Integrin α high cell population functions as an initiator in...

Integrin α6 marks stem cell-like cells in human liposarcoma

1

Integrin α6high cell population functions as an initiator in

tumorigenesis and relapse of human liposarcoma

Lu Wang1, Lingxian Wang1, Yanhong Gu1,2, Yongqian Shu2 , Yan Shen1 and

Qiang Xu1*

1 State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences,

Nanjing University, Nanjing 210093, China; 2 Department of Clinical Oncology,

The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029, China

Running Title: Integrin α6 marks stem cell-like cells in human liposarcoma

Key words: liposarcoma, cancer stem cells, integrin α6, tumorigenesis

Abbreviations List: ADCs, human normal adipose derived cells; CSC, cancer

stem cells; ECM, Extracellular matrix

Footnotes:

1. This study was supported by national Natural Science Foundation of China

(Nos. 30730107 and 90913023), Science Fund for Creative Research Groups

(No. 30821006), and Natural Science Foundation of Jiangsu Province

(BK2008022).

on June 19, 2018. © 2011 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on October 6, 2011; DOI: 10.1158/1535-7163.MCT-11-0487

http://mct.aacrjournals.org/


2

2.*Corresponding author. State Key Laboratory of Pharmaceutical Biotechnology,

School of Life Sciences, Nanjing University, 22 Han Kou Road, Nanjing 210093,

China Tel & Fax: 86-25-8359-7620 E-mail: [email protected] (Q. Xu)

The authors indicate no potential conflicts of interest.





3

Abstract

The relapse and resistance to chemo- and radiotherapy are main problems in the

treatment of human liposarcoma. It is important to find a functional marker

existing in the liposarcoma cells for targeting. In this report, we established a new

sub-cell line SW872-S cells with high tumorigenicity from human liposarcoma

SW-872 cells by repeated inoculation approach. The characteristic of the sub-cell

line is linked to the high levels of integrin α6 on the surface. The integrin α6high

cells show much higher tumor initiation and self-renewal potential in vivo than

integrin α6low cells do. Targeting integrin α6 with its specific siRNA and antibody

significantly inhibits the cell adhesion to laminin and the tumor growth in vitro and

in vivo, respectively. Interestingly, integrin α6 marks almost all of the surgical

biopsy specimens of patients with liposarcoma relapse. Moreover, integrin α6 is

found to co-express with CD13, which might contribute to anti-apoptosis ability of

integrin α6high cells. Consistently, integrin α6high cells are more sensitive to the

CD13 inhibitor bestatin, and 61% of 23 other human tumor cell lines also contain

integrin α6high CD13high subgroup. These results provide evidence, for the first

time, to our knowledge, that integrin α6 and CD13 can serve as functional

markers of the tumor-initiation sub-cell population in human liposarcoma as well

as other cancers for therapeutic targeting.





4

Introduction

Liposarcoma is the most common soft tissue sarcoma and accounts for at least

20% of all sarcomas in adults (1). The two major location of liposarcoma are the

extremities and the retroperitoneum (2). Surgery almost serves as the sole

therapy for localized liposarcoma and there is few effective treatment option (3).

For high grade liposarcoma such as lipoblastic sarcoma, 100% of local

recurrence will be present within 5 years, and half of them had a distant relapse.

Moreover, liposarcoma is highly resistant to chemotherapy and radiotherapy. All

these findings suggest the existence of a sub-group of cells with higher

tumorigenicity in human liposarcoma.

Extracellular matrix (ECM) proteins are key structural components of the

perivascular niche. The proteins are known to play a role in the proliferation and

migration of normal stem cells and tumor cells (4) and in liposarcoma

progression (5). One of the functions of ECM in regulating cell behavior is

through their receptors on the cell surface called heterodimer integrins, which

consist of α and β subunits (6). Integrin α6, the receptor for the ECM protein

laminin, forms heterodimers with integrin β1 or β4. Integrin α6 is highly

expressed in gastrointestinal stromal tumors (7), embryonic, hematopoeitic and

neural stem cells (8). Resent studies suggest that integrin α6 is important for the

tumourigenicity of stem cell-like subpopulation within breast cancer cells (9). It is

also known that integrin α6-positive cells are enriched in adult prostatic





5

progenitor/stem cells (10). Justin D. Lathia et al. demonstrated that integrin α6

may serve as a functional marker of human glioblastoma stem cells (11).

In the present study, for the first time, we established a sub-cell line (SW872-S)

derived from human liposarcoma cells SW872 by repeated inoculation approach

in nude mice, which showed high tumor initiation ability in vivo. The SW872-S

cells revealed higher adhesion ability to laminin but not to fibronectin than

SW872 cells did. This result was then linked to the up-regulated expression of

integrin α6 in SW872-S cells, which is rarely expressed in normal adipose

derived cells (12). Furthermore, integrin α6high cells showed much higher tumor

formation in mice than integrin α6low cells did. Consistently, integrin α6-positive

cells were confirmed in tumor tissues of patients who suffered from liposarcoma

relapse within 2 years after surgery. Moreover, the co-high expression of integrin

α6 with aminopeptidase N (CD13) was observed and the functions were

examined. The findings obtained here provide a novel characteristic of the new

sub-cell line of human liposarcoma.

Materials and Methods

Animals

Six-week-old NCR-nu/nu (nude) female mice were purchased from the Shanghai

Laboratory Animal Center (Shanghai, China). They were maintained in pathogen-

free condition at 22±2 °C and kept on a 12-h light–dark cycle. Animal welfare and





6

experimental procedures were carried out strictly in accordance with the Guide

for the Care and Use of Laboratory Animals (The Ministry of Science and

Technology of China, 2006) and the related ethical regulations of our university.

All efforts were made to minimize the animals’ suffering and to reduce the

number of animals used.

Isolation of high tumorigenicity sub-cell population using repeating

inoculation approach

SW872 cells at the logarithmic growth phase were suspended in ice-cold PBS to

a final density of 107/ml, and injected into the right flank of nude mice with 100 μl.

Six months later, neoplasm formed in 2 of 30 mice. The mice with tumor were

then sacrificed and the isolated cells from the tumor tissue were cultured as

method mentioned above. These cells were re-inoculated into nude mice after in

vitro culture for 5 generations. After 3 times of the repeated inoculation approach,

the sub-cell line with high tumorigenicity in vivo was designed as SW872-S cells.

Cell Culture

Human liposarcoma cell line SW872 cells were purchased from the American

Type Culture Collection (Rockville, MD). Cells were maintained in L-15 Medium

supplemented with 10% fetal bovine serum (FBS, Life Technologies), 100 U/ml

penicillin and 100 μg/ml streptomycin and incubated at 37 °C. Human melanoma

cell lines SKMEL-1, A875, A375; human liver cancer cell lines HepG2, BEL-7402;

human breast cancer cell lines MCF-7, MDA-MB-435S; human ovarian cancer





7

cell lines CAOV3, SKOV3; human renal cell carcinoma cell lines 786-O; human

colon cancer cell lines Colo 205, HT29, SW620, HUT-116; human fibrosarcoma

cell line HT1080; human pancreatic cancer cell line PANC-1; human lung cancer

cell line A549; human cervical cancer cell line Hela; human prostate cell line PC3

were obtained from American Type Culture Collection (ATCC). Human

melanoma cell line M14, human liver cancer cell line SMMC7221; human renal

cell carcinoma cell line OS-RC2; human gallbladder carcinoma cell line GBC-SD

were purchased from the Cell Institute Country Cell Bank, Institute of

Biochemistry and Cell Biology, Chinese Academy of Sciences, Shanghai, China.

These cells were maintained with DMEM containing 10% FBS, at 37 °C with 5%

CO2. No independent authentication of these cells was done by the authors.

Lipoaspirates from surgery (supplied by obtained from The First Affiliated

Hospital of Nanjing Medical University) were washed extensively with ice-cold

PBS to remove the containing debris and blood cells. Then the tissues were

treated with 0.15% collagenase (type I) containing 0.1% BSA in PBS for 30 min

at 37 °C with gentle agitation. The cellular pellet digested from tissues was then

resuspended in low-glucose DMEM/10% FBS. Human sample investigations

were preceded by local institutional review board approval.

Cell adhesion assay

The cell adhesion assay was performed as before (Wu et al., 2004). In brief, 96-

well, flat-bottom culture plates were coated with 50 μl of fibronectin (10 μg/ml),

laminin (10 μg/ml) (Calbiochem, San Diego, CA), or collagen type I (50 μg/ml)





8

(Sigma Chemical Co.) in PBS overnight at 4°C, respectively. Plates were then

blocked with 0.2% bovine serum albumin for 2 hours at room temperature

followed by washing three times with DMEM. The cells were harvested with

trypsin/EDTA, washed with ice cold PBS for twice, and re-suspended in DMEM

medium. Cells (2 × 104/well) were added to each well in triplicate and incubated

for 30 minutes at 37 °C. Plates were then washed three times with DMEM

medium to remove unbounded cells. Cells remaining attached to the plates were

quantified with MTT assay.

Real-time PCR

Quantitative PCR was performed with the ABI Prism 7000 sequence detection

system (Applied Biosystems, Foster City, CA) using SYBR Green I dye (Biotium,

Inc., Hayward, CA), and threshold cycle numbers were obtained using ABI Prism

7000 SDS software version 1.0. Conditions for amplification were one cycle of

94°C for 5 minutes followed by 35 cycles of 94°C for 30 seconds, 59°C for 35

second, and 72°C for 45 seconds. The primer sequences used in this study were

as follows: integrin a1 forwad, 5’-GGTTCCTACTTTGGCAG-3’; reverse, 5’-

AACCTTGTCTGATTGAGAG-3’; integrin a2 forwad, 5’-

GGAACGGGACTTTCGCAT-3’; reverse, 5’-GGTACTTCGGCTTTCT-3’; integrin

a3 forwad, 5’-AAGGGACCTTCAGGTGCA-3’; reverse, 5’-

TGTAGCCGGTGATTTACCAT-3’; integrin a4 forwad, 5’-

GCTTCTCAGATCTGCTCGTG-3’; reverse, 5’-GTCACTTCCAACGAGGTT-3’;

integrin a5 forwad, 5’-TGCAGTGTGAGGCTGTGTACA-3’; reverse, 5’-





9

GTGGCCACCTGACGCTCT-3’; integrin a6 forwad, 5’-

TTGAATATACTGCTAACC-3’; reverse, 5’-TCGAAACTGAACTCTTGAGGA-3’;

integrin a7 forwad, 5’-CTGTTTCAGCTACATTGCA-3’; reverse, 5’-

GCCTGGTGCTTGGGTT-3’; integrin av forwad, 5’-AATCTTCCAATTGAGGATA-

3’; reverse, 5’-AAAACAGCCAGTAGCAA-3’; integrin a11 forwad, 5’-

GGAGGAAGACTTGCG-3’; reverse, 5’-CACAGGTTCCCCAGTA-3’; CD9 forwad,

5’-ACTGTTCTTCGGCTT-3’; reverse, 5’-AAAATCCCAAAAATCT-3’; CD10

forwad, 5’-TGTGGCCAGATTGATT-3’; reverse, 5’-TTGTAGGTTCGGCTGA-3’;

CD13 forwad, 5’-CCCAAGATGTCCACGTA-3’; reverse, 5’-

GGTGCTGATGGCATTAACCT-3’; CD44 forwad, 5’-

CAACTCCATCTGTGCAGCA-3’; reverse, 5’-GTAACCTCCTGAAGTGCT-3’;

CD55 forwad, 5’-AAGTAATCTTTGGCTGTAAGG-3’; reverse, 5’-

TTCACCAGCATGTTTTACCTTT-3’; CD59 forwad, 5’-

CGTAGTCCGCTTTCTCTTG-3’; reverse, 5’-CTGCCAGAAGTCCTCTA-3’; CD90

forwad, 5’-CTAGTGGACCAGAGC-3’; reverse, 5’-GCCCTCACACTTGACCAG-3’;

CD166 forwad, 5’-CCAAGAAGGAGGAGGAATA-3’; reverse, 5’-

CCATTCCTGTACCAT-3’; β-actin forwad, 5’-GCTGTGCTACGTCGC-3’; reverse,

5’-GGAGGAGCTGGAAGC-3’;

RNA interference

Chemically synthesized 21-nucleotide sense and antisense RNA

oligonucleotides were obtained from Invitrogen. Cells were plated on six-well

plates at 3×105 cells per well and transfected with 100 pmol of siRNA duplex per





10

well using Oligofectamine (Invitrogen). CD13 siRNA sequences were as follows:

5’- AACGAUCUCUUCAGCACAUCA -3’, Luciferase siRNA was used as

described before (13). Integrin α6 specific SMARTpool® siRNA reagent

(Dharmacon, IL) was used to knockdown endogenous integrin α6 in cells.

Immunohistochemistry and H&E staining assay.

Immunostaining of Integrin α6 was done using Real Envision Detection kit (Gene

Tech Company, Nanjing, China) according to the manufacturer’s instructions.

H&E staining in tumor tissues were performed following manufacturer’s protocol.

Western blot

Western blot assay was performed as described (13). Antibodies to Src,

phosphorylated Src(Tyr416), Akt, phosphorylated Akt (Ser473), phosphorylated

ERK, Bcl-2, cleaved caspase 3, cleaved PARP (Cell Signaling Technology,

Danvers, MA); antibody to integrin α6, GAPDH, CD13 (Santa Cruz, CA) ;

antibody to FAK, phosphorylated FAK (Tyr397) (BD Biosciences, San Jose, CA)

were respectively used for blotting, and detection was performed by enhanced

chemiluminescence (Amersham Pharmacia Biotech, Piscataway, NJ).

Colony formation in soft agar

Two hundreds of SW872 or SW872-S cells were embedded in 0.3% Noble agar

in DMEM containing 10% FBS. Then the clotted agar was plated on a 0.6% agar





11

base in the same medium. Fourteen days later, the plates were photographed

using a Nikon inverted microscope and colonies (> 50 cells) were counted.

Flow cytometry and cell sorting

Laminin specific integrins (integrin α1, α2, α3, α6, β1, β4) were measured by

using Laminin-Specific Integrins Investigator Kit (ECM420, Millipore), isotype-

matched mouse immunoglobulins served as control. For flow cytometry, samples

were analyzed using a FACSCalibur flow cytometer and CellQuest software (BD

Biosciences). For cell sorting by flow cytometry, samples were analyzed and

sorted on a BD FACSVantage SE (BD Biosciences). For the integrin α6 high and

low populations, the stained cells with the upper 30% or lower 30% of

fluorescence intensity were selected, respectively.

Statistical analysis

Data are expressed as mean ± SD. Student’s t test was used to evaluate the

difference between two groups. Kaplan-Meier method was used to evaluate the

survival test. P < 0.05 was considered to be significant.





12

Results:

A new sub-cell line derived from human liposarcoma cells SW872 is

established and characterized with much stronger tumor-initiating potential

in mice.

SW872 cells (3×105) were injected into the right flank of nude mice (n=30). Six

months later, the mice with tumors (2 in 30) were sacrificed and the tumor cells

collected were re-inoculated into the naive nude mice. After 3 rounds of selection

as mentioned in Methods section, we obtained a sub-cell line of SW872 cells

(SW872-S) with high aggressive tumor formation potential in nude mice, while

SW872 cells only showed a slight tumor growth (Fig. 1A). H & E staining

revealed that the tumor tissues formed by both cell lines were composed by

lipoblastoma cells (Fig. 1B), indicating that both cell lines belong to the same

classification. In soft agar, SW872-S cells formed bigger and more clones, and

possessed 5-fold colony formation numbers (>50 cells) than SW872 cells (Fig.

1C). As compared with no visible tumor in SW872 cell-inoculated nude mice, we

observed tumor formation in all of the mice (n=8) injected with the same amount

of SW872-S cells (1×105). The smaller amount of 1×104 and even as few as

1×103 SW872-S cells formed tumor in 2 of 8, and 1 of 8 nude mice, respectively

(Fig. 1D).

SW872-S cells show a specifically increased adhesion to laminin with an

elevated expression of integrin α6.





13

In order to detect the underlying mechanism of tumor-initiating potential between

the two cell lines, we compared the adhesion ability of SW872 and SW872-S

cells. SW872-S cells showed higher adherent ability to laminin but not to

fibronectin or collagen (Fig. 2A), suggesting the involvement of laminin-specific

integrins in the sub-line cells. FACS analyzing revealed that among all the

binding integrins to laminin, integrin α6 was the only high-expressing one on cell

surface of SW872-S cells, while there was a decrease of integrin α1(Fig. 2B).

Figure 2C showed that among integrin α family, integrin α6 the only higher

expression one in SW872-S cells, indicating integrin α6 may contribute largely to

the high adhesion ability on laminin of SW872-S cells. Consistent with the result,

blocking with integrin α6 specific antibody (Clone: CoH3) significantly inhibited

the adhesion of SW872-S cells to laminin in a dose-dependent manner (Fig. 2D).

Integrin α6 contributes to the increased liposarcoma growth in vitro and in

vivo.

As shown in Fig. 3A, SW872-S cells grew faster than SW872 cells in vitro. To

examine the relation of such enhanced cell growth to the increased expression of

integrin α6, we divided SW872-S cells into two compartments according to

integrin α6 levels (low and high) by FACS sorting and used them for comparison.

After 72-hour culture, the α6high cells proliferated 2 times as α6low cells (Fig. 3B),

and knocking down of integrin α6 with its specific smartpool siRNA significantly

decreased the growth of SW872-S cells (Fig. 3C). We then inoculated into right

flank of nude mice with 1×106 SW872-S cells that were pre-incubated with





14

control antibody or integrin α6 monoclonal antibody for 30 min, respectively. As

shown in Fig. 3D, treating with integrin α6 antibody significantly inhibited the

growth of SW872-S cells in mice. In this case, the tumor formation rate of

SW872-S cells was also reduced to 60%, as compared with the rate of 100% of

control.

Integrin α6 expression associates with human liposarcoma relapse.

Patients with high grade liposarcoma always suffered from high relapse

frequency within 5 years. This fact leads us to presume that there exists a sub-

group of cells with high tumorigenicity in human liposarcoma. To test this

assumption, we collected liposarcoma specimens from 30 patients who suffered

from recurrence within two years, 6 samples of well-differentiated liposarcoma

with good prognosis and 3 samples of human normal fat tissues. We examined

the involvement of integrin α6 in human liposarcoma recurrence by means of

immunohistochemistry. As the result, 90% (27 in 30) of recurrent samples

contained integrin α6-positive cells and the representative pictures respectively

from dedifferentiated, pleomorphic and round cell liposarcoma, while we could

not detect remarkable integrin α6 positive staining cells in neither well-

differentiated liposarcoma samples, nor the normal fat tissue samples.

Accordingly, FACS analysis revealed that about 6.9% of integrin α6-positive cells

in human primary liposarcoma while human normal adipose derived cells (ADCs)

contained no integrin α6-positive cells (Fig. 4B).





15

Integrin α6high liposarcoma cells show high self-renewal and tumorigenicity

with activated FAK/Src/ERK signaling.

When cultured in serum-free medium, SW872-S cells with integrin α6 high

expression still proliferate well and the cell numbers were increased by 6.8 and

15.1 times after 24 and 48 hours, respectively (Fig. 5A). The SW872-S cells

showed an asymmetrical distribution of the integrin α6 expression in a cell as

well as in divided daughter cells during cell division (Fig. 5B, left panel). Further

analysis was performed to test the self-renewal ability of integrin α6 cells. The

α6high cells and α6low cells at 106 were inoculated into the right flank of nude mice,

and allowed to grow for 4 weeks. Interestingly, a totally reduced integrin α6

expression was observed in the tumor tissues from integrin α6high cells inoculated

mice by RT-PCR (Fig. 5B, middle panel) or FACS (right panel) , and in this case,

there was a greatly enhanced tumor growth in the mice. In soft agar, integrin

α6high cells have stronger colony formation than integrin α6low cells (Fig. 5C).

When injected into nude mice, 5000 α6high cells initiated tumors in 6 of 8 animals,

while the same amount of α6low cells only did in 2 of 8 mice. Similarly, 500 α6high

cells and α6low cells formed tumors in 2 of 4 and 0 mice, respectively (Fig. 5D). In

SW872-S cells, we found increased phosphorylation levels of FAK (tyr925), Src

(Tyr416), ERK and Akt (ser473), as well as up-regulated expression of Bcl-2.

Consistently, the sub-population with integrin α6high isolated from SW872-S cells

also showed stronger activation of FAK/Src/ERK pathway, and expression of Bcl-

2 (Fig. 5E).





16

Integrin α6high liposarcoma cells express high levels of aminopeptidase N

(CD13).

For liposarcoma is a malignant tumor that arises in fat cells, we measured

several markers that have been reported to express on the surface of human

adipose derived cells (ADCs) (12) by real-time PCR. The results revealed that

there were no significant changes in the expressions of CD44, CD55, and CD59

between SW872 and SW872-S cells. However, the expressions of CD9, CD10

and CD13 were significantly elevated in SW872-S cells, while those of CD90 and

CD166 were decreased in the cells (Fig. 6A). We further identified that in

SW872-S cells, the α6high group displayed 3 times CD13 expression as α6low

group, while there were no significant or just slender changes in the other

markers (Fig. 6B). The co-high expression of integrin α6 and CD13 was found in

SW872-S cells about 12 times than in SW872 cells (Fig. 6C, upper level). The

high expression of CD13 could also been observed in integrin α6high cells (Fig.

6C, lower panel). In addition, we found that in 23 other human cancer cell lines,

61% (Supplementary Fig.1) of which contained integrin α6- and CD13- double

positive sub groups (Supplementary Fig. 2). The integrin α6high CD13 high cells

showed the highest level of phosphorylated Src as well as the expression of Bcl-

2, as compared with α6howCD13low, α6highCD13low, and α6lowCD13high cells (Fig.

6D). Knocking down of CD13 expression induced apoptosis in SW872-S cells

(Fig. 6E, upper panel) as well as in some other malignant cancer cells

(Supplementary Fig. 3). CD13 specific inhibitor bestatin also induced apoptosis in

SW872-S cells in dose-dependent manner (Fig. 6E, lower panel). The integrin





17

α6high cells were more sensitive to the bestatin treatment than integrin α6low cells,

in which the proliferation of both cells were dose-dependently inhibited (Fig. 6F).

Consistent with the in vitro experiment, 20 mg/kg/day treatment of bestatin could

also inhibite the SW872-S cells growth in nude mice (Fig. 6G).

Discussion

Patients with liposarcoma always suffered from high risk of relapse, and 100% of

local recurrence will be present within 5 years such as lipoblastic liposarcoma

despite of thorough surgery treatment (14). This fact lets us to think about if there

is a sub-group of cells with high tumorigenicity in human liposarcoma tissues.

In the present study, we tried to generate the possibly existing sub-population by

an in vivo repeated inoculation approach with a small amount of cells as

mentioned in Materials and Methods. After nine-month selection, a sub-cell line

(SW872-S) was obtained from human liposarcoma SW872 cells, which have

been previously demonstrated unable or difficult to initiate tumors in nude mice

(15). The SW872-S cells obtained revealed extremely high tumorigenicity in the

nude mice. The elevated tumorigenicity of SW872-S cells was also exhibited in

the assays of colony formation (Fig. 1C), and specific cell adhesion to laminin but

not to fibronectin or collagen type I (Fig. 2A). This result suggests an involvement

of laminin-specific integrins in the functions of the sub-line cells. In order to prove

this assumption, we compared the expressions of various integrins associated

with laminin adhesion on the surface of SW872-S cells with SW872 cells, and

found that integrin α6 but not all the other integrins was elevated. The decrease





18

of integrin α1 in SW872-S cells seemed to be in less relationship with cell

adhesion ability on laminin, at least in our system, for integrin a1 antibody could

not inhibit neither SW872 cells nor SW872-S cells adhesion on laminin (data not

shown). Furthermore, blocking with integrin α6 specific antibody (Clone CoH3)

significantly inhibited the adhesion of SW872-S cells to laminin in vitro (Fig. 2D),

and the tumor growth in vivo (40.77% of inhibition rate) (Fig. 3D). These findings

strongly suggest that the high tumorigenicity of the sub-cell population could be

linked to integrin α6 at least as one of the important factors.

In previous studies, integrin α6 has been reported as subunit form heterodimers

with either β1 or β4 integrins, which both function as receptors for the laminin

family of ECM. Activated α6β1 or α6β4 components then bring extra-cellular

signal to active PI3K/Akt pathway or hif dependent pathway, respectively (16).

High expression of the α6 subunit in women with breast cancer has been

demonstrated to be correlated significantly with reduced survival times (9).

Recently, integrin α6 has been suggested as a potential marker of cancer stem

cells in human glioblastoma (11). In addition, integrin α6 is critical to the self-

renewal and tumor formation of the glioblastoma stem cells, and knocking-down

or blocking with α6 specific antibody could significantly inhibit glioblastoma

growth in vitro and in vivo (11). This report is in consistence with our data shown

in Fig. 2, suggesting that integrin α6 may be crucial for initiating tumor growth in

some kinds of cancers.





19

As reported by D-S. Kim, et. al., rapid adhering cells of human epidermal

keratinocytes with high levels of integrin α6 show a smaller size, which have high

ability of colony formation and skin equivalents reconstruction (17). In our study,

we noticed that in SW872-S cells, integrin α6high sub-group could grow in serum-

free medium at least more than 72 hours (Fig. 5A), and the size of proliferated

integrin α6high cells were also smaller than the others according to FACS analysis

(Fig. 5A). The underlying mechanism, however, remains unknown. Nevertheless,

we have evidenced that integrin α6 was distributed asymmetrically on the surface

of a cell and the expression level was quite different in divided daughter cells

during cell division. This finding suggests that integrin α6high cells could

differentiate into both integrin α6high and α6low cells. In fact, the integrin α6high

cells showed much higher proliferation in mice than α6low cells. Perhaps due to

the dilution of increased α6low cells after 4-week growth in mice, the total content

of integrin α6 in the tumor tissues was reduced (Fig. 5B). Although cancer stem

cells are believed to have stem cell characteristics (18), such as tumor initiation,

proliferation (19) and self-renewal (20), which may lead to metastasis and

relapse after therapy (21), it is still lacks of gold standard definition of cancer

stem cells in all types of cancers. Our results highlight the involvement of integrin

α6 in the self-renewal capacity, colony formation ability, and tumor initiation in

vivo of liposarcoma cells. All these results revealed the tumor initiation function of

integrin α6high sub group cells, at least in human liposarcoma.





20

It should be noted that in some experiments mentioned above, we did not

observe the complete blockade of tumor proliferation or growth by silencing

integrin α6 or using its specific monoclonal antibody. This could be partially

explained by incomplete silence due to technique restriction. We can also

assume that it might be due to another factor involved in integrin α6-mediated

tumor initiation upon these data. As the evidence for this, Fig. 6B and C showed

that integrin α6 co-highly expressed with CD13, which shows a variety of

functions of one member of this family, aminopeptidase N (22).

CD13 has been proved to be a transcript target of Ras signaling pathways (23),

playing an important role in tumor progression in ovarian carcinoma cells (24). It

was also reported that CD13 could block the apoptosis induction by tumor

necrosis factor-alpha (25), and enhance sensitivity of tumor cells to cisplatin (26).

CD13 was also proved to be involved in cell adhesion (27) as well as in

endothelial invasion (28). Recent study made by Haraguchi et al. proved that

CD13 may be a therapeutic target in human liver cancer stem cells and inhibition

of CD13 by monoclonal antibody could induce cell apoptosis (29). In the present

study, knocking down of CD13 with its specific siRNA induced apoptosis in

SW872-S cells (Fig. 6E), and small molecule inhibitor of CD13 such as bestatin

showed higher inhibition rate on SW872-S-integrin α6high cells (Fig. 6F). All these

results suggest that CD13 may be an essential co-operator in integrin α6high sub-

group of cells, which defends cells from apoptosis induction. In order to confirm

the implication of these two proteins simultaneously appeared in the cells, we





21

measured the co-expression of both proteins in 23 other human cancer cell lines.

As the result, we found that 61% (14 in 23) of them contained CD13 and integrin

α6 double-positive sub-group cells (Supplementary Fig. 1). Knocking down of

CD13 induced apoptosis in A375, A549 and Bel-7402 cells with CD13 and

integrin α6 co-high expression (Supplementary Fig. 3). These results indicate a

possibility that both integrin α6 and CD13 may serve as functional markers of not

only liposarcoma but also various human cancers and sarcomas, which may be

new therapeutic targets for the clinical cancer treatment.





22

Acknowledgements:

We want to sincerely consecrate this paper to Prof. Ting Chen who had been our

colleague and had struggled with retroperitoneum liposarcoma for 15 years, and

who is also the donor of some of the samples used in this study.





23

References

1. Mack T. Sarcomas and Other Malignancies of Soft-Tissue,

Retroperitoneum, Peritoneum, Pleura, Heart, Mediastinum, and Spleen. Cancer.

1995;75:211-44.

2. Amato G, Martella A, Ferraraccio F, Di Martino N, Maffettone V, Landolfi V,

et al. Well differentiated "lipoma-like" liposarcoma of the sigmoid mesocolon and

multiple lipomatosis of the rectosigmoid colon. Report of a case. Hepato-

Gastroenterology. 1998;45:2151-6.

3. Singer S, Socci N, Ambrosini G, Sambol E, Decarolis P, Wu Y, et al. Gene

expression profiling of liposarcoma identifies distinct biological types/subtypes

and potential therapeutic targets in well-differentiated and dedifferentiated

liposarcoma. Cancer Research. 2007;67:6626-36.

4. Gilbertson RJ, Rich JN. Making a tumour's bed: glioblastoma stem cells

and the vascular niche. Nature Reviews Cancer. 2007;7:733-6.

5. Roomi M, Ivanov V, Kalinovsky T, Niedzwiecki A, Rath M. Inhibition of cell

invasion and MMP production by a nutrient mixture in malignant liposarcoma cell

line SW-872. Medical Oncology. 2007;24:394-401.

6. Hynes R. Integrins: Bidirectional, allosteric signaling machines. Cell.

2002;110:673-87.

7. Takeyama H, Funahashi H, Sawai H, Takahashi H, Yamamoto M, Akamo

Y, et al. Expression of alpha(6) integrin subunit is associated with malignancy in

gastric gastrointestinal stromal tumors. Med Sci Monitor. 2007;13:CR51-CR6.





24

8. Evsikov A, Solter D. Comment on " 'Stemness': Transcriptional profiling of

embryonic and adult stem cells" and "A stem cell molecular signature" (II).

Science. 2003;302.

9. Wewer U, Shaw L, Albrechtsen R, Mercurio A. The integrin alpha 6 beta 1

promotes the survival of metastatic human breast carcinoma cells in mice.

American Journal of Pathology. 1997;151:1191-8.

10. Barclay W, Axanova L, Chen W, Romero L, Maund SL, Soker S, et al.

Characterization of adult prostatic progenitor/stem cells exhibiting self-renewal

and multilineage differentiation. Stem Cells. 2008;26:600-10.

11. Lathia J, Gallagher J, Heddleston J, Wang J, Eyler C, MacSwords J, et al.

Integrin Alpha 6 Regulates Glioblastoma Stem Cells. Cell Stem Cell. 2010;6:421-

32.

12. Katz AJ, Tholpady A, Tholpady SS, Shang HL, Ogle RC. Cell surface and

transcriptional characterization of human adipose-derived adherent stromal

(hADAS) cells. Stem Cells. 2005;23:412-23.

13. Wang L, Shen Y, Song R, Sun Y, Xu J, Xu Q. An Anticancer Effect of

Curcumin Mediated by Down-Regulating Phosphatase of Regenerating Liver-3

Expression on Highly Metastatic Melanoma Cells. Molecular Pharmacology.

2009;76:1238-45.

14. Chang H, Hajdu SI, Collin C, Brennan M. The Prognostic Value of

Histologic Subtypes in Primary Extremity Liposarcoma. Cancer. 1989;64:1514-20.





25

15. Guo Y, Me J, Rubin E, Tang Y, Lin F, Zi X, et al. Frzb, a secreted wnt

antagonist, decreases growth and invasiveness of fibrosarcoma cells associated

with inhibition of met signalling. Cancer Research. 2008;68:3350-60.

16. Lipscomb E, Simpson K, Lyle S, Ring J, Dugan A, Mercurio A. The alpha

6 beta 4 integrin promotes tumor formation by regulated cell survival. Molecular

Biology of the Cell. 2004;15:342.

17. Kim D, Cho H, Choi H, Kwon S, Park K. Isolation of human epidermal

stem cells by adherence and the reconstruction of skin equivalents. Cellular and

Molecular Life Sciences. 2004;61:2774-81.

18. Alison, R M. Stem cells and cancer in the aerodigestive tract. Eur J

Cancer. 2009;45 Suppl 1:175-85.

19. Dean M, Fojo T, Bates S. Tumour stem cells and drug resistance. Nature

Reviews Cancer. 2005;5:275-84.

20. Schatton T, Murphy G, Frank NY, Yamaura K, Waaga-Gasser A, Gasser

M, et al. Identification of cells initiating human melanomas. Nature.

2008;451:345-U11.

21. Reya T, Morrison S, Clarke M, Weissman I. Stem cells, cancer, and

cancer stem cells. Nature. 2001;414:105-11.

22. Mina-Osorio P. The moonlighting enzyme CD13: old and new functions to

target. Trends in Molecular Medicine. 2008;14:361-71.

23. Bhagwat S, Petrovic N, Okamoto Y, Shapiro L. The angiogenic regulator

CD13/APN is a transcriptional target of Ras signaling pathways in endothelial

morphogenesis. Blood. 2003;101:1818-26.





26

24. Terauchi M, Kajiyama H, Shibata K, Ino K, Nawa A, Mizutani S, et al.

Inhibition of APN/CD13 leads to suppressed progressive potential in ovarian

carcinoma cells. Bmc Cancer. 2007;7.

25. Cowburn A, Sobolewski A, Reedo B, Deighton J, Murray J, Cadwallader K,

et al. Aminopeptidase N (CD13) regulates tumor necrosis factor-alpha-induced

apoptosis in human neutrophils. Journal of Biological Chemistry.

2006;281:12458-67.

26. van Hensbergen Y, Broxterman H, Rana S, van Diest P, Duyndam M,

Hoekman K, et al. Reduced growth, increased vascular area, and reduced

response to cisplatin in CD13-overexpressing human ovarian cancer xenografts.

Clinical Cancer Research. 2004;10:1180-91.

27. Mina-Osorio P, Shapiro L, Ortega E. CD13 in cell adhesion:

aminopeptidase N (CD13) mediates homotypic aggregation of monocytic cells.

Journal of Leukocyte Biology. 2006;79:719-30.

28. Petrovic N, Schacke W, Gahagan J, O'Conor C, Winnicka B, Conway R,

et al. CD13/APN regulates endothelial invasion and filopodia fonnation. Blood.

2007;110:142-50.

29. Haraguchi N, Ishii H, Mimori K, Tanaka F, Ohkuma M, Kim H, et al. CD13

is a therapeutic target in human liver cancer stem cells. Journal of Clinical

Investigation. 2010;120:3326-39.





27

Figure Legends

Figure 1

Establishment and characterization of a new sub-cell line derived from

human liposarcoma cells SW872 with much stronger tumor-initiating

potential in vivo.

A. 3×106 of SW872 and SW872-S cells were injected into the right flank of nude

mice. Seven weeks later, the growth of tumor formed in mice. Data are mean ±

SD. of five nude mice in each group. B. Tumor sample sections from each group

were stained with H&E. C. 200 of SW872 and SW872-S cells were seeded in soft

agar as described in Materials and Methods. Two weeks later, the clones formed

were counted (lower panel), and the representative picture of clones were shown

(upper panel). Data are mean ± SD of three independent experiments. * p < 0.05,

** p < 0.01 vs the colony number of SW872 cells.

D. SW872 and SW872-S cells were diluted from 106 to 103, and injected into the

right flank of nude mice and allowed to grow for 2 months, the tumor formation

rate were presented.

Figure 2

Increased adhesion to laminin and elevated expression of integrin α6 in

SW872-S cells.

A. The adhesion of SW872 and SW872-S cells ability to fibronectin, laminin and

collagen type I were measured, respectively. B. The surface expressions of





28

laminin-specific integrins of SW872 and SW872-S cells were measured by FACS

more than 3 times, and representative result was presented. C. The mRNA levels

of the integrin α family members between SW872 and SW872-S cells were

qualified by real-time PCR. β-actin was used as invariant control. D. SW872-S

cells were incubated with various amounts of integrin α6 monoclonal antibody for

30 min, and the adhesion ability to laminin, fibronectin and collagen was

measured. Data are mean ± SD of three independent experiments. * p < 0.05, **

p < 0.01 vs control.

Figure 3

Identification of integrin α6high cells in liposarcoma cells’ growth in vitro

and in vivo.

A. The proliferation of SW872 and SW872-S cells was determined by MTT assay.

B. The proliferation of integrin α6high and integrin α6low cells of SW872-S was

determined by MTT assay. C. SW872-S cells were transfected with various

amounts of integrin α6 smartpool siRNA or luciferase siRNA for 72 hours,

respectively. The surface expression of integrin α6 was measured by FACS (left

panel). The proliferation rate of cells transfected by integrin a6 siRNA or

luciferase siRNA was determined by MTT assay (right panel). D. 106 of SW872-S

cells pre-incubated with control antibody or integrin α6 specific blocking antibody

(clone: CoH3), were inoculated into the right flank of nude mice, respectively.

Time course of tumor growth (left panel), representative pictures (right panel)





29

were presented. Data are mean ± SD of three independent experiments. * p <

0.05, ** p < 0.01 vs control.

Figure 4

Integrin α6-positive cells in human tumor tissues with liposarcoma relapse.

Immunohistochemical staining assays was carried out for integrin α6 by using

human liposarcoma specimens. Paraffin section of human liposarcoma tissues

were collected from 30 patients who had undergone liposarcoma relapse within 2

years; 6 samples from patients underwent well-differentiated liposarcoma with

good prognosis; 3 samples of normal fat tissue. A. The representative pictures

respectively from dedifferentiated, pleomorphic, round cell, well differentiated

liposarcoma and normal fat tissue were shown. B. FACS analyze between

human normal adipose derived cells and human primary liposarcoma cells

isolated from tumor tissues with relapse.

Figure 5

Multiple tumor formation potential in integrin α6high cells with activated

FAK/Src/ERK signaling.

A. SW872-S cells were cultured in serum free medium for 24 and 48 hours.

Integrin α6 level was measured by FACS, the fold induction of integrin α6high sub-

group was shown. B. Single cell suspension of SW872-S cells were seeded at

the concentration of 1000/ml, the surface expression of integrin α6 was analyzed

by immunofluorescence (left panel). Integrin α6high and integrin α6low cells (106





30

cells/mouse) were s.c. inoculated into the flank of nude mice, respectively. Four

weeks later, the tumor xenografts were collected and Integrin α6 expression was

detected by real-time PCR (middle panel) and FACS (right panel) respectively,

for comparison with the tumor size. C. The colony formation ability of Integrin

α6high and integrin α6low cells divided from SW872-S was measured. D. Integrin

α6high and integrin α6low cells divided from SW872-S cells were diluted from

50000 to 500, respectively, and injected into the right flank of nude mice and

allowed to grow for 2 months. The tumor formation rate (upper panel),

representative pictures of tumor formed (lower panel) were presented. E. The

protein levels of total integrin α6, FAK, Src, ERK, Akt, Bcl-2 as well as

phosphorylated FAK, Src, ERK, Akt of SW872, SW872-S, integrin α6high, and

integrin α6low of SW872-S cells were determined by western blot.

Figure 6

Co-expression of aminopeptidase N (CD13) in integrin α6high cells and

increased sensitivity to CD13 inhibitor bestatin.

A. The mRNA levels of CD9, CD10, CD13, CD44, CD55, CD59, CD90, and

CD166 between SW872 and SW872-S cells. B. The mRNA levels of the above

markers between SW872-S-integrin α6high and SW872-S-integrin α6low cells. C.

Flow cytometric analysis for expressions of CD13 and integrin α6 in SW872 and

SW872-S cells (upper panel). The protein level of CD13 was also determined in

α6low and α6high cells (lower panel). D. SW872-S cells were sorted into four

groups: α6low CD13low, α6low CD13high, α6high CD13high, α6high CD13low, the protein





31

levels of phosphorylated Src, Src, and Bcl-2 were determined by western blot. E.

SW872-S cells were transfected with control siRNA and CD13 specific siRNA for

72 hours. The protein levels of CD13, cleaved PARP, and cleaved caspase 3

were determined by western blot (upper panel). SW872-S cells were incubated

with various amount of bestatin for 24 hours, the protein level of integrin α6,

cleaved PARP, Caspase9, cleaved Caspase3 were determined by western blot

(lower panel). F. The 72-hour inhibition rates of Bestatin on SW872-S-integrin

α6high and SW872-S-integrin α6low cells were determined by MTT assay. G. The

mice with tumor formed of SW872-S cells were treated with PBS or 20 mg/kg

bestatin daily. The tumor size was measured every week. Data are mean ± SEM

of five mice in each group. * p < 0.05, ** p < 0.01 vs control.




Published OnlineFirst October 6, 2011.Mol Cancer Ther Lu Wang, Lingxian Wang, Yanhong Gu, et al. tumorigenesis and relapse of human liposarcomaIntegrin a6high cell population functions as an initiator in

Updated version

10.1158/1535-7163.MCT-11-0487doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2011/10/03/1535-7163.MCT-11-0487.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/early/2011/10/06/1535-7163.MCT-11-0487To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-11-0487

http://mct.aacrjournals.org/content/suppl/2011/10/03/1535-7163.MCT-11-0487.DC1

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mct.aacrjournals.org/content/early/2011/10/06/1535-7163.MCT-11-0487


Integrin α high cell population functions as an initiator in...

Documents

Transcript of Integrin α high cell population functions as an initiator in...