Impact of NF-κB pathway on the intervertebral disc inflammation … · 2021. 2. 2. · ing...

RESEARCH Open Access

Impact of NF-κB pathway on theintervertebral disc inflammation anddegeneration induced by over‐mechanicalstretching stressHui Xu1†, Guobao Qi2†, Kunpeng Li1, Keshi Yang1, Dawei Luo1 and Zhongxu Cai2*

Abstract

Background: Intervertebral disk degeneration (IVDD) contributes to low back pain. Increased cell apoptosis andinflammation, decreased extracellular matrix are associated with IVDD. Nuclear factor-kappa B (NF-κB) signalingpathway and inflammatory cytokines are implicated in the pathophysiology of IVDD.

Methods: In present study, we established a mechanical stretching stress-stimulated nucleus pulposus (NP) cellmodel. We knocked down NF-κB p65 by siRNA transfection to inhibit NF-κB and evaluated the effects of NF-κBinhibition on intervertebral disk degeneration. We applied the mechanical stretching stress on NP cells andinhibited NF-κB by siRNA, then evaluated the expression of inflammatory cytokines, matrix metalloproteinase (MMP),aggrecan, collagen II, and monitored viability and apoptosis of NP cells.

Results: Mechanical stretching stress induced the expression of TNF-α, IL-1β, NF-κB, MMP-3 and MMP-13, whileinhibited the production of aggrecan and collagen II in NP cells. Mechanical stretching stress decreased the cellviability and induced apoptosis in NP cells. Inhibition of NF-κB by siRNA suppressed the production of TNF-α, IL-1β,NF-κB, MMP-3 and MMP-13, while upregulated the expression of aggrecan and collagen II in NP cells.Conclusions: Inhibition of NF-κB by knocking down p65 suppressed over-mechanical stretching stress-induced cellapoptosis and promoted viability in NP cell. Inhibition of NF-κB suppressed inflammation and degeneration of NPcells in IVDD.

Keywords: NF-κB, Intervertebral disc, Inflammation, Degeneration, Mechanical stretching stress

BackgroundIn western country, low back pain affects up to 50 % ofthe population and becomes one of the major healthproblems [1]. It is widely acknowledged that interverte-bral disk degeneration (IVDD) is the master factor impli-cated in low back pain [2].

The intervertebral disks (IVD), which are composed ofannulus fibrosus (AF), nucleus pulposus (NP) and cartil-aginous endplates, lie between vertebral bodies and linkthem together [3]. The IVDD is a complex process inwhich multiple factors, including increased inflamma-tion, excessive apoptosis, loss of extracellular matrix,and excessive mechanical stretch have been implicated[4]. The excessive mechanical strain could induce in-flammatory cytokines production in NP cells [5]. Tumornecrosis factor alpha (TNF-α) is a key contributor to theIVDD by promoting matrix metalloproteinase (MMP)

© The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License,which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you giveappropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate ifchanges were made. The images or other third party material in this article are included in the article's Creative Commonslicence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commonslicence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtainpermission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to thedata made available in this article, unless otherwise stated in a credit line to the data.

* Correspondence: [email protected]†Hui Xu and Guobao Qi are contributed equally to this work.2Department of Spinal Surgery, Dongying People’s Hospital, No. 317, NanyiRoad, 257091 Dongying, Shandong, ChinaFull list of author information is available at the end of the article

Xu et al. Journal of Inflammation (2021) 18:6 https://doi.org/10.1186/s12950-021-00273-9

http://crossmark.crossref.org/dialog/?doi=10.1186/s12950-021-00273-9&domain=pdfhttp://creativecommons.org/licenses/by/4.0/http://creativecommons.org/publicdomain/zero/1.0/mailto:[email protected]

expression and extra cellular matrix degradation, ampli-fying inflammation, inducing cell apoptosis, and decreas-ing collagen II and aggrecan expression [6–9].Interleukin 1 beta (IL-1β) has similar functions to TNF-α in IVDD [10]. TNF-α and IL-1β are mainly producedand secreted by immune cells, but they are also secretedby IVD cells [11]. The expression of TNF-α and IL-1βare remarkably increased in degenerated IVDs and theexpression level is positively correlated with disc degen-eration degree [11]. Anti-TNF-α and IL-1β therapieshave been shown to alleviate disc degeneration.Nuclear factor-kappa B (NF-κB) is transcriptional fac-

tor with multiple functions. NF-κB family comprises fivemembers including p50, p52, p65 (Rel-A), c-Rel, andRel-B proteins which form homo- or heterodimers forfunction. The most abundant form of NF-κB activatedby pathologic stimuli via the canonical pathway is thep65:p50 heterodimer [12]. NF-κB has been shown to becritical in inflammation. Under unstimulated stage, NF-κB is inactive and present in cell cytosol. When stimu-lated by various stimuli including pathogen-associatedmolecular patterns (PAMPs), IL-1β, and TNF-α, NF-κBis translocated into host cell nucleus and activate genetranscription, which exacerbate the inflammation [13].Mechanical stress can activate NF-κB signaling pathwayand induce expression of TNF-α and IL-1β [14]. The sig-nificantly increased NF-κB activation is also identified indegenerated IVD tissues. Interestingly, inhibition ofTNF-α, IL-1β or NF-κB by specific inhibitors or antago-nists has been shown to ameliorate IVDD, suggestingthese three factors are potential therapeutic target totreat IVDD [15–17]. SiRNA targeting NF-κB p65 hasbeen shown to interfere the NF-κB signaling pathwayand inhibit inflammation [18, 19]. In present study,using a mechanical stress-stimulated NP cell model, weinhibited NF-κB by siRNA treatment in NP cells and in-vestigate the effects on IVDD.

Materials and methodsNucleus Pulposus (NP) cell cultureNP cells were isolated from adult Sprague-Dwaley ratsas described previously [20]. Briefly, the lumbar interver-tebral discs were separated from the rats. Under a dis-secting microscope, the gel-like nucleus pulposus wereisolated and digested by 0.1 % collagenase II at 37°C for6 h. The digested tissues were then transferred toDMEM/F12 medium containing 10 % fetal bovine serumand antibiotics (Thermo Fisher, Waltham, MA, USA).The cells were incubated at 37°C with 5 % CO2. Mediumwas changed every other day. The NP cells were har-vested when was confluent.The mechanical stretching stress was applied to the

cells by using a four-point bending system (Mirui Tech-nology Ltd, Chengdu, Sichuan, China) at the frequency

of 1 Hz and different applied values (0, 1000 μ, 2000 μ,4000 μ and 6000 μ) for 12 or 24 h. The general range ofloading is from 100 to 6000 µ.

Cell‐counting kit 8 (CCK-8) assayNP cells were seeded in BioFlex® Culture Plates. Afterapplying the stretching stress, the CCK-8 reagent(Abcam, Shanghai, China) for 3 h and the absorbancewas read at 460 nm.

Apoptosis assayFITC Annexin V Apoptosis Detection Kit with PI kit(Biolegend, Beijing, China) was used to measure theapoptosis using flow cytometry. Briefly, NP cells wereharvested and wash with FACS buffer (2 % fetal bovineserum in phosphate-buffered saline (PBS)). Cells werestained with the staining solution for 15 min at roomtemperature. After incubated with Annexin V bindingbuffer, cells were subjected to flow cytometry by usingBD FACSCalibur Flow Cytometer.

ELISACell culture supernatants were collected after treatment.TNF-α and IL-1β were measured using commercialELISA kits (Abcam, China) following manufacturer’sprotocols.

Western blotRadioimmunoprecipitation lysis buffer (Abcam, China)was used for protein extraction. Extracted proteins wereloaded on sodium dodecyl sulfate–polyacrylamide gelelectrophoresis gel and then transferred to polyvinyli-dene fluoride membrane. After blocked with 5 % non-fatmilk in PBST for 1 h at room temperature, membraneswere incubated with primary antibodies for overnight at4°C. Next day, after 3 times wash with PBST, corre-sponding secondary antibodies were incubated. The ECLWestern Blotting Substrate (Abcam, China) was addedto detect the reactive bands. The bands intensity wasquantitated and analyzed by using ImageJ. The followingprimary antibodies were used: anti-NF-κB p65 (Abcam,China), anti-Bax (Abcam, China), anti-Bcl-2 (Abcam,China), anti-IL-1β (Abcam, China), anti-IL-6 (Abcam,China), anti-GAPDH (Abcam, China).

RT-PCRTotal RNA was extracted using RNeasy Mini Kit (Qia-gen China, Shanghai, China). The cDNA was synthesizedand subjected to Real-time PCR by using QuantStudio 3(Thermo Fisher, USA) and TB Green® Advantage® qPCRPremix (Takara, China). Primers used for RT-PCR were:p65 Forward: 5’-GAGACCTGGAGCAAGCCATT − 3’,Reverse: 5’-GCCTGGTCCCGTGAAATACA-3’. MMP-3Forward: 5’- TTGATGGG CCT GGAATGGTC-3’,

Xu et al. Journal of Inflammation (2021) 18:6 Page 2 of 8

Reverse: 5’- AACAAGACTTCTCCCCGCAG − 3’.MMP-13 Forward: 5’-AAGCACCCCAAAACACCAGA-3’, Reverse: 5’-ACATGAGGTCTCGGGATGGA-3’.Aggrecan Forward: 5’-TCACCACCCACTCCGAAGAAGTTT-3’, Reverse: 5’-TCACCACCCA CTCCGAAGAAGTTT-3’. Collagen II Forward: 5’-CTCCATGTTGCAGAAGACTTTCA-3’, Reverse: 5’-TTCATGCATCCGCTAGTCCCTTCT-3’. TNF-α Forward: 5’-CCCTGGTACT AACTCCCAGAAA-3’, Reverse: 5’-TGTATGAGAGGGACGGAACC-3’. IL-1β Forward: 5’-C CAGGATGAGGACCCAAGCA − 3’, Reverse: 5’-TCCCGACCATTGCTGTTTCC-3’. β-actin Forward: 5’-CGTGCGTGACATCAAAGAGAAG-3’, Reverse 5’-CGTTGCCAATAGTGATGA CCTG-3’.

SiRNA and transfectionThe siRNA duplexes were designed by using StealthRNAi Pre-Designed siRNAs online software (http://www.thermofisher.com/cn/zh/home/life-science/rnai/synthetic-rnai-analysis/stealth-select-rnai.html) and syn-thesized by GenePharma (GenePharma Co., Suzhou,China). The p65 siRNA duplexes sequences were: Sense5’- GCAUGCGAUUCCGCUAUAAT T-3’, Antisense 5’-UUAUAGCGGAAUCGCAUGCTT − 3’. The controlsiRNA sequence were : Sense 5’- UUCUCCGAACGUGUCACGUTT-3’,Antisense 5’-ACGUGACACGUUCG GAGAATT-3’. Lipofectamine RNAiMAX(Thermo Fisher, USA) was used to transfect siRNA toNP cells following manufacturer’s instructions.

Immunofluorescence assayCells were fixed with 4 % paraformaldehyde in PBS andpermeabilized with 0.1 % Triton-X100. After blocking,anti-p65 antibody was added and incubated for 1 h at37°C. After wash, cells were incubated with Alexa Fluor488 conjugated secondary antibody and DAPI, and thenmounted with ProLong™ Gold Antifade Mountant(Thermo Fisher, USA). Images were taken by NikonECLIPSE 80 i microscope.

Statistical analysisExperiments were independently repeated in triplicate.One- or two-way ANOVA analysis followed with an ap-propriate post hoc test was used to determine statisticaldifference. Statistical difference was considered as sig-nificant when p < 0.05.

ResultsMechanical stretching stress induced inflammation anddegeneration in rat nucleus pulposus cellsTo evaluate the effects of mechanical stretching stresson NP cells, we stretched NP cells with different values(0-6000µ) for 12 or 24 h, and monitored the cell viabil-ity, the production of TNF-α, an inflammatory cytokine

associated with intervertebral disc degeneration, the ex-pression of NP cells marker aggrecan and disc degenera-tive marker MMP-3. As shown in Fig. 1a and 1000 µstretching for 12 or 24 h significantly increased the via-bility of NP cell. Increased stretching intensity resultedin decreased cell viability as 2000, 4000 and 6000 µstretching for 12 or 24 h significantly reduced cell viabil-ity when compared to no stretching. 1000 µ stretchingdid not induced NP cells to produce TNF-α (Fig. 1b). Incontrast, 2000, 4000 and 6000 µ stretching for 12 or24 h resulted in significantly increased production ofTNF-α in an intense-dependent manner. The highestvalue stretching (6000 µ) resulted in highest productionof TNF-α. 1000 µ stretching significantly increased themRNA level of aggrecan while intensified stretching re-sulted in significantly decreased mRNA level of aggrecan(Fig. 1c), which was in an intense-dependent manner.1000 µ stretching did not affect mRNA level of MMP-3while 2000, 4000 and 6000 µ stretching significantly in-creased the mRNA level of MMP-3 in an intense-dependent manner (Fig. 1d). Taken together, our datademonstrated that mechanical stretching decreased NPcell viability and expression of aggrecan while increasedthe expression of TNF-α and MMP-3, two factors asso-ciated with intervertebral disc degeneration. These re-sults indicated that mechanical stretching stress inducedinflammation and degeneration in NP cells. As 4000 µstretching for 24 h gave the satisfied result, we adoptedthis condition for other studies.

SiRNA treatment prevented mechanical stretching stressinduced NF-κB p65 expressionNF-κB signaling pathway can be activated by mechanicalstress and played essential role in intervertebral disc de-generation [14, 21]. We transfected NP cells with NF-κBp65 siRNA and evaluated the effects on p65 expressionafter mechanical stretching stress stimulation. As shownin Fig. 2a&b, mechanical stretching stress significantlyenhanced the expression of p65 in NP cells. Transfectionof control siRNA to NP cells (si-NC group) did notaffect the stretching stress-induced p65 expression. Incontrast, transfection of siRNA against p65 significantlydecreased the p65 level in NP cells after stretching stressstimulation. Similarly, transfection of p65 siRNA signifi-cantly reduced mRNA expression of p65 (Fig. 2d). More-over, stretching stress stimulation induced NF-κBnuclear translocation. In contrast, in p65 siRNA trans-fected NP cells, there was no obvious nuclear transloca-tion of p65 detected after stretching stress stimulation(Fig. 2c). Collectively, our data demonstrated that trans-fection of p65 siRNA knocked down endogenous p65protein level and prevented mechanical stretching stressinduced NF-κB p65 expression.


http://www.thermofisher.com/cn/zh/home/life-science/rnai/synthetic-rnai-analysis/stealth-select-rnai.htmlhttp://www.thermofisher.com/cn/zh/home/life-science/rnai/synthetic-rnai-analysis/stealth-select-rnai.htmlhttp://www.thermofisher.com/cn/zh/home/life-science/rnai/synthetic-rnai-analysis/stealth-select-rnai.html

Fig. 1 Mechanical stretching stress induced intervertebral disc inflammation and degeneration in rat nucleus pulposus cells. The cells in differentgroups were stretched mechanically by 1000µ, 2000µ, 4000µ and 6000µ respectively for 12 h and 24 h. CCK-8 was used to measure the cellviability (a), ELISA was used to measure the level of TNF-α (b), Real-time PCR was used to measure the mRNA expressions of Aggrecan (c) andMMP-3. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001 compared to control

Fig. 2 Effects of NF-κB inhibition on over-mechanical stretching stress-induced p65 expression in rat nucleus pulposus cells. a Western blotanalysis for the protein expression of p65, GAPDH was used as loading control. The relative expressions were normalized to control (b). c Thenuclear translocation of p65 was measured by Fluorescence immunocytochemistry. d Real-time PCR was used to measure the mRNA expressionsof p65. Data are presented as mean ± SD. ***p < 0.001 between the indicated groups


Inhibition of NF-κB prevented mechanical stretchingstress‐induced apoptosis of rat nucleus pulposus cellsWe continued to evaluate the effects of NF-κB inhibitionon stretching stress-induced cell death. Stretching stressstimulation significantly decreased cell viability in NPcells (Fig. 3a). In contrast, transfection of p65 siRNA sig-nificantly enhanced the cell viability in stretching stress-stimulated NP cells. The decreased cell viability afterstretching stress stimulation was correlated to the en-hanced apoptosis of NP cells (Fig. 3b&c). Knockingdown p65 significantly reduced the stretching stress-induced apoptosis of NP cells (Fig. 3b&c). Correspond-ingly, stretching stress stimulation remarkably increasedthe Bax expression and decreased Bcl-2 expression(Fig. 3d&e). Knocking down p65 suppressed the expres-sion of Bax while rescued Bcl-2 expression in stretchingstress-stimulated NP cells. After quantitation, stretchingstress significantly increased Bax/Bcl-2 ratio while

knocking down p65 by siRNA transfection significantlydecreased the Bax/Bcl-2 ratio in stretching stress-stimulated NP cells. Together, our data demonstratedthat inhibition of NF-κB prevented stretching stress-induced apoptosis in NP cells.

Inhibition of NF-κB ameliorated mechanical stretchingstress‐induced intervertebral disc degeneration in NPcellsNext, we investigated the effects of NF-κB inhibition onintervertebral disc degeneration by monitoring the ex-pression of cell markers. Mechanical stretching stresssignificantly promoted the mRNA level of MMP-3(Fig. 4a) and MMP-13 (Fig. 4b), two disc degenerationmarker. In contrast, mechanical stretching stress signifi-cantly decreased the mRNA level of aggrecan (Fig. 4c)and collagen II (Fig. 4d). Transfection of p65 siRNA sig-nificantly decreased MMP-3 and MMP-13 mRNA levelwhile rescued the mRNA expression of aggrecan and

Fig. 3 Effects of NF-κB inhibition on over-mechanical stretching stress induced apoptosis of rat nucleus pulposus cells. CCK-8 was used tomeasure the cell viability (a). Apoptotic cells were stained with Annexin V-PE and PI, and analyzed by flow cytometry (b and c). d Western blotanalysis for the protein expression of Bax and Bcl-2. GAPDH was used as loading control. The relative expressions of Bax/Bco-2 were calculated(e). Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001 between the indicated groups


Fig. 4 Effects of NF-κB inhibition on over-mechanical stretching stress induced intervertebral disc degeneration in rat nucleus pulposus cells. Real-time PCR was used to measure the mRNA expressions of MMP-3 (a), MMP-13 (b), Aggrecan (c) and Collagen II (d). Data are presented as mean ±SD. *p < 0.05, **p < 0.01, ***p < 0.001 between the indicated groups

Fig. 5 Effects of NF-κB inhibition on over-mechanical stretching stress induced inflammation in rat nucleus pulposus cells. ELISA was used tomeasure the levels of TNF-α (a) and IL-1β (b). Real-time PCR was used to measure the mRNA expressions of TNF-α (c) and IL-1β (d). e Westernblot analysis for the protein expression of TNF-α and IL-1β. GAPDH was used as loading control. The relative expressions were normalized tocontrol (f). Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001 between the indicated groups


collagen II in mechanical stretching stress-stimulatedNP cells. Collectively, our data demonstrated that inhib-ition of NF-κB p65 ameliorated mechanical stretchingstress-induced degeneration in NP cells.

Inhibition of NF-κB prevented mechanical stretchingstress‐induced inflammation in NP cellsLastly, we detected the effects of NF-κB inhibition on in-flammatory cytokine production after mechanicalstretching stress stimulation. We detected significantlyincreased TNF-α (Fig. 5a) and IL-1β (Fig. 5b) in NP cellculture supernatant after mechanical stretching stressstimulation. Inhibition of NF-κB by transfection of p65siRNA significantly reduced both TNF-α and IL-1β pro-duction in mechanical stretching stress-stimulated NPcells. Correspondingly, we detected significantly in-creased mRNA level of TNF-α (Fig. 5c) and IL-1β(Fig. 5d) in mechanical stretching stress-stimulated NPcells while knocking down NF-κB p65 significantly de-creased mRNA level of TNF-α (Fig. 5c&d) and IL-1β(Fig. 5d&f) in mechanical stretching stress-stimulatedNP cells. Consistently, we detected remarkably increasedTNF-α and IL-1β proteins in mechanical stretchingstress-stimulated NP cells while knocking down NF-κBp65 decreased the protein level of TNF-α and IL-1β(Fig. 5d, e).

DiscussionIn present study, we found that mechanical stretchingstress stimulation induced the inflammation and degen-eration in NP cells, and these effects was reversed byinhibiting NF-κB through knocking down p65 by siRNAtransfection. We demonstrated that mechanical stretch-ing stress reduced the cell viability and promoted apop-tosis of NP cells, promoted NF-κB, TNF-α, IL-1β,MMP-3 and MMP13 expression, and inhibited aggrecanand collagen II expression. Inhibition of NF-κB p65 bysiRNA transfection inhibited NP cells apoptosis and in-creased cell viability. In addition, inhibition of NF-κBprevented mechanical stretching stress-induced expres-sion of NF-κB, TNF-α, IL-1β, MMP-3 and MMP13,while promoted aggrecan and collagen II expression.These results strongly indicated that NF-κB played es-sential role in IVDD and targeting NF-κB could be usedto treat IVDD.IVDD is characterized with loss of disc extracellular

matrix. The MMPs, the enzymes contributing to in-creased matrix degradation, are up-regulated in IVDD,[22]. Activation of NF-κB induced the expression ofMMP-3, MMP-9, MMP-13 in NP cells [17]. MMP-3 andMMP-13 were the main collagenases to degrade type IIcollagen in NP. In present study, we demonstrated that

mechanical stretching stress induced the expression ofNF-κB, MMP-3 and MMP-9 while inhibiting NF-κB byknocking down p65 prevented the mechanical stretchingstress-induced up-regulation of MMP-3 and MMP-9 inNP cells. Our findings were consistent to previous studyin which NF-κB inhibitors were used [17, 23].High levels of IL-1β and TNF-α are associated with

IVDD [24]. IL-1β is one of the predominant cytokineswhich are highly expressed in degenerative IVD tissuesand cells. IL-1β has been shown to be involved in in-flammation, apoptosis, ECM degradation and oxidativestress in NP cells [25]. IL-1β promoted NF-κB activation,resulting in increased protein expression of MMP-3,MMP-9 in NP cells, and decreased the expression ofaggrecan and collagen II [17]. Recently, emerging evi-dence proved that TNF-α can also induce MMP3,MMP-13 expression, resulting in significantly decreasedexpression of aggrecan and collagen II [6]. It was de-scribed that TNF-α and IL-1β-induced expression ofMMPs was mediated by NF-κB signaling pathway [26]and NF-κB inhibitors suppressed upregulation of MMPsby TNF-α and IL-1β [27]. Here we also described thatinhibition of NF-κB by knocking down p65 could pre-vent mechanical stretching stress-induced MMP3 andMMP-13 expression, suggesting targeting NF-κB couldbe a useful strategy to treat IVDD.Mechanical loading was shown to cause apoptosis in

IVD [28]. The loss of NP cells played critical role in theprocess of IVDD [29]. Increasing evidences demon-strated that TNF-α was involved in IVD cell apoptosis.Dai and colleagues reported that TNF-α treatment sig-nificantly enhanced the apoptotic rate through promot-ing p53 and caspase 3 expression in NP cells [7]. IL-1βwas also shown to induce apoptosis of NP cells [30]. It isdescribed that NF-κB plays important role in apoptosisduring IVDD and inhibition of NF-κB block TNF-α andIL-1β-induced apoptosis in NP cells [31]. In presentstudy, inhibition of NF-κB by siRNA significantly re-duced the NP cells apoptosis after mechanical stretchingstress stimulation, strongly suggesting inhibition of NF-κB could be used as a potential therapeutic strategy totreat IVDD.

ConclusionsIn summary, our data demonstrated that knocking downNF-κB by transfecting p65 siRNA in NP cells inhibitedthe inflammation and degeneration in NP cells aftermechanical stretching stress stimulation.

AcknowledgementsNone.

Authors’ contributionsHui Xu, Guobao Qi, Kunpeng Li, Keshi Yang, Dawei Luo, Zhongxu Caiconducted the experiments and analyzed the data. Hui Xu and Zhongxu Caiconceived the study. Zhongxu Cai coordinated and supervised the study.


Hui Xu, Guobao Qi, Kunpeng Li, Keshi Yang, Dawei Luo wrote themanuscript. Hui Xu, Guobao Qi, Kunpeng Li, Keshi Yang, Dawei Luo,Zhongxu Cai approved the publication of this paper, and are accountable forall aspects of the work and ensure the accuracy or integrity of any part ofthe work.

FundingThe study was supported by the Natural Science Foundation of ShandongProvince (ZR2017MH112).

Availability of data and materialsThe raw data supporting the conclusions of this article will be madeavailable by the authors, without undue reservation.

Ethics approval and consent to participateThe study was approved by the ethics commitment of Dongying People’sHospital.

Consent for publicationCurrent study is available from the corresponding author on reasonablerequest.

Competing interestsThe authors declare that they have no conflict of interest.

Author details1Department of Spinal Surgery, Liaocheng People’s Hospital, No. 67,Dongchang Xilu Road, 252000 Liaocheng, Shandong, China. 2Department ofSpinal Surgery, Dongying People’s Hospital, No. 317, Nanyi Road, 257091Dongying, Shandong, China.

Received: 30 June 2020 Accepted: 22 January 2021

References1. Juniper M, Le TK, Mladsi D. The epidemiology, economic burden, and

pharmacological treatment of chronic low back pain in France, Germany,Italy, Spain and the UK: a literature-based review. Expert OpinPharmacother. 2009;10:2581–92.

2. Luoma K, Riihimaki H, Luukkonen R, Raininko R, Viikari-Juntura E, LamminenA. Low back pain in relation to lumbar disc degeneration. Spine (Phila Pa1976). 2000;25:487–92.

3. Choi YS. Pathophysiology of degenerative disc disease. Asian Spine J. 2009;3:39–44.

4. Vergroesen PP, Kingma I, Emanuel KS, Hoogendoorn RJ, Welting TJ, vanRoyen BJ, van Dieen JH, Smit TH. Mechanics and biology in intervertebraldisc degeneration: a vicious circle. Osteoarthritis Cartilage. 2015;23:1057–70.

5. Gawri R, Rosenzweig DH, Krock E, Ouellet JA, Stone LS, Quinn TM, HaglundL. High mechanical strain of primary intervertebral disc cells promotessecretion of inflammatory factors associated with disc degeneration andpain. Arthritis Res Ther. 2014;16:R21.

6. Seguin CA, Pilliar RM, Roughley PJ, Kandel RA. Tumor necrosis factor-alphamodulates matrix production and catabolism in nucleus pulposus tissue.Spine (Phila Pa 1976). 2005;30:1940–8.

7. Dai L, Liu Z, Liang W, Yao Y, Xu J, Ye D, Zou L, Shen Y. [Effect of vitamin con apoptosis of nucleus pulposus cells induced by tumor necrosis factor aand serum deprivation]. Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi. 2015;29:490–7.

8. Moon HJ, Kim JH, Lee HS, Chotai S, Kang JD, Suh JK, Park YK. Annulusfibrosus cells interact with neuron-like cells to modulate production ofgrowth factors and cytokines in symptomatic disc degeneration. Spine(Phila Pa 1976). 2012;37:2–9.

9. Kim HJ, Yeom JS, Koh YG, Yeo JE, Kang KT, Kang YM, Chang BS, Lee CK.Anti-inflammatory effect of platelet-rich plasma on nucleus pulposus cellswith response of TNF-alpha and IL-1. J Orthop Res. 2014;32:551–6.

10. Johnson ZI, Schoepflin ZR, Choi H, Shapiro IM, Risbud MV. Disc in flames:Roles of TNF-alpha and IL-1beta in intervertebral disc degeneration. Eur CellMater. 2015;30:104–16. discussion 116 – 107.

11. Le Maitre CL, Hoyland JA, Freemont AJ. Catabolic cytokine expression indegenerate and herniated human intervertebral discs: IL-1beta andTNFalpha expression profile. Arthritis Res Ther. 2007;9:R77.

12. Giridharan S, Srinivasan M. Mechanisms of NF-κB p65 and strategies fortherapeutic manipulation. J Inflamm Res. 2018;11:407–19.

13. Baldwin AS, Jr. Series introduction: the transcription factor NF-kappaB andhuman disease. J Clin Invest. 2001;107:3–6.

14. Kumar A, Boriek AM. Mechanical stress activates the nuclear factor-kappaBpathway in skeletal muscle fibers: a possible role in Duchenne musculardystrophy. FASEB J. 2003;17:386–96.

15. Evashwick-Rogler TW, Lai A, Watanabe H, Salandra JM, Winkelstein BA, ChoSK, Hecht AC, Iatridis JC. Inhibiting tumor necrosis factor-alpha at time ofinduced intervertebral disc injury limits long-term pain and degeneration ina rat model. JOR Spine 2018, 1.

16. Le Maitre CL, Hoyland JA, Freemont AJ. Interleukin-1 receptor antagonistdelivered directly and by gene therapy inhibits matrix degradation in theintact degenerate human intervertebral disc: an in situ zymographic andgene therapy study. Arthritis Res Ther. 2007;9:R83.

17. Zhongyi S, Sai Z, Chao L, Jiwei T. Effects of nuclear factor kappa B signalingpathway in human intervertebral disc degeneration. Spine (Phila Pa 1976).2015;40:224–32.

18. Li N, Song Y, Zhao W, Han T, Lin S, Ramirez O, Liang L. Small interferingRNA targeting NF-κB attenuates lipopolysaccharide-induced acute lunginjury in rats. BMC Physiol. 2016;16:7.

19. Yan H, Duan X, Pan H, Holguin N, Rai MF, Akk A, Springer LE, Wickline SA,Sandell LJ, Pham CT. Suppression of NF-κB activity via nanoparticle-basedsiRNA delivery alters early cartilage responses to injury. Proc Natl Acad Sci US A. 2016;113:E6199–208.

20. Liu H, Pan H, Yang H, Wang J, Zhang K, Li X, Wang H, Ding W, Li B, ZhengZ. LIM mineralization protein-1 suppresses TNF-alpha induced intervertebraldisc degeneration by maintaining nucleus pulposus extracellular matrixproduction and inhibiting matrix metalloproteinases expression. J OrthopRes. 2015;33:294–303.

21. Wu X, Liu Y, Guo X, Zhou W, Wang L, Shi J, Tao Y, Zhu M, Geng D, Yang H,Mao H. Prolactin inhibits the progression of intervertebral disc degenerationthrough inactivation of the NF-kappaB pathway in rats. Cell Death Dis. 2018;9:98.

22. Cui Y, Yu J, Urban JP, Young DA. Differential gene expression profiling ofmetalloproteinases and their inhibitors: a comparison between bovineintervertebral disc nucleus pulposus cells and articular chondrocytes. Spine(Phila Pa 1976). 2010;35:1101–8.

23. Chou YC, Sheu JR, Chung CL, Chen CY, Lin FL, Hsu MJ, Kuo YH, Hsiao G.Nuclear-targeted inhibition of NF-kappaB on MMP-9 production by N-2-(4-bromophenyl) ethyl caffeamide in human monocytic cells. Chem BiolInteract. 2010;184:403–12.

24. Risbud MV, Shapiro IM. Role of cytokines in intervertebral disc degeneration:pain and disc content. Nat Rev Rheumatol. 2014;10:44–56.

25. Chen J, Xuan J, Gu YT, Shi KS, Xie JJ, Chen JX, Zheng ZM, Chen Y, Chen XB, WuYS, et al. Celastrol reduces IL-1beta induced matrix catabolism, oxidative stressand inflammation in human nucleus pulposus cells and attenuates ratintervertebral disc degeneration in vivo. Biomed Pharmacother. 2017;91:208–19.

26. Li J, Yuan W, Jiang S, Ye W, Yang H, Shapiro IM, Risbud MV. Prolyl-4-hydroxylase domain protein 2 controls NF-kappaB/p65 transactivation andenhances the catabolic effects of inflammatory cytokines on cells of thenucleus pulposus. J Biol Chem. 2015;290:7195–207.

27. Tisherman R, Coelho P, Phillibert D, Wang D, Dong Q, Vo N, Kang J, Sowa G.NF-kappaB Signaling Pathway in Controlling Intervertebral Disk Cell Responseto Inflammatory and Mechanical Stressors. Phys Ther. 2016;96:704–11.

28. Chan SC, Ferguson SJ, Gantenbein-Ritter B. The effects of dynamic loadingon the intervertebral disc. Eur Spine J. 2011;20:1796–812.

29. Gruber HE, Hanley EN Jr. Analysis of aging and degeneration of the humanintervertebral disc. Comparison of surgical specimens with normal controls.Spine (Phila Pa 1976). 1998;23:751–7.

30. Lu L, Hu J, Wu Q, An Y, Cui W, Wang J, Ye Z. Berberine prevents humannucleus pulposus cells from IL1betainduced extracellular matrix degradationand apoptosis by inhibiting the NFkappaB pathway. Int J Mol Med. 2019;43:1679–86.

31. Yi W, Wen Y, Tan F, Liu X, Lan H, Ye H, Liu B. Impact of NF-kappaB pathwayon the apoptosis-inflammation-autophagy crosstalk in human degenerativenucleus pulposus cells. Aging. 2019;11:7294–306.

Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations.


AbstractBackgroundMethodsResultsConclusions

BackgroundMaterials and methodsNucleus Pulposus (NP) cell cultureCell‐counting kit 8 (CCK-8) assayApoptosis assayELISAWestern blotRT-PCRSiRNA and transfectionImmunofluorescence assayStatistical analysis

ResultsMechanical stretching stress induced inflammation and degeneration in rat nucleus pulposus cellsSiRNA treatment prevented mechanical stretching stress induced NF-κB p65 expressionInhibition of NF-κB prevented mechanical stretching stress‐induced apoptosis of rat nucleus pulposus cellsInhibition of NF-κB ameliorated mechanical stretching stress‐induced intervertebral disc degeneration in NP cellsInhibition of NF-κB prevented mechanical stretching stress‐induced inflammation in NP cells

DiscussionConclusionsAcknowledgementsAuthors’ contributionsFundingAvailability of data and materialsEthics approval and consent to participateConsent for publicationCompeting interestsAuthor detailsReferencesPublisher’s Note

Impact of NF-κB pathway on the intervertebral disc inflammation … · 2021. 2. 2. · ing...

Documents

Transcript of Impact of NF-κB pathway on the intervertebral disc inflammation … · 2021. 2. 2. · ing...