclear receptors in lipid metabolism: targeting the heart of dyslipidemia. Annu.Rev.Med. 57, 313-329.
Beeson, M., Sajan, M. P., Dizon, M., Grebenev, D., Gomez-Daspet, J., Miura, A., Kanoh, Y., Powe, J., Bandyopadhyay, G., Standaert, M. L., & Farese, R. V. (2003). Activation of protein kinase C-zeta by insulin and phosphatidylinositol-3,4,5-(PO4)3 is defective in muscle in type 2 diabetes and impaired glucose tolerance: amelioration by rosiglitazone and exercise. Diabetes 52, 1926-1934.
Best, J. D., Judzewitsch, R. G., Pfeifer, M. A., Beard, J. C., Halter, J. B., & Porte, D., Jr. (1982). The effect of chronic sulfonylurea therapy on hepatic glucose production in non-insulin-dependent diabetes. Diabetes 31, 333-338.
Betz, A., Okamoto, M., Benseler, F., & Brose, N. (1997). Direct interaction of the rat unc-13 homologue Munc13-1 with the N terminus of syntaxin. J.Biol.Chem. 272, 2520-2526.
214
Bickel, P. E. (2002). Lipid rafts and insulin signaling. Am.J.Physiol Endocrinol.Metab 282, E1-E10.
Bingley, P. J., Bonifacio, E., Williams, A. J., Genovese, S., Bottazzo, G. F., & Gale, E. A. (1997). Prediction of IDDM in the general population: strategies based on combinations of autoantibody markers. Diabetes 46, 1701-1710.
Bist, A., Fielding, P. E., & Fielding, C. J. (1997). Two sterol regulatory element-like sequences mediate up-regulation of caveolin gene transcription in response to low density lipoprotein free cholesterol. Proc.Natl.Acad.Sci.U.S.A 94, 10693-10698.
Bode, H. P., Weber, S., Fehmann, H. C., & Goke, B. (1999). A nutrient-regulated cytosolic calcium oscillator in endocrine pancreatic glucagon-secreting cells. Pflugers Arch. 437, 324-334.
Bokvist, K., Eliasson, L., Ammala, C., Renstrom, E., & Rorsman, P. (1995). Co-localization of L-type Ca2+ channels and insulin-containing secretory granules and its significance for the initiation of exocytosis in mouse pancreatic B-cells. EMBO J 14, 50-57.
Bokvist, K., Olsen, H. L., Hoy, M., Gotfredsen, C. F., Holmes, W. F., Buschard, K., Rorsman, P., & Gromada, J. (1999). Characterisation of sulphonylurea and ATP-regulated K+ channels in rat pancreatic A-cells. Pflugers Arch. 438, 428-436.
Bonifacio, E., Bingley, P. J., Shattock, M., Dean, B. M., Dunger, D., Gale, E. A., & Bottazzo, G. F. (1990). Quantification of islet-cell antibodies and prediction of insulin-dependent diabetes. Lancet 335, 147-149.
Borg, M. A., Tamborlane, W. V., Shulman, G. I., & Sherwin, R. S. (2003). Local lactate perfusion of the ventromedial hypothalamus suppresses hypoglycemic counterregulation. Diabetes 52, 663-666.
Bradfute, D. L., Silva, C. J., & Simoni, R. D. (1992). Squalene synthase-deficient mutant of Chinese hamster ovary cells. J.Biol.Chem. 267, 18308-18314.
Brose, N., Hofmann, K., Hata, Y., & Sudhof, T. C. (1995). Mammalian homologues of Caenorhabditis elegans unc-13 gene define novel family of C2-domain proteins. J.Biol.Chem. 270, 25273-25280.
Brown, D. A. & London, E. (2000). Structure and function of sphingolipid- and cholesterol-rich membrane rafts. J Biol.Chem. 275, 17221-17224.
215
Brown, D. A. & Rose, J. K. (1992). Sorting of GPI-anchored proteins to glycolipid-enriched membrane subdomains during transport to the apical cell surface. Cell 68, 533-544.
Brownlee, M. (2001). Biochemistry and molecular cell biology of diabetic complications. Nature 414, 813-820.
Brubaker, P. L. & Drucker, D. J. (2004). Minireview: Glucagon-like peptides regulate cell proliferation and apoptosis in the pancreas, gut, and central nervous system. Endocrinology 145, 2653-2659.
Brunger, A. T. (2000). Structural insights into the molecular mechanism of Ca(2+)-dependent exocytosis. Curr.Opin.Neurobiol. 10, 293-302.
Brunger, A. T. (2005). Structure and function of SNARE and SNARE-interacting proteins. Q.Rev.Biophys. 38, 1-47.
Brunham, L. R., Kruit, J. K., Pape, T. D., Timmins, J. M., Reuwer, A. Q., Vasanji, Z., Marsh, B. J., Rodrigues, B., Johnson, J. D., Parks, J. S., Verchere, C. B., & Hayden, M. R. (2007). Beta-cell ABCA1 influences insulin secretion, glucose homeostasis and response to thiazolidinedione treatment. Nat.Med. 13, 340-347.
Brunicardi, F. C., Kleinman, R., Moldovan, S., Nguyen, T. H., Watt, P. C., Walsh, J., & Gingerich, R. (2001). Immunoneutralization of somatostatin, insulin, and glucagon causes alterations in islet cell secretion in the isolated perfused human pancreas. Pancreas 23, 302-308.
Bruning, J. C., Gautam, D., Burks, D. J., Gillette, J., Schubert, M., Orban, P. C., Klein, R., Krone, W., Muller-Wieland, D., & Kahn, C. R. (2000). Role of brain insulin receptor in control of body weight and reproduction. Science 289, 2122-2125.
Brunner, Y., Coute, Y., Iezzi, M., Foti, M., Fukuda, M., Hochstrasser, D. F., Wollheim, C. B., & Sanchez, J. C. (2007). Proteomics analysis of insulin secretory granules. Mol.Cell Proteomics. 6, 1007-1017.
Bruns, D. & Jahn, R. (2002). Molecular determinants of exocytosis. Pflugers Arch. 443, 333-338.
Bruns, R. R. & Palade, G. E. (1968). Studies on blood capillaries. II. Transport of ferritin molecules across the wall of muscle capillaries. J.Cell Biol. 37, 277-299.
216
Bryant, N. J., Govers, R., & James, D. E. (2002). Regulated transport of the glucose transporter GLUT4. Nat.Rev.Mol.Cell Biol. 3, 267-277.
Calakos, N. & Scheller, R. H. (1996). Synaptic vesicle biogenesis, docking, and fusion: a molecular description. Physiol Rev. 76, 1-29.
Capozza, F., Combs, T. P., Cohen, A. W., Cho, Y. R., Park, S. Y., Schubert, W., Williams, T. M., Brasaemle, D. L., Jelicks, L. A., Scherer, P. E., Kim, J. K., & Lisanti, M. P. (2005). Caveolin-3 knockout mice show increased adiposity and whole body insulin resistance, with ligand-induced insulin receptor instability in skeletal muscle. Am.J.Physiol Cell Physiol 288, C1317-C1331.
Catterall, W. A. (2000). Structure and regulation of voltage-gated Ca2+ channels. Annu.Rev.Cell Dev.Biol. 16, 521-555.
CDA (2007). http://www.diabetes.ca/Section_About/prevalence.asp. Canadian Diabetges Association Website.
Cejvan, K., Coy, D. H., & Efendic, S. (2003). Intra-islet somatostatin regulates glucagon release via type 2 somatostatin receptors in rats. Diabetes 52, 1176-1181.
Chamberlain, L. H., Burgoyne, R. D., & Gould, G. W. (2001). SNARE proteins are highly enriched in lipid rafts in PC12 cells: implications for the spatial control of exocytosis. Proc.Natl.Acad.Sci.U.S.A 98, 5619-5624.
Chan, C. B., MacPhail, R. M., Sheu, L., Wheeler, M. B., & Gaisano, H. Y. (1999). Beta-cell hypertrophy in fa/fa rats is associated with basal glucose hypersensitivity and reduced SNARE protein expression. Diabetes 48, 997-1005.
Chang, T. Y., Chang, C. C., Ohgami, N., & Yamauchi, Y. (2006). Cholesterol sensing, trafficking, and esterification. Annu.Rev.Cell Dev.Biol. 22, 129-157.
Chang, T. Y., Reid, P. C., Sugii, S., Ohgami, N., Cruz, J. C., & Chang, C. C. (2005). Niemann-Pick type C disease and intracellular cholesterol trafficking. J.Biol.Chem. 280, 20917-20920.
Chen, H. Q., Tannous, M., Veluthakal, R., Amin, R., & Kowluru, A. (2003). Novel roles for palmitoylation of Ras in IL-1 beta-induced nitric oxide release and caspase 3 activation in insulin-secreting beta cells. Biochem.Pharmacol. 66, 1681-1694.
217
Chintagari, N. R., Jin, N., Wang, P., Narasaraju, T. A., Chen, J., & Liu, L. (2006). Effect of cholesterol depletion on exocytosis of alveolar type II cells. Am.J.Respir.Cell Mol.Biol. 34, 677-687.
Cho, S. J., Kelly, M., Rognlien, K. T., Cho, J. A., Horber, J. K., & Jena, B. P. (2002). SNAREs in opposing bilayers interact in a circular array to form conducting pores. Biophys.J. 83, 2522-2527.
Cho, W. J., Jeremic, A., Jin, H., Ren, G., & Jena, B. P. (2007). Neuronal fusion pore assembly requires membrane cholesterol. Cell Biol.Int. 31, 1301-1308.
Choudhury, A., Dominguez, M., Puri, V., Sharma, D. K., Narita, K., Wheatley, C. L., Marks, D. L., & Pagano, R. E. (2002). Rab proteins mediate Golgi transport of caveola-internalized glycosphingolipids and correct lipid trafficking in Niemann-Pick C cells. J.Clin.Invest 109, 1541-1550.
Christian, A. E., Haynes, M. P., Phillips, M. C., & Rothblat, G. H. (1997). Use of cyclodextrins for manipulating cellular cholesterol content. J Lipid Res. 38, 2264-2272.
Chugh, A., Ray, A., & Gupta, J. B. (2003). Squalene epoxidase as hypocholesterolemic drug target revisited. Prog.Lipid Res. 42, 37-50.
Churchward, M. A., Rogasevskaia, T., Hofgen, J., Bau, J., & Coorssen, J. R. (2005). Cholesterol facilitates the native mechanism of Ca2+-triggered membrane fusion. J.Cell Sci. 118, 4833-4848.
Chutkow, W. A., Simon, M. C., Le Beau, M. M., & Burant, C. F. (1996). Cloning, tissue expression, and chromosomal localization of SUR2, the putative drug-binding subunit of cardiac, skeletal muscle, and vascular KATP channels. Diabetes 45, 1439-1445.
Clement, J. P., Kunjilwar, K., Gonzalez, G., Schwanstecher, M., Panten, U., Aguilar-Bryan, L., & Bryan, J. (1997). Association and stoichiometry of K(ATP) channel subunits. Neuron 18, 827-838.
Cnop, M., Grupping, A., Hoorens, A., Bouwens, L., Pipeleers-Marichal, M., & Pipeleers, D. (2000). Endocytosis of low-density lipoprotein by human pancreatic beta cells and uptake in lipid-storing vesicles, which increase with age. Am.J.Pathol. 156, 237-244.
Cohen, A. W., Combs, T. P., Scherer, P. E., & Lisanti, M. P. (2003a). Role of caveolin and caveolae in insulin signaling and diabetes. Am.J.Physiol Endocrinol.Metab 285, E1151-E1160.
218
Cohen, A. W., Razani, B., Wang, X. B., Combs, T. P., Williams, T. M., Scherer, P. E., & Lisanti, M. P. (2003b). Caveolin-1-deficient mice show insulin resistance and defective insulin receptor protein expression in adipose tissue. Am.J.Physiol Cell Physiol 285, C222-C235.
Couet, J., Li, S., Okamoto, T., Ikezu, T., & Lisanti, M. P. (1997). Identification of peptide and protein ligands for the caveolin-scaffolding domain. Implications for the interaction of caveolin with caveolae-associated proteins. J.Biol.Chem. 272, 6525-6533.
Cryer, P. E., Davis, S. N., & Shamoon, H. (2003). Hypoglycemia in diabetes. Diabetes Care 26, 1902-1912.
Curry, D. L., Bennett, L. L., & Grodsky, G. M. (1968). Dynamics of insulin secretion by the perfused rat pancreas. Endocrinology 83, 572-584.
Curtis, B. M. & Catterall, W. A. (1984). Purification of the calcium antagonist receptor of the voltage-sensitive calcium channel from skeletal muscle transverse tubules. Biochemistry 23, 2113-2118.
D'Alessio, D. A. & Vahl, T. P. (2004). Glucagon-like peptide 1: evolution of an incretin into a treatment for diabetes. Am.J Physiol Endocrinol.Metab 286, E882-E890.
Darby, P. J., Kwan, C. Y., & Daniel, E. E. (2000). Caveolae from canine airway smooth muscle contain the necessary components for a role in Ca(2+) handling. Am.J.Physiol Lung Cell Mol.Physiol 279, L1226-L1235.
Davalli, A. M., Biancardi, E., Pollo, A., Socci, C., Pontiroli, A. E., Pozza, G., Clementi, F., Sher, E., & Carbone, E. (1996). Dihydropyridine-sensitive and -insensitive voltage-operated calcium channels participate in the control of glucose-induced insulin release from human pancreatic beta cells. J.Endocrinol. 150, 195-203.
Davies, A., Douglas, L., Hendrich, J., Wratten, J., Tran, V. M., Foucault, I., Koch, D., Pratt, W. S., Saibil, H. R., & Dolphin, A. C. (2006). The calcium channel alpha2delta-2 subunit partitions with CaV2.1 into lipid rafts in cerebellum: implications for localization and function. J Neurosci. 26, 8748-8757.
de Almeida, R. F., Fedorov, A., & Prieto, M. (2003). Sphingomyelin/phosphatidylcholine/cholesterol phase diagram: boundaries and composition of lipid rafts. Biophys.J. 85, 2406-2416.
219
de Almeida, R. F., Loura, L. M., Fedorov, A., & Prieto, M. (2005). Lipid rafts have different sizes depending on membrane composition: a time-resolved fluorescence resonance energy transfer study. J.Mol.Biol. 346, 1109-1120.
Del Prato, S. & Marchetti, P. (2004). Beta- and alpha-cell dysfunction in type 2 diabetes. Horm.Metab Res. 36, 775-781.
Del Prato, S. & Pulizzi, N. (2006). The place of sulfonylureas in the therapy for type 2 diabetes mellitus. Metabolism 55, S20-S27.
Detimary, P., Dejonghe, S., Ling, Z., Pipeleers, D., Schuit, F., & Henquin, J. C. (1998). The changes in adenine nucleotides measured in glucose-stimulated rodent islets occur in beta cells but not in alpha cells and are also observed in human islets. J.Biol.Chem. 273, 33905-33908.
Dietschy, J. M., Turley, S. D., & Spady, D. K. (1993). Role of liver in the maintenance of cholesterol and low density lipoprotein homeostasis in different animal species, including humans. J.Lipid Res. 34, 1637-1659.
Dietze, D., Koenen, M., Rohrig, K., Horikoshi, H., Hauner, H., & Eckel, J. (2002). Impairment of insulin signaling in human skeletal muscle cells by co-culture with human adipocytes. Diabetes 51, 2369-2376.
Dietze, D., Ramrath, S., Ritzeler, O., Tennagels, N., Hauner, H., & Eckel, J. (2004). Inhibitor kappaB kinase is involved in the paracrine crosstalk between human fat and muscle cells. Int.J Obes.Relat Metab Disord. 28, 985-992.
Dietze-Schroeder, D., Sell, H., Uhlig, M., Koenen, M., & Eckel, J. (2005). Autocrine action of adiponectin on human fat cells prevents the release of insulin resistance-inducing factors. Diabetes 54, 2003-2011.
Doliba, N. M., Qin, W., Vatamaniuk, M. Z., Buettger, C. W., Collins, H. W., Magnuson, M. A., Kaestner, K. H., Wilson, D. F., Carr, R. D., & Matschinsky, F. M. (2006). Cholinergic regulation of fuel-induced hormone secretion and respiration of SUR1-/- mouse islets. Am.J.Physiol Endocrinol.Metab 291, E525-E535.
Drucker, D. J. (2006). The biology of incretin hormones. Cell Metab 3, 153-165.
Dukes, I. D. & Philipson, L. H. (1996). K+ channels: generating excitement in pancreatic beta-cells. Diabetes 45, 845-853.
220
Dulubova, I., Lou, X., Lu, J., Huryeva, I., Alam, A., Schneggenburger, R., Sudhof, T. C., & Rizo, J. (2005). A Munc13/RIM/Rab3 tripartite complex: from priming to plasticity? EMBO J. 24, 2839-2850.
Dunne, M. J., Cosgrove, K. E., Shepherd, R. M., Aynsley-Green, A., & Lindley, K. J. (2004). Hyperinsulinism in infancy: from basic science to clinical disease. Physiol Rev. 84, 239-275.
Dunning, B. E., Foley, J. E., & Ahren, B. (2005). Alpha cell function in health and disease: influence of glucagon-like peptide-1. Diabetologia 48, 1700-1713.
Dupree, P., Parton, R. G., Raposo, G., Kurzchalia, T. V., & Simons, K. (1993). Caveolae and sorting in the trans-Golgi network of epithelial cells. EMBO J. 12, 1597-1605.
Easom, R. A. (2000). Beta-granule transport and exocytosis. Semin.Cell Dev.Biol. 11, 253-266.
Epand, R. M. (2006). Cholesterol and the interaction of proteins with membrane domains. Prog.Lipid Res. 45, 279-294.
Ertel, E. A., Campbell, K. P., Harpold, M. M., Hofmann, F., Mori, Y., Perez-Reyes, E., Schwartz, A., Snutch, T. P., Tanabe, T., Birnbaumer, L., Tsien, R. W., & Catterall, W. A. (2000). Nomenclature of voltage-gated calcium channels. Neuron 25, 533-535.
Evans, M. L., McCrimmon, R. J., Flanagan, D. E., Keshavarz, T., Fan, X., McNay, E. C., Jacob, R. J., & Sherwin, R. S. (2004). Hypothalamic ATP-sensitive K + channels play a key role in sensing hypoglycemia and triggering counterregulatory epinephrine and glucagon responses. Diabetes 53, 2542-2551.
Fehmann, H. C., Strowski, M., & Goke, B. (1995). Functional characterization of somatostatin receptors expressed on hamster glucagonoma cells. Am.J.Physiol 268, E40-E47.
Felig, P., Wahren, J., & Hendler, R. (1978). Influence of maturity-onset diabetes on splanchnic glucose balance after oral glucose ingestion. Diabetes 27, 121-126.
Fernandez, A. M., Kim, J. K., Yakar, S., Dupont, J., Hernandez-Sanchez, C., Castle, A. L., Filmore, J., Shulman, G. I., & Le Roith, D. (2001). Functional inactivation of the IGF-I and insulin receptors in skeletal muscle causes type 2 diabetes. Genes Dev. 15, 1926-1934.
221
Fernandez-Chacon, R., Konigstorfer, A., Gerber, S. H., Garcia, J., Matos, M. F., Stevens, C. F., Brose, N., Rizo, J., Rosenmund, C., & Sudhof, T. C. (2001). Synaptotagmin I functions as a calcium regulator of release probability. Nature 410, 41-49.
Feron, O., Dessy, C., Desager, J. P., & Balligand, J. L. (2001). Hydroxy-methylglutaryl-coenzyme A reductase inhibition promotes endothelial nitric oxide synthase activation through a decrease in caveolin abundance. Circulation 103, 113-118.
Ferrannini, E., Simonson, D. C., Katz, L. D., Reichard, G., Jr., Bevilacqua, S., Barrett, E. J., Olsson, M., & DeFronzo, R. A. (1988). The disposal of an oral glucose load in patients with non-insulin-dependent diabetes. Metabolism 37, 79-85.
Fielding, C. J. & Fielding, P. E. (2001). Caveolae and intracellular trafficking of cholesterol. Adv.Drug Deliv.Rev. 49, 251-264.
Filippov, A., Oradd, G., & Lindblom, G. (2006). Sphingomyelin structure influences the lateral diffusion and raft formation in lipid bilayers. Biophys.J. 90, 2086-2092.
Foster, L. J., De Hoog, C. L., & Mann, M. (2003). Unbiased quantitative proteomics of lipid rafts reveals high specificity for signaling factors. Proc.Natl.Acad.Sci.U.S.A 100, 5813-5818.
Fra, A. M., Pasqualetto, E., Mancini, M., & Sitia, R. (2000). Genomic organization and transcriptional analysis of the human genes coding for caveolin-1 and caveolin-2. Gene 243, 75-83.
Fra, A. M., Williamson, E., Simons, K., & Parton, R. G. (1995). De novo formation of caveolae in lymphocytes by expression of VIP21-caveolin. Proc.Natl.Acad.Sci.U.S.A 92, 8655-8659.
Franklin, I., Gromada, J., Gjinovci, A., Theander, S., & Wollheim, C. B. (2005). Beta-cell secretory products activate alpha-cell ATP-dependent potassium channels to inhibit glucagon release. Diabetes 54, 1808-1815.
Gaisano, H. Y., Ostenson, C. G., Sheu, L., Wheeler, M. B., & Efendic, S. (2002). Abnormal expression of pancreatic islet exocytotic soluble N-ethylmaleimide-sensitive factor attachment protein receptors in Goto-Kakizaki rats is partially restored by phlorizin treatment and accentuated by high glucose treatment. Endocrinology 143, 4218-4226.
Galbiati, F., Razani, B., & Lisanti, M. P. (2001). Emerging themes in lipid rafts and caveolae. Cell 106, 403-411.
222
Gao, Z., Reavey-Cantwell, J., Young, R. A., Jegier, P., & Wolf, B. A. (2000). Synaptotagmin III/VII isoforms mediate Ca2+-induced insulin secretion in pancreatic islet beta -cells. J.Biol.Chem. 275, 36079-36085.
Gaskins, H. R., Baldeon, M. E., Selassie, L., & Beverly, J. L. (1995). Glucose modulates gamma-aminobutyric acid release from the pancreatic beta TC6 cell line. J.Biol.Chem. 270, 30286-30289.
Gelling, R. W., Morton, G. J., Morrison, C. D., Niswender, K. D., Myers, M. G., Jr., Rhodes, C. J., & Schwartz, M. W. (2006). Insulin action in the brain contributes to glucose lowering during insulin treatment of diabetes. Cell Metab 3, 67-73.
Geppert, M., Goda, Y., Hammer, R. E., Li, C., Rosahl, T. W., Stevens, C. F., & Sudhof, T. C. (1994). Synaptotagmin I: a major Ca2+ sensor for transmitter release at a central synapse. Cell 79, 717-727.
Gerich, J. E., Charles, M. A., & Grodsky, G. M. (1974a). Characterization of the effects of arginine and glucose on glucagon and insulin release from the perfused rat pancreas. J Clin.Invest 54, 833-841.
Gerich, J. E., Charles, M. A., & Grodsky, G. M. (1976). Regulation of pancreatic insulin and glucagon secretion. Annu.Rev.Physiol 38, 353-388.
Gerich, J. E., Lorenzi, M., Karam, J. H., Schneider, V., & Forsham, P. H. (1975). Abnormal pancreatic glucagon secretion and postprandial hyperglycemia in diabetes mellitus. JAMA 234, 159-5.
Gerich, J. E., Schneider, V., Dippe, S. E., Langlois, M., Noacco, C., Karam, J. H., & Forsham, P. H. (1974b). Characterization of the glucagon response to hypoglycemia in man. J Clin.Endocrinol.Metab 38, 77-82.
Gil, C., Soler-Jover, A., Blasi, J., & Aguilera, J. (2005). Synaptic proteins and SNARE complexes are localized in lipid rafts from rat brain synaptosomes. Biochem.Biophys.Res.Commun. 329, 117-124.
Gilon, P., Bertrand, G., Loubatieres-Mariani, M. M., Remacle, C., & Henquin, J. C. (1991). The influence of gamma-aminobutyric acid on hormone release by the mouse and rat endocrine pancreas. Endocrinology 129, 2521-2529.
223
Giocondi, M. C., Vie, V., Lesniewska, E., Goudonnet, J. P., & Le Grimellec, C. (2000). In situ imaging of detergent-resistant membranes by atomic force microscopy. J.Struct.Biol. 131, 38-43.
Goldstein, J. L. & Brown, M. S. (1990). Regulation of the mevalonate pathway. Nature 343, 425-430.
Goldstein, J. L., DeBose-Boyd, R. A., & Brown, M. S. (2006). Protein sensors for membrane sterols. Cell 124, 35-46.
Golub, T., Wacha, S., & Caroni, P. (2004). Spatial and temporal control of signaling through lipid rafts. Curr.Opin.Neurobiol. 14, 542-550.
Gondre-Lewis, M. C., Petrache, H. I., Wassif, C. A., Harries, D., Parsegian, A., Porter, F. D., & Loh, Y. P. (2006). Abnormal sterols in cholesterol-deficiency diseases cause secretory granule malformation and decreased membrane curvature. J.Cell Sci. 119, 1876-1885.
Goodwin, J. S., Drake, K. R., Remmert, C. L., & Kenworthy, A. K. (2005). Ras diffusion is sensitive to plasma membrane viscosity. Biophys.J. 89, 1398-1410.
Gopel, S., Zhang, Q., Eliasson, L., Ma, X. S., Galvanovskis, J., Kanno, T., Salehi, A., & Rorsman, P. (2004). Capacitance measurements of exocytosis in mouse pancreatic alpha-, beta- and delta-cells within intact islets of Langerhans. J.Physiol 556, 711-726.
Gopel, S. O., Kanno, T., Barg, S., & Rorsman, P. (2000a). Patch-clamp characterisation of somatostatin-secreting -cells in intact mouse pancreatic islets. J.Physiol 528, 497-507.
Gopel, S. O., Kanno, T., Barg, S., Weng, X. G., Gromada, J., & Rorsman, P. (2000b). Regulation of glucagon release in mouse -cells by KATP channels and inactivation of TTX-sensitive Na+ channels. J.Physiol 528, 509-520.
Gorus, F. K., Malaisse, W. J., & Pipeleers, D. G. (1984). Differences in glucose handling by pancreatic A- and B-cells. J.Biol.Chem. 259, 1196-1200.
Gribble, F. M. & Reimann, F. (2003). Sulphonylurea action revisited: the post-cloning era. Diabetologia 46, 875-891.
Gribble, F. M., Tucker, S. J., & Ashcroft, F. M. (1997). The essential role of the Walker A motifs of SUR1 in K-ATP channel activation by Mg-ADP and diazoxide. EMBO J. 16, 1145-1152.
224
Gromada, J., Bokvist, K., Ding, W. G., Barg, S., Buschard, K., Renstrom, E., & Rorsman, P. (1997). Adrenaline stimulates glucagon secretion in pancreatic A-cells by increasing the Ca2+ current and the number of granules close to the L-type Ca2+ channels. J.Gen.Physiol 110, 217-228.
Gromada, J., Franklin, I., & Wollheim, C. B. (2007). alpha-Cells of the Endocrine Pancreas: 35 Years of Research but the Enigma Remains. Endocr.Rev. 28, 84-116.
Gromada, J., Hoy, M., Buschard, K., Salehi, A., & Rorsman, P. (2001a). Somatostatin inhibits exocytosis in rat pancreatic alpha-cells by G(i2)-dependent activation of calcineurin and depriming of secretory granules. J Physiol 535, 519-532.
Gromada, J., Hoy, M., Olsen, H. L., Gotfredsen, C. F., Buschard, K., Rorsman, P., & Bokvist, K. (2001b). Gi2 proteins couple somatostatin receptors to low-conductance K+ channels in rat pancreatic alpha-cells. Pflugers Arch. 442, 19-26.
Gromada, J., Ma, X., Hoy, M., Bokvist, K., Salehi, A., Berggren, P. O., & Rorsman, P. (2004). ATP-sensitive K+ channel-dependent regulation of glucagon release and electrical activity by glucose in wild-type and SUR1-/- mouse alpha-cells. Diabetes 53 Suppl 3, S181-S189.
Grundy, S. M. (1983). Absorption and metabolism of dietary cholesterol. Annu.Rev.Nutr. 3, 71-96.
Grupping, A. Y., Cnop, M., Van Schravendijk, C. F., Hannaert, J. C., Van Berkel, T. J., & Pipeleers, D. G. (1997). Low density lipoprotein binding and uptake by human and rat islet beta cells. Endocrinology 138, 4064-4068.
Grynkiewicz, G., Poenie, M., & Tsien, R. Y. (1985). A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol.Chem. 260, 3440-3450.
Gu, P., Ishii, Y., Spencer, T. A., & Shechter, I. (1998). Function-structure studies and identification of three enzyme domains involved in the catalytic activity in rat hepatic squalene synthase. J.Biol.Chem. 273, 12515-12525.
Gustavsson, J., Parpal, S., & Stralfors, P. (1996). Insulin-stimulated glucose uptake involves the transition of glucose transporters to a caveolae-rich fraction within the plasma membrane: implications for type II diabetes. Mol.Med. 2, 367-372.
225
Gustavsson, N., Lao, Y., Maximov, A., Chuang, J. C., Kostromina, E., Repa, J. J., Li, C., Radda, G. K., Sudhof, T. C., & Han, W. (2008). Impaired insulin secretion and glucose intolerance in synaptotagmin-7 null mutant mice. Proc.Natl.Acad.Sci.U.S.A 105, 3992-3997.
Haffner, S. M. (1998). Epidemiology of type 2 diabetes: risk factors. Diabetes Care 21 Suppl 3, C3-C6.
Hahn, H. J., Gottschling, H. D., & Woltanski, P. (1978). Effect of somatostatin on insulin secretion and cAMP content of isolated pancreatic rat islets. Metabolism 27, 1291-1294.
Hahn, H. J., Ziegler, M., & Mohr, E. (1974). Inhibition of glucagon secretion by glucose and glyceraldehyde on isolated islets of Wistar rats. FEBS Lett. 49, 100-102.
Haines, T. H. (2001). Do sterols reduce proton and sodium leaks through lipid bilayers? Prog.Lipid Res. 40, 299-324.
Hamaguchi, K. & Leiter, E. H. (1990). Comparison of cytokine effects on mouse pancreatic alpha-cell and beta-cell lines. Viability, secretory function, and MHC antigen expression. Diabetes 39, 415-425.
Hancock, J. F. (2006). Lipid rafts: contentious only from simplistic standpoints. Nat.Rev.Mol.Cell Biol. 7, 456-462.
Hao, M., Head, W. S., Gunawardana, S. C., Hasty, A. H., & Piston, D. W. (2007). Direct effect of cholesterol on insulin secretion: a novel mechanism for pancreatic beta-cell dysfunction. Diabetes 56, 2328-2338.
Hashimoto, N., Kido, Y., Uchida, T., Asahara, S., Shigeyama, Y., Matsuda, T., Takeda, A., Tsuchihashi, D., Nishizawa, A., Ogawa, W., Fujimoto, Y., Okamura, H., Arden, K. C., Herrera, P. L., Noda, T., & Kasuga, M. (2006). Ablation of PDK1 in pancreatic beta cells induces diabetes as a result of loss of beta cell mass. Nat.Genet. 38, 589-593.
Hata, Y. & Sudhof, T. C. (1995). A novel ubiquitous form of Munc-18 interacts with multiple syntaxins. Use of the yeast two-hybrid system to study interactions between proteins involved in membrane traffic. J.Biol.Chem. 270, 13022-13028.
He, Y., Kang, Y., Leung, Y. M., Xia, F., Gao, X., Xie, H., Gaisano, H. Y., & Tsushima, R. G. (2006). Modulation of Kv2.1 channel gating and TEA sensitivity by distinct domains of SNAP-25. Biochem.J. 396, 363-369.
226
Heding, L. G. (1971). Radioimmunological determination of pancreatic and gut glucagon in plasma. Diabetologia 7, 10-19.
Heimberg, H., De Vos, A., Moens, K., Quartier, E., Bouwens, L., Pipeleers, D., Van Schaftingen, E., Madsen, O., & Schuit, F. (1996). The glucose sensor protein glucokinase is expressed in glucagon-producing alpha-cells. Proc.Natl.Acad.Sci.U.S.A 93, 7036-7041.
Heimberg, H., De Vos, A., Pipeleers, D., Thorens, B., & Schuit, F. (1995). Differences in glucose transporter gene expression between rat pancreatic alpha- and beta-cells are correlated to differences in glucose transport but not in glucose utilization. J Biol.Chem. 270, 8971-8975.
Heino, S., Lusa, S., Somerharju, P., Ehnholm, C., Olkkonen, V. M., & Ikonen, E. (2000). Dissecting the role of the golgi complex and lipid rafts in biosynthetic transport of cholesterol to the cell surface. Proc.Natl.Acad.Sci.U.S.A 97, 8375-8380.
Heller, R. S., Kieffer, T. J., & Habener, J. F. (1997). Insulinotropic glucagon-like peptide I receptor expression in glucagon-producing alpha-cells of the rat endocrine pancreas. Diabetes 46, 785-791.
Helms, J. B. & Zurzolo, C. (2004). Lipids as targeting signals: lipid rafts and intracellular trafficking. Traffic. 5, 247-254.
Henquin, J. C. (2000). Triggering and amplifying pathways of regulation of insulin secretion by glucose. Diabetes 49, 1751-1760.
Henquin, J. C., Ravier, M. A., Nenquin, M., Jonas, J. C., & Gilon, P. (2003). Hierarchy of the beta-cell signals controlling insulin secretion. Eur.J.Clin.Invest 33, 742-750.
Hilgemann, D. W. (2004). Biochemistry. Oily barbarians breach ion channel gates. Science 304, 223-224.
Hjortoe, G. M., Hagel, G. M., Terry, B. R., Thastrup, O., & Arkhammar, P. O. (2004). Functional identification and monitoring of individual alpha and beta cells in cultured mouse islets of Langerhans. Acta Diabetol. 41, 185-193.
Holthuis, J. C., van Meer, G., & Huitema, K. (2003). Lipid microdomains, lipid translocation and the organization of intracellular membrane transport (Review). Mol.Membr.Biol. 20, 231-241.
227
Holtta-Vuori, M. & Ikonen, E. (2006). Endosomal cholesterol traffic: vesicular and non-vesicular mechanisms meet. Biochem.Soc.Trans. 34, 392-394.
Hong, W. (2005). SNAREs and traffic. Biochim.Biophys.Acta 1744, 493-517.
Hope, K. M., Tran, P. O., Zhou, H., Oseid, E., LeRoy, E., & Robertson, R. P. (2004). Regulation of alpha-cell function by the beta-cell in isolated human and rat islets deprived of glucose: the "switch-off" hypothesis. Diabetes 53, 1488-1495.
Horie, M., Tsuchiya, Y., Hayashi, M., Iida, Y., Iwasawa, Y., Nagata, Y., Sawasaki, Y., Fukuzumi, H., Kitani, K., & Kamei, T. (1990). NB-598: a potent competitive inhibitor of squalene epoxidase. J.Biol.Chem. 265, 18075-18078.
Hu, F. B., Sigal, R. J., Rich-Edwards, J. W., Colditz, G. A., Solomon, C. G., Willett, W. C., Speizer, F. E., & Manson, J. E. (1999). Walking compared with vigorous physical activity and risk of type 2 diabetes in women: a prospective study. JAMA 282, 1433-1439.
Hu, S. H., Latham, C. F., Gee, C. L., James, D. E., & Martin, J. L. (2007). Structure of the Munc18c/Syntaxin4 N-peptide complex defines universal features of the N-peptide binding mode of Sec1/Munc18 proteins. Proc.Natl.Acad.Sci.U.S.A 104, 8773-8778.
Ikonen, E. (2006). Mechanisms for cellular cholesterol transport: defects and human disease. Physiol Rev. 86, 1237-1261.
Inagaki, N., Gonoi, T., Clement, J. P., Namba, N., Inazawa, J., Gonzalez, G., Aguilar-Bryan, L., Seino, S., & Bryan, J. (1995a). Reconstitution of IKATP: an inward rectifier subunit plus the sulfonylurea receptor. Science 270, 1166-1170.
Inagaki, N., Gonoi, T., Clement, J. P., Wang, C. Z., Aguilar-Bryan, L., Bryan, J., & Seino, S. (1996). A family of sulfonylurea receptors determines the pharmacological properties of ATP-sensitive K+ channels. Neuron 16, 1011-1017.
Inagaki, N., Tsuura, Y., Namba, N., Masuda, K., Gonoi, T., Horie, M., Seino, Y., Mizuta, M., & Seino, S. (1995b). Cloning and functional characterization of a novel ATP-sensitive potassium channel ubiquitously expressed in rat tissues, including pancreatic islets, pituitary, skeletal muscle, and heart. J.Biol.Chem. 270, 5691-5694.
Inokuchi, J. (2006). Insulin resistance as a membrane microdomain disorder. Biol.Pharm.Bull. 29, 1532-1537.
228
Inoue, H., Ogawa, W., Asakawa, A., Okamoto, Y., Nishizawa, A., Matsumoto, M., Teshigawara, K., Matsuki, Y., Watanabe, E., Hiramatsu, R., Notohara, K., Katayose, K., Okamura, H., Kahn, C. R., Noda, T., Takeda, K., Akira, S., Inui, A., & Kasuga, M. (2006). Role of hepatic STAT3 in brain-insulin action on hepatic glucose production. Cell Metab 3, 267-275.
Ishihara, H., Maechler, P., Gjinovci, A., Herrera, P. L., & Wollheim, C. B. (2003). Islet beta-cell secretion determines glucagon release from neighbouring alpha-cells. Nat.Cell Biol. 5, 330-335.
Isomoto, S., Kondo, C., Yamada, M., Matsumoto, S., Higashiguchi, O., Horio, Y., Matsuzawa, Y., & Kurachi, Y. (1996). A novel sulfonylurea receptor forms with BIR (Kir6.2) a smooth muscle type ATP-sensitive K+ channel. J.Biol.Chem. 271, 24321-24324.
Israelian, Z., Gosmanov, N. R., Szoke, E., Schorr, M., Bokhari, S., Cryer, P. E., Gerich, J. E., & Meyer, C. (2005). Increasing the decrement in insulin secretion improves glucagon responses to hypoglycemia in advanced type 2 diabetes. Diabetes Care 28, 2691-2696.
Isshiki, M. & Anderson, R. G. (1999). Calcium signal transduction from caveolae. Cell Calcium 26, 201-208.
Jacobson, D. A., Kuznetsov, A., Lopez, J. P., Kash, S., Ammala, C. E., & Philipson, L. H. (2007a). Kv2.1 ablation alters glucose-induced islet electrical activity, enhancing insulin secretion. Cell Metab 6, 229-235.
Jacobson, K., Mouritsen, O. G., & Anderson, R. G. (2007b). Lipid rafts: at a crossroad between cell biology and physics. Nat.Cell Biol. 9, 7-14.
Jan, L. Y. & Jan, Y. N. (1997). Voltage-gated and inwardly rectifying potassium channels. J.Physiol 505 ( Pt 2), 267-282.
Jeremic, A., Kelly, M., Cho, J. A., Cho, S. J., Horber, J. K., & Jena, B. P. (2004). Calcium drives fusion of SNARE-apposed bilayers. Cell Biol.Int. 28, 19-31.
Jetton, T. L., Lausier, J., LaRock, K., Trotman, W. E., Larmie, B., Habibovic, A., Peshavaria, M., & Leahy, J. L. (2005). Mechanisms of compensatory beta-cell growth in insulin-resistant rats: roles of Akt kinase. Diabetes 54, 2294-2304.
Jewell, J. L., Oh, E., Bennett, S. M., Meroueh, S. O., & Thurmond, D. C. (2008). The Tyrosine Phosphorylation of Munc18c Induces a Switch in Binding Specificity from Syntaxin 4 to Doc2beta. J.Biol.Chem. 283, 21734-21746.
229
Ji, J., Tsuk, S., Salapatek, A. M., Huang, X., Chikvashvili, D., Pasyk, E. A., Kang, Y., Sheu, L., Tsushima, R., Diamant, N., Trimble, W. S., Lotan, I., & Gaisano, H. Y. (2002). The 25-kDa synaptosome-associated protein (SNAP-25) binds and inhibits delayed rectifier potassium channels in secretory cells. J.Biol.Chem. 277, 20195-20204.
Jiang, G. & Zhang, B. B. (2003). Glucagon and regulation of glucose metabolism. Am.J Physiol Endocrinol.Metab 284, E671-E678.
Jing, X., Li, D. Q., Olofsson, C. S., Salehi, A., Surve, V. V., Caballero, J., Ivarsson, R., Lundquist, I., Pereverzev, A., Schneider, T., Rorsman, P., & Renstrom, E. (2005). CaV2.3 calcium channels control second-phase insulin release. J Clin.Invest 115, 146-154.
Johnston, C., Millward, B. A., Hoskins, P., Leslie, R. D., Bottazzo, G. F., & Pyke, D. A. (1989). Islet-cell antibodies as predictors of the later development of type 1 (insulin-dependent) diabetes. A study in identical twins. Diabetologia 32, 382-386.
Kahn, B. B. & Flier, J. S. (2000). Obesity and insulin resistance. J Clin.Invest 106, 473-481.
Kahn, S. E. (2001). Beta cell failure: causes and consequences. Int.J.Clin.Pract.Suppl 13-18.
Kahn, S. E. (2003). The relative contributions of insulin resistance and beta-cell dysfunction to the pathophysiology of Type 2 diabetes. Diabetologia 46, 3-19.
Kang, L., Routh, V. H., Kuzhikandathil, E. V., Gaspers, L. D., & Levin, B. E. (2004). Physiological and molecular characteristics of rat hypothalamic ventromedial nucleus glucosensing neurons. Diabetes 53, 549-559.
Kang, Y., Huang, X., Pasyk, E. A., Ji, J., Holz, G. G., Wheeler, M. B., Tsushima, R. G., & Gaisano, H. Y. (2002). Syntaxin-3 and syntaxin-1A inhibit L-type calcium channel activity, insulin biosynthesis and exocytosis in beta-cell lines. Diabetologia 45, 231-241.
Kanno, T., Rorsman, P., & Gopel, S. O. (2002). Glucose-dependent regulation of rhythmic action potential firing in pancreatic beta-cells by K(ATP)-channel modulation. J.Physiol 545, 501-507.
Karlsson, M., Thorn, H., Parpal, S., Stralfors, P., & Gustavsson, J. (2002). Insulin induces translocation of glucose transporter GLUT4 to plasma membrane caveolae in adipocytes. FASEB J. 16, 249-251.
230
Karpen, H. E., Bukowski, J. T., Hughes, T., Gratton, J. P., Sessa, W. C., & Gailani, M. R. (2001). The sonic hedgehog receptor patched associates with caveolin-1 in cholesterol-rich microdomains of the plasma membrane. J.Biol.Chem. 276, 19503-19511.
Kasuga, M. (2006). Insulin resistance and pancreatic beta cell failure. J Clin.Invest 116, 1756-1760.
Kauppi, M., Wohlfahrt, G., & Olkkonen, V. M. (2002). Analysis of the Munc18b-syntaxin binding interface. Use of a mutant Munc18b to dissect the functions of syntaxins 2 and 3. J.Biol.Chem. 277, 43973-43979.
Kay, J. G., Murray, R. Z., Pagan, J. K., & Stow, J. L. (2006). Cytokine secretion via cholesterol-rich lipid raft-associated SNAREs at the phagocytic cup. J.Biol.Chem. 281, 11949-11954.
Ke, B., Oh, E., & Thurmond, D. C. (2007). Doc2beta is a novel Munc18c-interacting partner and positive effector of syntaxin 4-mediated exocytosis. J.Biol.Chem. 282, 21786-21797.
Kilsdonk, E. P., Yancey, P. G., Stoudt, G. W., Bangerter, F. W., Johnson, W. J., Phillips, M. C., & Rothblat, G. H. (1995). Cellular cholesterol efflux mediated by cyclodextrins. J.Biol.Chem. 270, 17250-17256.
Kisanuki, K., Kishikawa, H., Araki, E., Shirotani, T., Uehara, M., Isami, S., Ura, S., Jinnouchi, H., Miyamura, N., & Shichiri, M. (1995). Expression of insulin receptor on clonal pancreatic alpha cells and its possible role for insulin-stimulated negative regulation of glucagon secretion. Diabetologia 38, 422-429.
Kloppel, G., Lohr, M., Habich, K., Oberholzer, M., & Heitz, P. U. (1985). Islet pathology and the pathogenesis of type 1 and type 2 diabetes mellitus revisited. Surv.Synth.Pathol.Res. 4, 110-125.
Knowler, W. C., Saad, M. F., Pettitt, D. J., Nelson, R. G., & Bennett, P. H. (1993). Determinants of diabetes mellitus in the Pima Indians. Diabetes Care 16, 216-227.
Ko, D. C., Binkley, J., Sidow, A., & Scott, M. P. (2003). The integrity of a cholesterol-binding pocket in Niemann-Pick C2 protein is necessary to control lysosome cholesterol levels. Proc.Natl.Acad.Sci.U.S.A 100, 2518-2525.
Koch, H., Hofmann, K., & Brose, N. (2000). Definition of Munc13-homology-domains and characterization of a novel ubiquitously expressed Munc13 isoform. Biochem.J. 349, 247-253.
231
Kong, M. M., Hasbi, A., Mattocks, M., Fan, T., O'Dowd, B. F., & George, S. R. (2007). Regulation of D1 dopamine receptor trafficking and signaling by caveolin-1. Mol.Pharmacol. 72, 1157-1170.
Kulkarni, R. N., Bruning, J. C., Winnay, J. N., Postic, C., Magnuson, M. A., & Kahn, C. R. (1999). Tissue-specific knockout of the insulin receptor in pancreatic beta cells creates an insulin secretory defect similar to that in type 2 diabetes. Cell 96, 329-339.
Kulkarni, R. N., Holzenberger, M., Shih, D. Q., Ozcan, U., Stoffel, M., Magnuson, M. A., & Kahn, C. R. (2002). beta-cell-specific deletion of the Igf1 receptor leads to hyperinsulinemia and glucose intolerance but does not alter beta-cell mass. Nat.Genet. 31, 111-115.
Kumar, U., Sasi, R., Suresh, S., Patel, A., Thangaraju, M., Metrakos, P., Patel, S. C., & Patel, Y. C. (1999). Subtype-selective expression of the five somatostatin receptors (hSSTR1-5) in human pancreatic islet cells: a quantitative double-label immunohistochemical analysis. Diabetes 48, 77-85.
Kurzchalia, T. V., Dupree, P., Parton, R. G., Kellner, R., Virta, H., Lehnert, M., & Simons, K. (1992). VIP21, a 21-kD membrane protein is an integral component of trans-Golgi-network-derived transport vesicles. J.Cell Biol. 118, 1003-1014.
Kwan, E. P., Xie, L., Sheu, L., Nolan, C. J., Prentki, M., Betz, A., Brose, N., & Gaisano, H. Y. (2006). Munc13-1 deficiency reduces insulin secretion and causes abnormal glucose tolerance. Diabetes 55, 1421-1429.
Kwik, J., Boyle, S., Fooksman, D., Margolis, L., Sheetz, M. P., & Edidin, M. (2003). Membrane cholesterol, lateral mobility, and the phosphatidylinositol 4,5-bisphosphate-dependent organization of cell actin. Proc.Natl.Acad.Sci.U.S.A 100, 13964-13969.
Lafont, F., Verkade, P., Galli, T., Wimmer, C., Louvard, D., & Simons, K. (1999). Raft association of SNAP receptors acting in apical trafficking in Madin-Darby canine kidney cells. Proc.Natl.Acad.Sci.U.S.A 96, 3734-3738.
Lang, J. (1999). Molecular mechanisms and regulation of insulin exocytosis as a paradigm of endocrine secretion. Eur.J.Biochem. 259, 3-17.
Lang, J., Fukuda, M., Zhang, H., Mikoshiba, K., & Wollheim, C. B. (1997). The first C2 domain of synaptotagmin is required for exocytosis of insulin from pancreatic beta-cells: action of synaptotagmin at low micromolar calcium. EMBO J. 16, 5837-5846.
232
Lang, T. (2007). SNARE proteins and membrane rafts. J.Physiol 585, 693-698.
Lang, T., Bruns, D., Wenzel, D., Riedel, D., Holroyd, P., Thiele, C., & Jahn, R. (2001). SNAREs are concentrated in cholesterol-dependent clusters that define docking and fusion sites for exocytosis. EMBO J. 20, 2202-2213.
Langmann, T., Klucken, J., Reil, M., Liebisch, G., Luciani, M. F., Chimini, G., Kaminski, W. E., & Schmitz, G. (1999). Molecular cloning of the human ATP-binding cassette transporter 1 (hABC1): evidence for sterol-dependent regulation in macrophages. Biochem.Biophys.Res.Commun. 257, 29-33.
Lee, J. Y., Ristow, M., Lin, X., White, M. F., Magnuson, M. A., & Hennighausen, L. (2006). RIP-Cre revisited, evidence for impairments of pancreatic beta-cell function. J.Biol.Chem. 281, 2649-2653.
Leung, A. T., Imagawa, T., & Campbell, K. P. (1987). Structural characterization of the 1,4-dihydropyridine receptor of the voltage-dependent Ca2+ channel from rabbit skeletal muscle. Evidence for two distinct high molecular weight subunits. J.Biol.Chem. 262, 7943-7946.
Leung, Y. M., Ahmed, I., Sheu, L., Gao, X., Hara, M., Tsushima, R. G., Diamant, N. E., & Gaisano, H. Y. (2006a). Insulin regulates islet alpha-cell function by reducing KATP channel sensitivity to adenosine 5'-triphosphate inhibition. Endocrinology 147, 2155-2162.
Leung, Y. M., Ahmed, I., Sheu, L., Tsushima, R. G., Diamant, N. E., & Gaisano, H. Y. (2006b). Two populations of pancreatic islet alpha-cells displaying distinct Ca2+ channel properties. Biochem.Biophys.Res.Commun. 345, 340-344.
Leung, Y. M., Ahmed, I., Sheu, L., Tsushima, R. G., Diamant, N. E., Hara, M., & Gaisano, H. Y. (2005a). Electrophysiological characterization of pancreatic islet cells in the mouse insulin promoter-green fluorescent protein mouse. Endocrinology 146, 4766-4775.
Leung, Y. M., Kang, Y., Gao, X., Xia, F., Xie, H., Sheu, L., Tsuk, S., Lotan, I., Tsushima, R. G., & Gaisano, H. Y. (2003). Syntaxin 1A binds to the cytoplasmic C terminus of Kv2.1 to regulate channel gating and trafficking. J.Biol.Chem. 278, 17532-17538.
Leung, Y. M., Kang, Y., Xia, F., Sheu, L., Gao, X., Xie, H., Tsushima, R. G., & Gaisano, H. Y. (2005b). Open form of syntaxin-1A is a more potent inhibitor than wild-type syntaxin-1A of Kv2.1 channels. Biochem.J. 387, 195-202.
233
Levy, J. C. (2006). Therapeutic intervention in the GLP-1 pathway in Type 2 diabetes. Diabet.Med. 23 Suppl 1, 14-19.
Li, C., Davletov, B. A., & Sudhof, T. C. (1995). Distinct Ca2+ and Sr2+ binding properties of synaptotagmins. Definition of candidate Ca2+ sensors for the fast and slow components of neurotransmitter release. J.Biol.Chem. 270, 24898-24902.
Li, L. & Chin, L. S. (2003). The molecular machinery of synaptic vesicle exocytosis. Cell Mol.Life Sci. 60, 942-960.
Li, Y., Cao, X., Li, L. X., Brubaker, P. L., Edlund, H., & Drucker, D. J. (2005). beta-Cell Pdx1 expression is essential for the glucoregulatory, proliferative, and cytoprotective actions of glucagon-like peptide-1. Diabetes 54, 482-491.
Liadis, N., Salmena, L., Kwan, E., Tajmir, P., Schroer, S. A., Radziszewska, A., Li, X., Sheu, L., Eweida, M., Xu, S., Gaisano, H. Y., Hakem, R., & Woo, M. (2007). Distinct in vivo roles of Caspase-8 in beta cells in physiological and diabetes models. Diabetes 56, 2302-2311.
Lihn, A. S., Pedersen, S. B., & Richelsen, B. (2005). Adiponectin: action, regulation and association to insulin sensitivity. Obes.Rev. 6, 13-21.
Lim, G. E. & Brubaker, P. L. (2006). Glucagon-Like Peptide 1 Secretion by the L-Cell: The View From Within. Diabetes 55, S70-S77.
Lindau, M. & Neher, E. (1988). Patch-clamp techniques for time-resolved capacitance measurements in single cells. Pflugers Arch. 411, 137-146.
Lisanti, M. P., Scherer, P. E., Vidugiriene, J., Tang, Z., Hermanowski-Vosatka, A., Tu, Y. H., Cook, R. F., & Sargiacomo, M. (1994). Characterization of caveolin-rich membrane domains isolated from an endothelial-rich source: implications for human disease. J.Cell Biol. 126, 111-126.
Liss, B., Bruns, R., & Roeper, J. (1999). Alternative sulfonylurea receptor expression defines metabolic sensitivity of K-ATP channels in dopaminergic midbrain neurons. EMBO J. 18, 833-846.
Littleton, J. T., Stern, M., Schulze, K., Perin, M., & Bellen, H. J. (1993). Mutational analysis of Drosophila synaptotagmin demonstrates its essential role in Ca(2+)-activated neurotransmitter release. Cell 74, 1125-1134.
234
Liu, P., Leffler, B. J., Weeks, L. K., Chen, G., Bouchard, C. M., Strawbridge, A. B., & Elmendorf, J. S. (2004a). Sphingomyelinase activates GLUT4 translocation via a cholesterol-dependent mechanism. Am.J.Physiol Cell Physiol 286, C317-C329.
Liu, P., Li, W. P., Machleidt, T., & Anderson, R. G. (1999). Identification of caveolin-1 in lipoprotein particles secreted by exocrine cells. Nat.Cell Biol. 1, 369-375.
Liu, Y. J., Vieira, E., & Gylfe, E. (2004b). A store-operated mechanism determines the activity of the electrically excitable glucagon-secreting pancreatic alpha-cell. Cell Calcium 35, 357-365.
Loh, Y. P., Kim, T., Rodriguez, Y. M., & Cawley, N. X. (2004). Secretory granule biogenesis and neuropeptide sorting to the regulated secretory pathway in neuroendocrine cells. J.Mol.Neurosci. 22, 63-71.
Lohn, M., Furstenau, M., Sagach, V., Elger, M., Schulze, W., Luft, F. C., Haller, H., & Gollasch, M. (2000). Ignition of calcium sparks in arterial and cardiac muscle through caveolae. Circ.Res. 87, 1034-1039.
London, E. & Brown, D. A. (2000). Insolubility of lipids in triton X-100: physical origin and relationship to sphingolipid/cholesterol membrane domains (rafts). Biochim.Biophys.Acta 1508, 182-195.
Low, S. H., Vasanji, A., Nanduri, J., He, M., Sharma, N., Koo, M., Drazba, J., & Weimbs, T. (2006). Syntaxins 3 and 4 are concentrated in separate clusters on the plasma membrane before the establishment of cell polarity. Mol.Biol.Cell 17, 977-989.
Ludvigsen, E., Olsson, R., Stridsberg, M., Janson, E. T., & Sandler, S. (2004). Expression and distribution of somatostatin receptor subtypes in the pancreatic islets of mice and rats. J.Histochem.Cytochem. 52, 391-400.
Luft, R., Efendic, S., & Hokfelt, T. (1978). Somatostatin--both hormone and neurotransmitter? Diabetologia 14, 1-13.
Lundbaek, J. A., Birn, P., Girshman, J., Hansen, A. J., & Andersen, O. S. (1996). Membrane stiffness and channel function. Biochemistry 35, 3825-3830.
Lv, J. H., He, L., & Sui, S. F. (2008). Lipid rafts association of synaptotagmin I on synaptic vesicles. Biochemistry (Mosc.) 73, 283-288.
235
Ma, D. W. (2007). Lipid mediators in membrane rafts are important determinants of human health and disease. Appl.Physiol Nutr.Metab 32, 341-350.
Ma, X., Zhang, Y., Gromada, J., Sewing, S., Berggren, P. O., Buschard, K., Salehi, A., Vikman, J., Rorsman, P., & Eliasson, L. (2005). Glucagon stimulates exocytosis in mouse and rat pancreatic alpha-cells by binding to glucagon receptors. Mol.Endocrinol. 19, 198-212.
Macdonald, P. E., Ha, X. F., Wang, J., Smukler, S. R., Sun, A. M., Gaisano, H. Y., Salapatek, A. M., Backx, P. H., & Wheeler, M. B. (2001). Members of the Kv1 and Kv2 voltage-dependent K(+) channel families regulate insulin secretion. Mol.Endocrinol. 15, 1423-1435.
Macdonald, P. E., Salapatek, A. M., & Wheeler, M. B. (2002a). Glucagon-like peptide-1 receptor activation antagonizes voltage-dependent repolarizing K(+) currents in beta-cells: a possible glucose-dependent insulinotropic mechanism. Diabetes 51 Suppl 3, S443-S447.
Macdonald, P. E., Sewing, S., Wang, J., Joseph, J. W., Smukler, S. R., Sakellaropoulos, G., Wang, J., Saleh, M. C., Chan, C. B., Tsushima, R. G., Salapatek, A. M., & Wheeler, M. B. (2002b). Inhibition of Kv2.1 voltage-dependent K+ channels in pancreatic beta-cells enhances glucose-dependent insulin secretion. J.Biol.Chem. 277, 44938-44945.
Macdonald, P. E., Wang, G., Tsuk, S., Dodo, C., Kang, Y., Tang, L., Wheeler, M. B., Cattral, M. S., Lakey, J. R., Salapatek, A. M., Lotan, I., & Gaisano, H. Y. (2002c). Synaptosome-associated protein of 25 kilodaltons modulates Kv2.1 voltage-dependent K(+) channels in neuroendocrine islet beta-cells through an interaction with the channel N terminus. Mol.Endocrinol. 16, 2452-2461.
Macdonald, P. E. & Wheeler, M. B. (2003). Voltage-dependent K(+) channels in pancreatic beta cells: role, regulation and potential as therapeutic targets. Diabetologia 46, 1046-1062.
Maechler, P., Carobbio, S., & Rubi, B. (2006). In beta-cells, mitochondria integrate and generate metabolic signals controlling insulin secretion. Int.J Biochem.Cell Biol. 38, 696-709.
Maguy, A., Hebert, T. E., & Nattel, S. (2006). Involvement of lipid rafts and caveolae in cardiac ion channel function. Cardiovasc.Res. 69, 798-807.
Malaisse-Lagae, F., Mathias, P. C., & Malaisse, W. J. (1984). Gating and blocking of calcium channels by dihydropyridines in the pancreatic B-cell. Biochem.Biophys.Res.Commun. 123, 1062-1068.
236
Marliss, E. B., Wollheim, C. B., Blondel, B., Orci, L., Lambert, A. E., Stauffacher, W., Like, A. A., & Renold, A. E. (1973). Insulin and glucagon release from monolayer cell cultures of pancreas from newborn rats. Eur.J Clin.Invest 3, 16-26.
Martens, J. R., Navarro-Polanco, R., Coppock, E. A., Nishiyama, A., Parshley, L., Grobaski, T. D., & Tamkun, M. M. (2000). Differential targeting of Shaker-like potassium channels to lipid rafts. J.Biol.Chem. 275, 7443-7446.
Martens, J. R., Sakamoto, N., Sullivan, S. A., Grobaski, T. D., & Tamkun, M. M. (2001). Isoform-specific localization of voltage-gated K+ channels to distinct lipid raft populations. Targeting of Kv1.5 to caveolae. J.Biol.Chem. 276, 8409-8414.
Martin, F., Moya, F., Gutierrez, L. M., Reig, J. A., & Soria, B. (1995). Role of syntaxin in mouse pancreatic beta cells. Diabetologia 38, 860-863.
Martin, F., Salinas, E., Vazquez, J., Soria, B., & Reig, J. A. (1996). Inhibition of insulin release by synthetic peptides shows that the H3 region at the C-terminal domain of syntaxin-1 is crucial for Ca(2+)- but not for guanosine 5'-[gamma-thio]triphosphate-induced secretion. Biochem.J. 320 ( Pt 1), 201-205.
Maruyama, H., Hisatomi, A., Orci, L., Grodsky, G. M., & Unger, R. H. (1984). Insulin within islets is a physiologic glucagon release inhibitor. J.Clin.Invest 74, 2296-2299.
Matschinsky, F. M. (2002). Regulation of pancreatic beta-cell glucokinase: from basics to therapeutics. Diabetes 51 Suppl 3, S394-S404.
Matter, K., Whitney, J. A., Yamamoto, E. M., & Mellman, I. (1993). Common signals control low density lipoprotein receptor sorting in endosomes and the Golgi complex of MDCK cells. Cell 74, 1053-1064.
Matveev, S., Li, X., Everson, W., & Smart, E. J. (2001). The role of caveolae and caveolin in vesicle-dependent and vesicle-independent trafficking. Adv.Drug Deliv.Rev. 49, 237-250.
Maxfield, F. R. & Tabas, I. (2005). Role of cholesterol and lipid organization in disease. Nature 438, 612-621.
Maxfield, F. R. & Wustner, D. (2002). Intracellular cholesterol transport. J Clin.Invest 110, 891-898.
237
Mayor, S., Rothberg, K. G., & Maxfield, F. R. (1994). Sequestration of GPI-anchored proteins in caveolae triggered by cross-linking. Science 264, 1948-1951.
McCrimmon, R. J., Fan, X., Ding, Y., Zhu, W., Jacob, R. J., & Sherwin, R. S. (2004). Potential role for AMP-activated protein kinase in hypoglycemia sensing in the ventromedial hypothalamus. Diabetes 53, 1953-1958.
McGirr, R., Ejbick, C. E., Carter, D. E., Andrews, J. D., Nie, Y., Friedman, T. C., & Dhanvantari, S. (2005). Glucose dependence of the regulated secretory pathway in alphaTC1-6 cells. Endocrinology 146, 4514-4523.
Mears, D. (2004). Regulation of insulin secretion in islets of Langerhans by Ca(2+)channels. J.Membr.Biol. 200, 57-66.
Michel, V. & Bakovic, M. (2007). Lipid rafts in health and disease. Biol.Cell 99, 129-140.
Miki, T., Liss, B., Minami, K., Shiuchi, T., Saraya, A., Kashima, Y., Horiuchi, M., Ashcroft, F., Minokoshi, Y., Roeper, J., & Seino, S. (2001). ATP-sensitive K+ channels in the hypothalamus are essential for the maintenance of glucose homeostasis. Nat.Neurosci. 4, 507-512.
Miki, T., Nagashima, K., Tashiro, F., Kotake, K., Yoshitomi, H., Tamamoto, A., Gonoi, T., Iwanaga, T., Miyazaki, J., & Seino, S. (1998). Defective insulin secretion and enhanced insulin action in KATP channel-deficient mice. Proc.Natl.Acad.Sci.U.S.A 95, 10402-10406.
Miki, T., Tashiro, F., Iwanaga, T., Nagashima, K., Yoshitomi, H., Aihara, H., Nitta, Y., Gonoi, T., Inagaki, N., Miyazaki, J., & Seino, S. (1997). Abnormalities of pancreatic islets by targeted expression of a dominant-negative KATP channel. Proc.Natl.Acad.Sci.U.S.A 94, 11969-11973.
Miller, W. L. & Strauss, J. F., III (1999). Molecular pathology and mechanism of action of the steroidogenic acute regulatory protein, StAR. J.Steroid Biochem.Mol.Biol. 69, 131-141.
Misler, S., Gee, W. M., Gillis, K. D., Scharp, D. W., & Falke, L. C. (1989). Metabolite-regulated ATP-sensitive K+ channel in human pancreatic islet cells. Diabetes 38, 422-427.
Misura, K. M., Scheller, R. H., & Weis, W. I. (2000). Three-dimensional structure of the neuronal-Sec1-syntaxin 1a complex. Nature 404, 355-362.
238
Mitra, S. W., Mezey, E., Hunyady, B., Chamberlain, L., Hayes, E., Foor, F., Wang, Y., Schonbrunn, A., & Schaeffer, J. M. (1999). Colocalization of somatostatin receptor sst5 and insulin in rat pancreatic beta-cells. Endocrinology 140, 3790-3796.
Miyazaki, J., Araki, K., Yamato, E., Ikegami, H., Asano, T., Shibasaki, Y., Oka, Y., & Yamamura, K. (1990). Establishment of a pancreatic beta cell line that retains glucose-inducible insulin secretion: special reference to expression of glucose transporter isoforms. Endocrinology 127, 126-132.
Mochida, S., Sheng, Z. H., Baker, C., Kobayashi, H., & Catterall, W. A. (1996). Inhibition of neurotransmission by peptides containing the synaptic protein interaction site of N-type Ca2+ channels. Neuron 17, 781-788.
Moens, K., Heimberg, H., Flamez, D., Huypens, P., Quartier, E., Ling, Z., Pipeleers, D., Gremlich, S., Thorens, B., & Schuit, F. (1996). Expression and functional activity of glucagon, glucagon-like peptide I, and glucose-dependent insulinotropic peptide receptors in rat pancreatic islet cells. Diabetes 45, 257-261.
Moller, D. E. (2001). New drug targets for type 2 diabetes and the metabolic syndrome. Nature 414, 821-827.
Monck, J. R., Robinson, I. M., Escobar, A. L., Vergara, J. L., & Fernandez, J. M. (1994). Pulsed laser imaging of rapid Ca2+ gradients in excitable cells. Biophys.J 67, 505-514.
Montesano, R., Roth, J., Robert, A., & Orci, L. (1982). Non-coated membrane invaginations are involved in binding and internalization of cholera and tetanus toxins. Nature 296, 651-653.
Morandat, S., Bortolato, M., & Roux, B. (2002). Cholesterol-dependent insertion of glycosylphosphatidylinositol-anchored enzyme. Biochim.Biophys.Acta 1564, 473-478.
Morgan, N. G., Short, C. D., Rumford, G. M., & Montague, W. (1985). Effects of the calcium-channel agonist CGP 28392 on insulin secretion from isolated rat islets of Langerhans. Biochem.J. 231, 629-634.
Munoz, A., Hu, M., Hussain, K., Bryan, J., Aguilar-Bryan, L., & Rajan, A. S. (2005). Regulation of glucagon secretion at low glucose concentrations: evidence for adenosine triphosphate-sensitive potassium channel involvement. Endocrinology 146, 5514-5521.
239
Murakami, K., Taniguchi, H., Tamagawa, M., Ejiri, K., & Baba, S. (1982). Modulation of somatostatin release by endogenous glucagon and insulin: physiological relationship between A, B and D cells in rat pancreatic islets. Endocrinol.Jpn. 29, 503-508.
Murata, M., Peranen, J., Schreiner, R., Wieland, F., Kurzchalia, T. V., & Simons, K. (1995). VIP21/caveolin is a cholesterol-binding protein. Proc.Natl.Acad.Sci.U.S.A 92, 10339-10343.
Namkung, Y., Skrypnyk, N., Jeong, M. J., Lee, T., Lee, M. S., Kim, H. L., Chin, H., Suh, P. G., Kim, S. S., & Shin, H. S. (2001). Requirement for the L-type Ca(2+) channel alpha(1D) subunit in postnatal pancreatic beta cell generation. J Clin.Invest 108, 1015-1022.
Neher, E. (1998). Vesicle pools and Ca2+ microdomains: new tools for understanding their roles in neurotransmitter release. Neuron 20, 389-399.
Nestorowicz, A., Inagaki, N., Gonoi, T., Schoor, K. P., Wilson, B. A., Glaser, B., Landau, H., Stanley, C. A., Thornton, P. S., Seino, S., & Permutt, M. A. (1997). A nonsense mutation in the inward rectifier potassium channel gene, Kir6.2, is associated with familial hyperinsulinism. Diabetes 46, 1743-1748.
Nevins, A. K. & Thurmond, D. C. (2006). Caveolin-1 functions as a novel Cdc42 guanine nucleotide dissociation inhibitor in pancreatic beta-cells. J.Biol.Chem. 281, 18961-18972.
Newcomb, R., Szoke, B., Palma, A., Wang, G., Chen, X., Hopkins, W., Cong, R., Miller, J., Urge, L., Tarczy-Hornoch, K., Loo, J. A., Dooley, D. J., Nadasdi, L., Tsien, R. W., Lemos, J., & Miljanich, G. (1998). Selective peptide antagonist of the class E calcium channel from the venom of the tarantula Hysterocrates gigas. Biochemistry 37, 15353-15362.
Nichols, C. G., Shyng, S. L., Nestorowicz, A., Glaser, B., Clement, J. P., Gonzalez, G., Aguilar-Bryan, L., Permutt, M. A., & Bryan, J. (1996). Adenosine diphosphate as an intracellular regulator of insulin secretion. Science 272, 1785-1787.
Nicolau, D. V., Jr., Burrage, K., Parton, R. G., & Hancock, J. F. (2006). Identifying optimal lipid raft characteristics required to promote nanoscale protein-protein interactions on the plasma membrane. Mol.Cell Biol. 26, 313-323.
Nikoulina, S. E., Ciaraldi, T. P., Mudaliar, S., Mohideen, P., Carter, L., & Henry, R. R. (2000). Potential role of glycogen synthase kinase-3 in skeletal muscle insulin resistance of type 2 diabetes. Diabetes 49, 263-271.
240
O'Connell, K. M., Martens, J. R., & Tamkun, M. M. (2004). Localization of ion channels to lipid Raft domains within the cardiovascular system. Trends Cardiovasc.Med. 14, 37-42.
O'Dea, K. (1992). Obesity and diabetes in "the land of milk and honey". Diabetes Metab Rev. 8, 373-388.
Obici, S., Zhang, B. B., Karkanias, G., & Rossetti, L. (2002). Hypothalamic insulin signaling is required for inhibition of glucose production. Nat.Med. 8, 1376-1382.
Ohara-Imaizumi, M., Nishiwaki, C., Kikuta, T., Kumakura, K., Nakamichi, Y., & Nagamatsu, S. (2004a). Site of docking and fusion of insulin secretory granules in live MIN6 beta cells analyzed by TAT-conjugated anti-syntaxin 1 antibody and total internal reflection fluorescence microscopy. J Biol.Chem. 279, 8403-8408.
Ohara-Imaizumi, M., Nishiwaki, C., Kikuta, T., Nagai, S., Nakamichi, Y., & Nagamatsu, S. (2004b). TIRF imaging of docking and fusion of single insulin granule motion in primary rat pancreatic beta-cells: different behaviour of granule motion between normal and Goto-Kakizaki diabetic rat beta-cells. Biochem.J 381, 13-18.
Ohneda, A., Aguilar-Parada, E., Eisentraut, A. M., & Unger, R. H. (1969). Control of pancreatic glucagon secretion by glucose. Diabetes 18, 1-10.
Ohta, M., Nelson, J., Nelson, D., Meglasson, M. D., & Erecinska, M. (1993). Effect of Ca++ channel blockers on energy level and stimulated insulin secretion in isolated rat islets of Langerhans. J.Pharmacol.Exp.Ther. 264, 35-40.
Ohvo-Rekila, H., Ramstedt, B., Leppimaki, P., & Slotte, J. P. (2002). Cholesterol interactions with phospholipids in membranes. Prog.Lipid Res. 41, 66-97.
Okamoto, H., Nakae, J., Kitamura, T., Park, B. C., Dragatsis, I., & Accili, D. (2004). Transgenic rescue of insulin receptor-deficient mice. J Clin.Invest 114, 214-223.
Oliver, D., Lien, C. C., Soom, M., Baukrowitz, T., Jonas, P., & Fakler, B. (2004). Functional conversion between A-type and delayed rectifier K+ channels by membrane lipids. Science 304, 265-270.
Olofsson, C. S., Salehi, A., Gopel, S. O., Holm, C., & Rorsman, P. (2004). Palmitate stimulation of glucagon secretion in mouse pancreatic alpha-cells results from activation of L-type calcium channels and elevation of cytoplasmic calcium. Diabetes 53, 2836-2843.
241
Olsen, H. L., Theander, S., Bokvist, K., Buschard, K., Wollheim, C. B., & Gromada, J. (2005). Glucose stimulates glucagon release in single rat alpha-cells by mechanisms that mirror the stimulus-secretion coupling in beta-cells. Endocrinology 146, 4861-4870.
Oram, J. F. (2002). ATP-binding cassette transporter A1 and cholesterol trafficking. Curr.Opin.Lipidol. 13, 373-381.
Orci, L., Amherdt, M., Montesano, R., Vassalli, P., & Perrelet, A. (1981). Topology of morphologically detectable protein and cholesterol in membranes of polypeptide-secreting cells. Philos.Trans.R.Soc.Lond B Biol.Sci. 296, 47-54.
Ostenson, C. G., Gaisano, H., Sheu, L., Tibell, A., & Bartfai, T. (2006). Impaired gene and protein expression of exocytotic soluble N-ethylmaleimide attachment protein receptor complex proteins in pancreatic islets of type 2 diabetic patients. Diabetes 55, 435-440.
Palade, G. E. (1953). Fine structure of blood capillaries. J.Appl.Phys 24, 1424.
Parton, R. G. (2003). Caveolae--from ultrastructure to molecular mechanisms. Nat.Rev.Mol.Cell Biol. 4, 162-167.
Parton, R. G. & Hancock, J. F. (2004). Lipid rafts and plasma membrane microorganization: insights from Ras. Trends Cell Biol. 14, 141-147.
Parton, R. G., Hanzal-Bayer, M., & Hancock, J. F. (2006). Biogenesis of caveolae: a structural model for caveolin-induced domain formation. J.Cell Sci. 119, 787-796.
Patel, Y. C. (1999). Somatostatin and its receptor family. Front Neuroendocrinol. 20, 157-198.
Pediconi, M. F., Gallegos, C. E., Los Santos, E. B., & Barrantes, F. J. (2004). Metabolic cholesterol depletion hinders cell-surface trafficking of the nicotinic acetylcholine receptor. Neuroscience 128, 239-249.
Pereverzev, A., Salehi, A., Mikhna, M., Renstrom, E., Hescheler, J., Weiergraber, M., Smyth, N., & Schneider, T. (2005). The ablation of the Ca(v)2.3/E-type voltage-gated Ca2+ channel causes a mild phenotype despite an altered glucose induced glucagon response in isolated islets of Langerhans. Eur.J.Pharmacol. 511, 65-72.
Peters, K. R., Carley, W. W., & Palade, G. E. (1985). Endothelial plasmalemmal vesicles have a characteristic striped bipolar surface structure. J.Cell Biol. 101, 2233-2238.
242
Pfeffer, S. & Aivazian, D. (2004). Targeting Rab GTPases to distinct membrane compartments. Nat.Rev.Mol.Cell Biol. 5, 886-896.
Pichler, H. & Riezman, H. (2004). Where sterols are required for endocytosis. Biochim.Biophys.Acta 1666, 51-61.
Pike, L. J. (2003). Lipid rafts: bringing order to chaos. J.Lipid Res. 44, 655-667.
Pike, L. J. (2004). Lipid rafts: heterogeneity on the high seas. Biochem.J. 378, 281-292.
Pike, L. J. (2006). Rafts defined: a report on the Keystone Symposium on Lipid Rafts and Cell Function. J.Lipid Res. 47, 1597-1598.
Pitha, J., Irie, T., Sklar, P. B., & Nye, J. S. (1988). Drug solubilizers to aid pharmacologists: amorphous cyclodextrin derivatives. Life Sci. 43, 493-502.
Platzer, J., Engel, J., Schrott-Fischer, A., Stephan, K., Bova, S., Chen, H., Zheng, H., & Striessnig, J. (2000). Congenital deafness and sinoatrial node dysfunction in mice lacking class D L-type Ca2+ channels. Cell 102, 89-97.
Plum, L., Belgardt, B. F., & Bruning, J. C. (2006). Central insulin action in energy and glucose homeostasis. J Clin.Invest 116, 1761-1766.
Pocai, A., Lam, T. K., Gutierrez-Juarez, R., Obici, S., Schwartz, G. J., Bryan, J., Aguilar-Bryan, L., & Rossetti, L. (2005). Hypothalamic K(ATP) channels control hepatic glucose production. Nature 434, 1026-1031.
Porte, D., Jr. & Kahn, S. E. (2001). beta-cell dysfunction and failure in type 2 diabetes: potential mechanisms. Diabetes 50 Suppl 1, S160-S163.
Portela-Gomes, G. M., Stridsberg, M., Grimelius, L., Oberg, K., & Janson, E. T. (2000). Expression of the five different somatostatin receptor subtypes in endocrine cells of the pancreas. Appl.Immunohistochem.Mol.Morphol. 8, 126-132.
Puri, N. & Roche, P. A. (2006). Ternary SNARE complexes are enriched in lipid rafts during mast cell exocytosis. Traffic. 7, 1482-1494.
Quesada, I., Martin, F., & Soria, B. (2000). Nutrient modulation of polarized and sustained submembrane Ca2+ microgradients in mouse pancreatic islet cells. J Physiol 525 Pt 1, 159-167.
243
Quesada, I., Todorova, M. G., & Soria, B. (2006). Different metabolic responses in alpha-, beta-, and delta-cells of the islet of Langerhans monitored by redox confocal microscopy. Biophys.J 90, 2641-2650.
Radhakrishnan, A., Sun, L. P., Kwon, H. J., Brown, M. S., & Goldstein, J. L. (2004). Direct binding of cholesterol to the purified membrane region of SCAP: mechanism for a sterol-sensing domain. Mol.Cell 15, 259-268.
Rajala, M. W. & Scherer, P. E. (2003). Minireview: The adipocyte--at the crossroads of energy homeostasis, inflammation, and atherosclerosis. Endocrinology 144, 3765-3773.
Rajan, A. S., Aguilar-Bryan, L., Nelson, D. A., Nichols, C. G., Wechsler, S. W., Lechago, J., & Bryan, J. (1993). Sulfonylurea receptors and ATP-sensitive K+ channels in clonal pancreatic alpha cells. Evidence for two high affinity sulfonylurea receptors. J.Biol.Chem. 268, 15221-15228.
Ramanadham, S., Bohrer, A., Gross, R. W., & Turk, J. (1993). Mass spectrometric characterization of arachidonate-containing plasmalogens in human pancreatic islets and in rat islet beta-cells and subcellular membranes. Biochemistry 32, 13499-13509.
Ravier, M. A. & Rutter, G. A. (2005). Glucose or insulin, but not zinc ions, inhibit glucagon secretion from mouse pancreatic alpha-cells. Diabetes 54, 1789-1797.
Razani, B., Engelman, J. A., Wang, X. B., Schubert, W., Zhang, X. L., Marks, C. B., Macaluso, F., Russell, R. G., Li, M., Pestell, R. G., Di Vizio, D., Hou, H., Jr., Kneitz, B., Lagaud, G., Christ, G. J., Edelmann, W., & Lisanti, M. P. (2001). Caveolin-1 null mice are viable but show evidence of hyperproliferative and vascular abnormalities. J.Biol.Chem. 276, 38121-38138.
Razani, B., Wang, X. B., Engelman, J. A., Battista, M., Lagaud, G., Zhang, X. L., Kneitz, B., Hou, H., Jr., Christ, G. J., Edelmann, W., & Lisanti, M. P. (2002). Caveolin-2-deficient mice show evidence of severe pulmonary dysfunction without disruption of caveolae. Mol.Cell Biol. 22, 2329-2344.
Razavi, R., Chan, Y., Afifiyan, F. N., Liu, X. J., Wan, X., Yantha, J., Tsui, H., Tang, L., Tsai, S., Santamaria, P., Driver, J. P., Serreze, D., Salter, M. W., & Dosch, H. M. (2006). TRPV1+ sensory neurons control beta cell stress and islet inflammation in autoimmune diabetes. Cell 127, 1123-1135.
Reinhart, M. P., Billheimer, J. T., Faust, J. R., & Gaylor, J. L. (1987). Subcellular localization of the enzymes of cholesterol biosynthesis and metabolism in rat liver. J.Biol.Chem. 262, 9649-9655.
244
Ren, J., Lew, S., Wang, Z., & London, E. (1997). Transmembrane orientation of hydrophobic alpha-helices is regulated both by the relationship of helix length to bilayer thickness and by the cholesterol concentration. Biochemistry 36, 10213-10220.
Ren, X., Ostermeyer, A. G., Ramcharan, L. T., Zeng, Y., Lublin, D. M., & Brown, D. A. (2004). Conformational defects slow Golgi exit, block oligomerization, and reduce raft affinity of caveolin-1 mutant proteins. Mol.Biol.Cell 15, 4556-4567.
Resh, M. D. (2004). Membrane targeting of lipid modified signal transduction proteins. Subcell.Biochem. 37, 217-232.
Rettig, J. & Neher, E. (2002). Emerging roles of presynaptic proteins in Ca++-triggered exocytosis. Science 298, 781-785.
Reusch, J. E. (2003). Diabetes, microvascular complications, and cardiovascular complications: what is it about glucose? J Clin.Invest 112, 986-988.
Revers, R. R., Fink, R., Griffin, J., Olefsky, J. M., & Kolterman, O. G. (1984). Influence of hyperglycemia on insulin's in vivo effects in type II diabetes. J Clin.Invest 73, 664-672.
Rewers, M., LaPorte, R. E., King, H., & Tuomilehto, J. (1988). Trends in the prevalence and incidence of diabetes: insulin-dependent diabetes mellitus in childhood. World Health Stat.Q. 41, 179-189.
Rizo, J. & Sudhof, T. C. (2002). Snares and Munc18 in synaptic vesicle fusion. Nat.Rev.Neurosci. 3, 641-653.
Rizzo, V., McIntosh, D. P., Oh, P., & Schnitzer, J. E. (1998). In situ flow activates endothelial nitric oxide synthase in luminal caveolae of endothelium with rapid caveolin dissociation and calmodulin association. J.Biol.Chem. 273, 34724-34729.
Roe, M. W., Worley, J. F., III, Mittal, A. A., Kuznetsov, A., DasGupta, S., Mertz, R. J., Witherspoon, S. M., III, Blair, N., Lancaster, M. E., McIntyre, M. S., Shehee, W. R., Dukes, I. D., & Philipson, L. H. (1996). Expression and function of pancreatic beta-cell delayed rectifier K+ channels. Role in stimulus-secretion coupling. J.Biol.Chem. 271, 32241-32246.
Roehrich, M. E., Mooser, V., Lenain, V., Herz, J., Nimpf, J., Azhar, S., Bideau, M., Capponi, A., Nicod, P., Haefliger, J. A., & Waeber, G. (2003). Insulin-secreting beta-cell dysfunction induced by human lipoproteins. J.Biol.Chem. 278, 18368-18375.
245
Ronner, P., Matschinsky, F. M., Hang, T. L., Epstein, A. J., & Buettger, C. (1993). Sulfonylurea-binding sites and ATP-sensitive K+ channels in alpha-TC glucagonoma and beta-TC insulinoma cells. Diabetes 42, 1760-1772.
Rorsman, P. (1988). Two types of Ca2+ currents with different sensitivities to organic Ca2+ channel antagonists in guinea pig pancreatic alpha 2 cells. J.Gen.Physiol 91, 243-254.
Rorsman, P., Berggren, P. O., Bokvist, K., Ericson, H., Mohler, H., Ostenson, C. G., & Smith, P. A. (1989). Glucose-inhibition of glucagon secretion involves activation of GABAA-receptor chloride channels. Nature 341, 233-236.
Rorsman, P., Eliasson, L., Renstrom, E., Gromada, J., Barg, S., & Gopel, S. (2000). The Cell Physiology of Biphasic Insulin Secretion. News Physiol Sci. 15, 72-77.
Rorsman, P. & Hellman, B. (1988). Voltage-activated currents in guinea pig pancreatic alpha 2 cells. Evidence for Ca2+-dependent action potentials. J.Gen.Physiol 91, 223-242.
Rorsman, P. & Renstrom, E. (2003). Insulin granule dynamics in pancreatic beta cells. Diabetologia 46, 1029-1045.
Rothberg, K. G., Heuser, J. E., Donzell, W. C., Ying, Y. S., Glenney, J. R., & Anderson, R. G. (1992). Caveolin, a protein component of caveolae membrane coats. Cell 68, 673-682.
Rutter, G. A., Tsuboi, T., & Ravier, M. A. (2006). Ca2+ microdomains and the control of insulin secretion. Cell Calcium 40, 539-551.
Saher, G., Brugger, B., Lappe-Siefke, C., Mobius, W., Tozawa, R., Wehr, M. C., Wieland, F., Ishibashi, S., & Nave, K. A. (2005). High cholesterol level is essential for myelin membrane growth. Nat.Neurosci. 8, 468-475.
Sakura, H., Ammala, C., Smith, P. A., Gribble, F. M., & Ashcroft, F. M. (1995). Cloning and functional expression of the cDNA encoding a novel ATP-sensitive potassium channel subunit expressed in pancreatic beta-cells, brain, heart and skeletal muscle. FEBS Lett. 377, 338-344.
Sakurai, H., Dobbs, R., & Unger, R. H. (1974). Somatostatin-induced changes in insulin and glucagon secretion in normal and diabetic dogs. J.Clin.Invest 54, 1395-1402.
Salaun, C., Gould, G. W., & Chamberlain, L. H. (2005a). Lipid raft association of SNARE proteins regulates exocytosis in PC12 cells. J.Biol.Chem. 280, 19449-19453.
246
Salaun, C., Gould, G. W., & Chamberlain, L. H. (2005b). The SNARE proteins SNAP-25 and SNAP-23 display different affinities for lipid rafts in PC12 cells. Regulation by distinct cysteine-rich domains. J.Biol.Chem. 280, 1236-1240.
Salehi, A., Vieira, E., & Gylfe, E. (2006). Paradoxical stimulation of glucagon secretion by high glucose concentrations. Diabetes 55, 2318-2323.
Saltiel, A. R. (2001). New perspectives into the molecular pathogenesis and treatment of type 2 diabetes. Cell 104, 517-529.
Saltiel, A. R. & Olefsky, J. M. (1996). Thiazolidinediones in the treatment of insulin resistance and type II diabetes. Diabetes 45, 1661-1669.
Sanguinetti, M. C., Johnson, J. H., Hammerland, L. G., Kelbaugh, P. R., Volkmann, R. A., Saccomano, N. A., & Mueller, A. L. (1997). Heteropodatoxins: peptides isolated from spider venom that block Kv4.2 potassium channels. Mol.Pharmacol. 51, 491-498.
Santerre, R. F., Cook, R. A., Crisel, R. M., Sharp, J. D., Schmidt, R. J., Williams, D. C., & Wilson, C. P. (1981). Insulin synthesis in a clonal cell line of simian virus 40-transformed hamster pancreatic beta cells. Proc.Natl.Acad.Sci.U.S.A 78, 4339-4343.
Santiago, J. V., Clarke, W. L., Shah, S. D., & Cryer, P. E. (1980). Epinephrine, norepinephrine, glucagon, and growth hormone release in association with physiological decrements in the plasma glucose concentration in normal and diabetic man. J Clin.Endocrinol.Metab 51, 877-883.
Schade, A. E. & Levine, A. D. (2002). Lipid raft heterogeneity in human peripheral blood T lymphoblasts: a mechanism for regulating the initiation of TCR signal transduction. J.Immunol. 168, 2233-2239.
Scherer, P. E., Lisanti, M. P., Baldini, G., Sargiacomo, M., Mastick, C. C., & Lodish, H. F. (1994). Induction of caveolin during adipogenesis and association of GLUT4 with caveolin-rich vesicles. J.Cell Biol. 127, 1233-1243.
Scherer, P. E., Okamoto, T., Chun, M., Nishimoto, I., Lodish, H. F., & Lisanti, M. P. (1996). Identification, sequence, and expression of caveolin-2 defines a caveolin gene family. Proc.Natl.Acad.Sci.U.S.A 93, 131-135.
Schlegel, A., Schwab, R. B., Scherer, P. E., & Lisanti, M. P. (1999). A role for the caveolin scaffolding domain in mediating the membrane attachment of caveolin-1. The caveolin
247
scaffolding domain is both necessary and sufficient for membrane binding in vitro. J.Biol.Chem. 274, 22660-22667.
Schnitzer, J. E., McIntosh, D. P., Dvorak, A. M., Liu, J., & Oh, P. (1995). Separation of caveolae from associated microdomains of GPI-anchored proteins. Science 269, 1435-1439.
Schrader, M. (2004). Membrane targeting in secretion. Subcell.Biochem. 37, 391-421.
Schuit, F., De Vos, A., Farfari, S., Moens, K., Pipeleers, D., Brun, T., & Prentki, M. (1997). Metabolic fate of glucose in purified islet cells. Glucose-regulated anaplerosis in beta cells. J.Biol.Chem. 272, 18572-18579.
Schuit, F. C., Derde, M. P., & Pipeleers, D. G. (1989). Sensitivity of rat pancreatic A and B cells to somatostatin. Diabetologia 32, 207-212.
Schulla, V., Renstrom, E., Feil, R., Feil, S., Franklin, I., Gjinovci, A., Jing, X. J., Laux, D., Lundquist, I., Magnuson, M. A., Obermuller, S., Olofsson, C. S., Salehi, A., Wendt, A., Klugbauer, N., Wollheim, C. B., Rorsman, P., & Hofmann, F. (2003). Impaired insulin secretion and glucose tolerance in beta cell-selective Ca(v)1.2 Ca2+ channel null mice. EMBO J. 22, 3844-3854.
Schwartz, G. G., Olsson, A. G., Ezekowitz, M. D., Ganz, P., Oliver, M. F., Waters, D., Zeiher, A., Chaitman, B. R., Leslie, S., & Stern, T. (2001). Effects of atorvastatin on early recurrent ischemic events in acute coronary syndromes: the MIRACL study: a randomized controlled trial. JAMA 285, 1711-1718.
Sekine, N., Cirulli, V., Regazzi, R., Brown, L. J., Gine, E., Tamarit-Rodriguez, J., Girotti, M., Marie, S., MacDonald, M. J., Wollheim, C. B., & . (1994). Low lactate dehydrogenase and high mitochondrial glycerol phosphate dehydrogenase in pancreatic beta-cells. Potential role in nutrient sensing. J Biol.Chem. 269, 4895-4902.
Sell, H., Eckel, J., & Dietze-Schroeder, D. (2006). Pathways leading to muscle insulin resistance--the muscle--fat connection. Arch.Physiol Biochem. 112, 105-113.
Severs, N. J. (1988). Caveolae: static inpocketings of the plasma membrane, dynamic vesicles or plain artifact? J.Cell Sci. 90 ( Pt 3), 341-348.
Shapiro, A. M., Lakey, J. R., Ryan, E. A., Korbutt, G. S., Toth, E., Warnock, G. L., Kneteman, N. M., & Rajotte, R. V. (2000). Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N.Engl.J Med. 343, 230-238.
248
Sharma, P., Varma, R., Sarasij, R. C., Ira, Gousset, K., Krishnamoorthy, G., Rao, M., & Mayor, S. (2004). Nanoscale organization of multiple GPI-anchored proteins in living cell membranes. Cell 116, 577-589.
Sharom, F. J. & Lehto, M. T. (2002). Glycosylphosphatidylinositol-anchored proteins: structure, function, and cleavage by phosphatidylinositol-specific phospholipase C. Biochem.Cell Biol. 80, 535-549.
Shaw, A. S. (2006). Lipid rafts: now you see them, now you don't. Nat.Immunol. 7, 1139-1142.
Sheng, Z. H., Rettig, J., Cook, T., & Catterall, W. A. (1996). Calcium-dependent interaction of N-type calcium channels with the synaptic core complex. Nature 379, 451-454.
Sheu, L., Pasyk, E. A., Ji, J., Huang, X., Gao, X., Varoqueaux, F., Brose, N., & Gaisano, H. Y. (2003). Regulation of insulin exocytosis by Munc13-1. J.Biol.Chem. 278, 27556-27563.
Shibata, R., Misonou, H., Campomanes, C. R., Anderson, A. E., Schrader, L. A., Doliveira, L. C., Carroll, K. I., Sweatt, J. D., Rhodes, K. J., & Trimmer, J. S. (2003). A fundamental role for KChIPs in determining the molecular properties and trafficking of Kv4.2 potassium channels. J.Biol.Chem. 278, 36445-36454.
Shiota, C., Rocheleau, J. V., Shiota, M., Piston, D. W., & Magnuson, M. A. (2005). Impaired glucagon secretory responses in mice lacking the type 1 sulfonylurea receptor. Am.J.Physiol Endocrinol.Metab 289, E570-E577.
Shirakawa, R., Higashi, T., Tabuchi, A., Yoshioka, A., Nishioka, H., Fukuda, M., Kita, T., & Horiuchi, H. (2004). Munc13-4 is a GTP-Rab27-binding protein regulating dense core granule secretion in platelets. J.Biol.Chem. 279, 10730-10737.
Shyng, S. & Nichols, C. G. (1997). Octameric stoichiometry of the KATP channel complex. J.Gen.Physiol 110, 655-664.
Sieber, J. J., Willig, K. I., Heintzmann, R., Hell, S. W., & Lang, T. (2006). The SNARE motif is essential for the formation of syntaxin clusters in the plasma membrane. Biophys.J. 90, 2843-2851.
Simionescu, N., Siminoescu, M., & Palade, G. E. (1975). Permeability of muscle capillaries to small heme-peptides. Evidence for the existence of patent transendothelial channels. J.Cell Biol. 64, 586-607.
249
Simons, K. & Ehehalt, R. (2002). Cholesterol, lipid rafts, and disease. J.Clin.Invest 110, 597-603.
Simons, K. & Ikonen, E. (1997). Functional rafts in cell membranes. Nature 387, 569-572.
Simons, K. & Ikonen, E. (2000). How cells handle cholesterol. Science 290, 1721-1726.
Simons, K. & Toomre, D. (2000). Lipid rafts and signal transduction. Nat.Rev.Mol.Cell Biol. 1, 31-39.
Singer, S. J. & Nicolson, G. L. (1972). The fluid mosaic model of the structure of cell membranes. Science 175, 720-731.
Sjoholm, A. (1995). Regulation of insulinoma cell proliferation and insulin accumulation by peptides and second messengers. Ups.J Med.Sci. 100, 201-216.
Smart, E. J., Graf, G. A., McNiven, M. A., Sessa, W. C., Engelman, J. A., Scherer, P. E., Okamoto, T., & Lisanti, M. P. (1999). Caveolins, liquid-ordered domains, and signal transduction. Mol.Cell Biol. 19, 7289-7304.
Smith, P. A., Bokvist, K., & Rorsman, P. (1989). Demonstration of A-currents in pancreatic islet cells. Pflugers Arch. 413, 441-443.
Song, K. S., Li, S., Okamoto, T., Quilliam, L. A., Sargiacomo, M., & Lisanti, M. P. (1996). Co-purification and direct interaction of Ras with caveolin, an integral membrane protein of caveolae microdomains. Detergent-free purification of caveolae microdomains. J.Biol.Chem. 271, 9690-9697.
Song, Z., Levin, B. E., McArdle, J. J., Bakhos, N., & Routh, V. H. (2001). Convergence of pre- and postsynaptic influences on glucosensing neurons in the ventromedial hypothalamic nucleus. Diabetes 50, 2673-2681.
Sorensen, J. B. (2004). Formation, stabilisation and fusion of the readily releasable pool of secretory vesicles. Pflugers Arch. 448, 347-362.
Soria, B., Andreu, E., Berna, G., Fuentes, E., Gil, A., Leon-Quinto, T., Martin, F., Montanya, E., Nadal, A., Reig, J. A., Ripoll, C., Roche, E., Sanchez-Andres, J. V., & Segura, J. (2000). Engineering pancreatic islets. Pflugers Arch. 440, 1-18.
250
Stan, R. V. (2002). Structure and function of endothelial caveolae. Microsc.Res.Tech. 57, 350-364.
Straub, S. G. & Sharp, G. W. (2002). Glucose-stimulated signaling pathways in biphasic insulin secretion. Diabetes Metab Res.Rev. 18, 451-463.
Su, J., Yu, H., Lenka, N., Hescheler, J., & Ullrich, S. (2001). The expression and regulation of depolarization-activated K+ channels in the insulin-secreting cell line INS-1. Pflugers Arch. 442, 49-56.
Subtil, A., Gaidarov, I., Kobylarz, K., Lampson, M. A., Keen, J. H., & McGraw, T. E. (1999). Acute cholesterol depletion inhibits clathrin-coated pit budding. Proc.Natl.Acad.Sci.U.S.A 96, 6775-6780.
Sudhof, T. C. (2004). The synaptic vesicle cycle. Annu.Rev.Neurosci. 27, 509-547.
Sugii, S., Reid, P. C., Ohgami, N., Du, H., & Chang, T. Y. (2003). Distinct endosomal compartments in early trafficking of low density lipoprotein-derived cholesterol. J.Biol.Chem. 278, 27180-27189.
Sutton, R. B., Davletov, B. A., Berghuis, A. M., Sudhof, T. C., & Sprang, S. R. (1995). Structure of the first C2 domain of synaptotagmin I: a novel Ca2+/phospholipid-binding fold. Cell 80, 929-938.
Sutton, R. B., Fasshauer, D., Jahn, R., & Brunger, A. T. (1998). Crystal structure of a SNARE complex involved in synaptic exocytosis at 2.4 A resolution. Nature 395, 347-353.
Suzuki, M., Fujikura, K., Inagaki, N., Seino, S., & Takata, K. (1997). Localization of the ATP-sensitive K+ channel subunit Kir6.2 in mouse pancreas. Diabetes 46, 1440-1444.
Suzuki, M., Fujikura, K., Kotake, K., Inagaki, N., Seino, S., & Takata, K. (1999). Immuno-localization of sulphonylurea receptor 1 in rat pancreas. Diabetologia 42, 1204-1211.
Takahashi, E., Ito, M., Miyamoto, N., Nagasu, T., Ino, M., & Tanaka, I. (2005). Increased glucose tolerance in N-type Ca2+ channel alpha(1B)-subunit gene-deficient mice. Int.J.Mol.Med. 15, 937-944.
251
Takahashi, M., Seagar, M. J., Jones, J. F., Reber, B. F., & Catterall, W. A. (1987). Subunit structure of dihydropyridine-sensitive calcium channels from skeletal muscle. Proc.Natl.Acad.Sci.U.S.A 84, 5478-5482.
Takahashi, N., Hatakeyama, H., Okado, H., Miwa, A., Kishimoto, T., Kojima, T., Abe, T., & Kasai, H. (2004). Sequential exocytosis of insulin granules is associated with redistribution of SNAP25. J.Cell Biol. 165, 255-262.
Takahashi, R., Ishihara, H., Tamura, A., Yamaguchi, S., Yamada, T., Takei, D., Katagiri, H., Endou, H., & Oka, Y. (2006). Cell type-specific activation of metabolism reveals that beta-cell secretion suppresses glucagon release from alpha-cells in rat pancreatic islets. Am.J Physiol Endocrinol.Metab 290, E308-E316.
Takimoto, K., Yang, E. K., & Conforti, L. (2002). Palmitoylation of KChIP splicing variants is required for efficient cell surface expression of Kv4.3 channels. J.Biol.Chem. 277, 26904-26911.
Tanabe, K., Tucker, S. J., Matsuo, M., Proks, P., Ashcroft, F. M., Seino, S., Amachi, T., & Ueda, K. (1999). Direct photoaffinity labeling of the Kir6.2 subunit of the ATP-sensitive K+ channel by 8-azido-ATP. J.Biol.Chem. 274, 3931-3933.
Tang, Z., Scherer, P. E., Okamoto, T., Song, K., Chu, C., Kohtz, D. S., Nishimoto, I., Lodish, H. F., & Lisanti, M. P. (1996). Molecular cloning of caveolin-3, a novel member of the caveolin gene family expressed predominantly in muscle. J.Biol.Chem. 271, 2255-2261.
Taniguchi, C. M., Emanuelli, B., & Kahn, C. R. (2006). Critical nodes in signalling pathways: insights into insulin action. Nat.Rev.Mol.Cell Biol. 7, 85-96.
Taverna, E., Saba, E., Rowe, J., Francolini, M., Clementi, F., & Rosa, P. (2004). Role of lipid microdomains in P/Q-type calcium channel (Cav2.1) clustering and function in presynaptic membranes. J.Biol.Chem. 279, 5127-5134.
Terauchi, Y., Takamoto, I., Kubota, N., Matsui, J., Suzuki, R., Komeda, K., Hara, A., Toyoda, Y., Miwa, I., Aizawa, S., Tsutsumi, S., Tsubamoto, Y., Hashimoto, S., Eto, K., Nakamura, A., Noda, M., Tobe, K., Aburatani, H., Nagai, R., & Kadowaki, T. (2007). Glucokinase and IRS-2 are required for compensatory beta cell hyperplasia in response to high-fat diet-induced insulin resistance. J Clin.Invest 117, 246-257.
Theler, J. M., Mollard, P., Guerineau, N., Vacher, P., Pralong, W. F., Schlegel, W., & Wollheim, C. B. (1992). Video imaging of cytosolic Ca2+ in pancreatic beta-cells stimulated by glucose, carbachol, and ATP. J Biol.Chem. 267, 18110-18117.
252
Thomas, P., Ye, Y., & Lightner, E. (1996). Mutation of the pancreatic islet inward rectifier Kir6.2 also leads to familial persistent hyperinsulinemic hypoglycemia of infancy. Hum.Mol.Genet. 5, 1809-1812.
Thomas, P. M., Cote, G. J., Wohllk, N., Haddad, B., Mathew, P. M., Rabl, W., Aguilar-Bryan, L., Gagel, R. F., & Bryan, J. (1995). Mutations in the sulfonylurea receptor gene in familial persistent hyperinsulinemic hypoglycemia of infancy. Science 268, 426-429.
Thorens, B., Sarkar, H. K., Kaback, H. R., & Lodish, H. F. (1988). Cloning and functional expression in bacteria of a novel glucose transporter present in liver, intestine, kidney, and beta-pancreatic islet cells. Cell 55, 281-290.
Thurmond, D. C., Ceresa, B. P., Okada, S., Elmendorf, J. S., Coker, K., & Pessin, J. E. (1998). Regulation of insulin-stimulated GLUT4 translocation by Munc18c in 3T3L1 adipocytes. J.Biol.Chem. 273, 33876-33883.
Tian, Q., Stepaniants, S. B., Mao, M., Weng, L., Feetham, M. C., Doyle, M. J., Yi, E. C., Dai, H., Thorsson, V., Eng, J., Goodlett, D., Berger, J. P., Gunter, B., Linseley, P. S., Stoughton, R. B., Aebersold, R., Collins, S. J., Hanlon, W. A., & Hood, L. E. (2004). Integrated genomic and proteomic analyses of gene expression in Mammalian cells. Mol.Cell Proteomics. 3, 960-969.
Tooze, S. A. (1998). Biogenesis of secretory granules in the trans-Golgi network of neuroendocrine and endocrine cells. Biochim.Biophys.Acta 1404, 231-244.
Toselli, M., Biella, G., Taglietti, V., Cazzaniga, E., & Parenti, M. (2005). Caveolin-1 expression and membrane cholesterol content modulate N-type calcium channel activity in NG108-15 cells. Biophys.J. 89, 2443-2457.
Tozawa, R., Ishibashi, S., Osuga, J., Yagyu, H., Oka, T., Chen, Z., Ohashi, K., Perrey, S., Shionoiri, F., Yahagi, N., Harada, K., Gotoda, T., Yazaki, Y., & Yamada, N. (1999). Embryonic lethality and defective neural tube closure in mice lacking squalene synthase. J.Biol.Chem. 274, 30843-30848.
Trayhurn, P. & Beattie, J. H. (2001). Physiological role of adipose tissue: white adipose tissue as an endocrine and secretory organ. Proc.Nutr.Soc. 60, 329-339.
Trigatti, B. L., Anderson, R. G., & Gerber, G. E. (1999). Identification of caveolin-1 as a fatty acid binding protein. Biochem.Biophys.Res.Commun. 255, 34-39.
253
Trushina, E., Du, C. J., Parisi, J., & McMurray, C. T. (2006). Neurological abnormalities in caveolin-1 knock out mice. Behav.Brain Res. 172, 24-32.
Tsien, R. W., Lipscombe, D., Madison, D. V., Bley, K. R., & Fox, A. P. (1988). Multiple types of neuronal calcium channels and their selective modulation. Trends Neurosci. 11, 431-438.
Tu, J., Tuch, B. E., & Si, Z. (1999). Expression and regulation of glucokinase in rat islet beta- and alpha-cells during development. Endocrinology 140, 3762-3766.
Tucker, S. J., Gribble, F. M., Zhao, C., Trapp, S., & Ashcroft, F. M. (1997). Truncation of Kir6.2 produces ATP-sensitive K+ channels in the absence of the sulphonylurea receptor. Nature 387, 179-183.
Ueki, K., Okada, T., Hu, J., Liew, C. W., Assmann, A., Dahlgren, G. M., Peters, J. L., Shackman, J. G., Zhang, M., Artner, I., Satin, L. S., Stein, R., Holzenberger, M., Kennedy, R. T., Kahn, C. R., & Kulkarni, R. N. (2006). Total insulin and IGF-I resistance in pancreatic beta cells causes overt diabetes. Nat.Genet. 38, 583-588.
Uhles, S., Moede, T., Leibiger, B., Berggren, P. O., & Leibiger, I. B. (2003). Isoform-specific insulin receptor signaling involves different plasma membrane domains. J.Cell Biol. 163, 1327-1337.
Unger, R. H. (1985). Glucagon physiology and pathophysiology in the light of new advances. Diabetologia 28, 574-578.
Unger, R. H., Aguilar-Parada, E., Muller, W. A., & Eisentraut, A. M. (1970). Studies of pancreatic alpha cell function in normal and diabetic subjects. J Clin.Invest 49, 837-848.
Vallett, S. M., Sanchez, H. B., Rosenfeld, J. M., & Osborne, T. F. (1996). A direct role for sterol regulatory element binding protein in activation of 3-hydroxy-3-methylglutaryl coenzyme A reductase gene. J.Biol.Chem. 271, 12247-12253.
Varma, R. & Mayor, S. (1998). GPI-anchored proteins are organized in submicron domains at the cell surface. Nature 394, 798-801.
Varoqueaux, F., Sigler, A., Rhee, J. S., Brose, N., Enk, C., Reim, K., & Rosenmund, C. (2002). Total arrest of spontaneous and evoked synaptic transmission but normal synaptogenesis in the absence of Munc13-mediated vesicle priming. Proc.Natl.Acad.Sci.U.S.A 99, 9037-9042.
254
Veluthakal, R., Chvyrkova, I., Tannous, M., McDonald, P., Amin, R., Hadden, T., Thurmond, D. C., Quon, M. J., & Kowluru, A. (2005). Essential role for membrane lipid rafts in interleukin-1beta-induced nitric oxide release from insulin-secreting cells: potential regulation by caveolin-1+. Diabetes 54, 2576-2585.
Verge, C. F., Gianani, R., Kawasaki, E., Yu, L., Pietropaolo, M., Jackson, R. A., Chase, H. P., & Eisenbarth, G. S. (1996). Prediction of type I diabetes in first-degree relatives using a combination of insulin, GAD, and ICA512bdc/IA-2 autoantibodies. Diabetes 45, 926-933.
Vignali, S., Leiss, V., Karl, R., Hofmann, F., & Welling, A. (2006). Characterisation of voltage-dependent sodium and calcium channels in mouse pancreatic A- and B-cells. J.Physiol 572, 691-706.
Virkamaki, A., Ueki, K., & Kahn, C. R. (1999). Protein-protein interaction in insulin signaling and the molecular mechanisms of insulin resistance. J Clin.Invest 103, 931-943.
Voets, T., Neher, E., & Moser, T. (1999). Mechanisms underlying phasic and sustained secretion in chromaffin cells from mouse adrenal slices. Neuron 23, 607-615.
Walter, M., Davies, J. P., & Ioannou, Y. A. (2003). Telomerase immortalization upregulates Rab9 expression and restores LDL cholesterol egress from Niemann-Pick C1 late endosomes. J.Lipid Res. 44, 243-253.
Wang, C., Kerckhofs, K., Van de, C. M., Smolders, I., Pipeleers, D., & Ling, Z. (2006). Glucose inhibits GABA release by pancreatic beta-cells through an increase in GABA shunt activity. Am.J.Physiol Endocrinol.Metab 290, E494-E499.
Wang, C. T., Grishanin, R., Earles, C. A., Chang, P. Y., Martin, T. F., Chapman, E. R., & Jackson, M. B. (2001a). Synaptotagmin modulation of fusion pore kinetics in regulated exocytosis of dense-core vesicles. Science 294, 1111-1115.
Wang, C. T., Lu, J. C., Bai, J., Chang, P. Y., Martin, T. F., Chapman, E. R., & Jackson, M. B. (2003). Different domains of synaptotagmin control the choice between kiss-and-run and full fusion. Nature 424, 943-947.
Wang, X., Li, H., De Leo, D., Guo, W., Koshkin, V., Fantus, I. G., Giacca, A., Chan, C. B., Der, S., & Wheeler, M. B. (2004). Gene and protein kinase expression profiling of reactive oxygen species-associated lipotoxicity in the pancreatic beta-cell line MIN6. Diabetes 53, 129-140.
255
Wang, Y., Dulubova, I., Rizo, J., & Sudhof, T. C. (2001b). Functional analysis of conserved structural elements in yeast syntaxin Vam3p. J.Biol.Chem. 276, 28598-28605.
Wang, Y., Okamoto, M., Schmitz, F., Hofmann, K., & Sudhof, T. C. (1997). Rim is a putative Rab3 effector in regulating synaptic-vesicle fusion. Nature 388, 593-598.
Wang, Y., Thiele, C., & Huttner, W. B. (2000). Cholesterol is required for the formation of regulated and constitutive secretory vesicles from the trans-Golgi network. Traffic. 1, 952-962.
Watson, R. T., Kanzaki, M., & Pessin, J. E. (2004). Regulated membrane trafficking of the insulin-responsive glucose transporter 4 in adipocytes. Endocr.Rev. 25, 177-204.
Way, M. & Parton, R. G. (1995). M-caveolin, a muscle-specific caveolin-related protein. FEBS Lett. 376, 108-112.
Weber, T., Zemelman, B. V., McNew, J. A., Westermann, B., Gmachl, M., Parlati, F., Sollner, T. H., & Rothman, J. E. (1998). SNAREpins: minimal machinery for membrane fusion. Cell 92, 759-772.
Weir, G. C. & Bonner-Weir, S. (2007). A dominant role for glucose in beta cell compensation of insulin resistance. J Clin.Invest 117, 81-83.
Wellington, C. L., Walker, E. K., Suarez, A., Kwok, A., Bissada, N., Singaraja, R., Yang, Y. Z., Zhang, L. H., James, E., Wilson, J. E., Francone, O., McManus, B. M., & Hayden, M. R. (2002). ABCA1 mRNA and protein distribution patterns predict multiple different roles and levels of regulation. Lab Invest 82, 273-283.
Wendt, A., Birnir, B., Buschard, K., Gromada, J., Salehi, A., Sewing, S., Rorsman, P., & Braun, M. (2004). Glucose inhibition of glucagon secretion from rat alpha-cells is mediated by GABA released from neighboring beta-cells. Diabetes 53, 1038-1045.
Wheeler, M. B., Sheu, L., Ghai, M., Bouquillon, A., Grondin, G., Weller, U., Beaudoin, A. R., Bennett, M. K., Trimble, W. S., & Gaisano, H. Y. (1996). Characterization of SNARE protein expression in beta cell lines and pancreatic islets. Endocrinology 137, 1340-1348.
Wiederkehr, A. & Wollheim, C. B. (2006). Minireview: implication of mitochondria in insulin secretion and action. Endocrinology 147, 2643-2649.
256
Winter, W. E. & Schatz, D. (2003). Prevention strategies for type 1 diabetes mellitus: current status and future directions. BioDrugs. 17, 39-64.
Wiser, O., Bennett, M. K., & Atlas, D. (1996). Functional interaction of syntaxin and SNAP-25 with voltage-sensitive L- and N-type Ca2+ channels. EMBO J. 15, 4100-4110.
Wiser, O., Tobi, D., Trus, M., & Atlas, D. (1997). Synaptotagmin restores kinetic properties of a syntaxin-associated N-type voltage sensitive calcium channel. FEBS Lett. 404, 203-207.
Wiser, O., Trus, M., Hernandez, A., Renstrom, E., Barg, S., Rorsman, P., & Atlas, D. (1999). The voltage sensitive Lc-type Ca2+ channel is functionally coupled to the exocytotic machinery. Proc.Natl.Acad.Sci.U.S.A 96, 248-253.
Withers, D. J., Gutierrez, J. S., Towery, H., Burks, D. J., Ren, J. M., Previs, S., Zhang, Y., Bernal, D., Pons, S., Shulman, G. I., Bonner-Weir, S., & White, M. F. (1998). Disruption of IRS-2 causes type 2 diabetes in mice. Nature 391, 900-904.
Wollheim, C. B. & Maechler, P. (2002). Beta-cell mitochondria and insulin secretion: messenger role of nucleotides and metabolites. Diabetes 51 Suppl 1, S37-S42.
Wong, W. & Schlichter, L. C. (2004). Differential recruitment of Kv1.4 and Kv4.2 to lipid rafts by PSD-95. J.Biol.Chem. 279, 444-452.
Xia, F., Gao, X., Kwan, E., Lam, P. P., Chan, L., Sy, K., Sheu, L., Wheeler, M. B., Gaisano, H. Y., & Tsushima, R. G. (2004). Disruption of pancreatic beta-cell lipid rafts modifies Kv2.1 channel gating and insulin exocytosis. J.Biol.Chem. 279, 24685-24691.
Xia, F., Leung, Y. M., Gaisano, G., Gao, X., Chen, Y., Manning Fox, J. E., Bhattacharjee, A., Wheeler, M. B., Gaisano, H. Y., & Tsushima, R. G. (2007). Targeting of KV4, CaV1.2 and SNARE Proteins to Cholesterol-Rich Lipid Rafts in Pancreatic alpha-cells: Effects on Glucagon Stimulus-Secretion Coupling. Endocrinology 148, 2157-2167.
Xia, F., Xie, L., Mihic, A., Gao, X., Chen, Y., Gaisano, H. Y., & Tsushima, R. G. (2008). Inhibition of Cholesterol Biosynthesis Impairs Insulin Secretion and Voltage-Gated Calcium Channel Function in Pancreatic beta-Cells. Endocrinology.
Xu, E., Kumar, M., Zhang, Y., Ju, W., Obata, T., Zhang, N., Liu, S., Wendt, A., Deng, S., Ebina, Y., Wheeler, M. B., Braun, M., & Wang, Q. (2006). Intra-islet insulin suppresses glucagon release via GABA-GABAA receptor system. Cell Metab 3, 47-58.
257
Xu, T., Binz, T., Niemann, H., & Neher, E. (1998). Multiple kinetic components of exocytosis distinguished by neurotoxin sensitivity. Nat.Neurosci. 1, 192-200.
Xu, T., Rammner, B., Margittai, M., Artalejo, A. R., Neher, E., & Jahn, R. (1999). Inhibition of SNARE complex assembly differentially affects kinetic components of exocytosis. Cell 99, 713-722.
Xuan, S., Kitamura, T., Nakae, J., Politi, K., Kido, Y., Fisher, P. E., Morroni, M., Cinti, S., White, M. F., Herrera, P. L., Accili, D., & Efstratiadis, A. (2002). Defective insulin secretion in pancreatic beta cells lacking type 1 IGF receptor. J Clin.Invest 110, 1011-1019.
Yamamoto, M., Toya, Y., Schwencke, C., Lisanti, M. P., Myers, M. G., Jr., & Ishikawa, Y. (1998). Caveolin is an activator of insulin receptor signaling. J.Biol.Chem. 273, 26962-26968.
Yan, L., Figueroa, D. J., Austin, C. P., Liu, Y., Bugianesi, R. M., Slaughter, R. S., Kaczorowski, G. J., & Kohler, M. G. (2004). Expression of voltage-gated potassium channels in human and rhesus pancreatic islets. Diabetes 53, 597-607.
Yanada, E. (1955). The fine structure of the gall bladder epithelium of the mouse. J.Biophys.Biochem.Cytol. 1, 445-458.
Yaney, G. C. & Corkey, B. E. (2003). Fatty acid metabolism and insulin secretion in pancreatic beta cells. Diabetologia 46, 1297-1312.
Yang, S. N. & Berggren, P. O. (2005). CaV2.3 channel and PKClambda: new players in insulin secretion. J.Clin.Invest 115, 16-20.
Yang, S. N. & Berggren, P. O. (2006). The role of voltage-gated calcium channels in pancreatic beta-cell physiology and pathophysiology. Endocr.Rev. 27, 621-676.
Yang, S. N., Larsson, O., Branstrom, R., Bertorello, A. M., Leibiger, B., Leibiger, I. B., Moede, T., Kohler, M., Meister, B., & Berggren, P. O. (1999). Syntaxin 1 interacts with the L(D) subtype of voltage-gated Ca(2+) channels in pancreatic beta cells. Proc.Natl.Acad.Sci.U.S.A 96, 10164-10169.
Yellen, G. (2002). The voltage-gated potassium channels and their relatives. Nature 419, 35-42.
Yokoyama, S. (2005). Assembly of high density lipoprotein by the ABCA1/apolipoprotein pathway. Curr.Opin.Lipidol. 16, 269-279.
258
Yoshimoto, Y., Fukuyama, Y., Horio, Y., Inanobe, A., Gotoh, M., & Kurachi, Y. (1999). Somatostatin induces hyperpolarization in pancreatic islet alpha cells by activating a G protein-gated K+ channel. FEBS Lett. 444, 265-269.
Zagotta, W. N., Hoshi, T., & Aldrich, R. W. (1990). Restoration of inactivation in mutants of Shaker potassium channels by a peptide derived from ShB. Science 250, 568-571.
Zajchowski, L. D. & Robbins, S. M. (2002). Lipid rafts and little caves. Compartmentalized signalling in membrane microdomains. Eur.J.Biochem. 269, 737-752.
Zhou, H., Tran, P. O., Yang, S., Zhang, T., LeRoy, E., Oseid, E., & Robertson, R. P. (2004). Regulation of alpha-cell function by the beta-cell during hypoglycemia in Wistar rats: the "switch-off" hypothesis. Diabetes 53, 1482-1487.
![Metabolisme Lipid [Recovered]](https://static.fdocument.org/doc/165x107/55cf98ee550346d0339a8594/metabolisme-lipid-recovered.jpg)
