II. MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/26651/8/08_chapter...

II. MATERIALS AND METHODS

Materials and Methods

57

2.1. MATERIALS

The sources of the materials used in this investigation are listed below:

Table 2.1. Materials and their sources

S. No. Products Sources

1.

Ammonium persulphate, acrylamide, asparagine, birchwood xylan, β-mercaptoethanol, bis acrylamide, bovine serum albumin, cetyl trimethyl ammonium bromide, cholic acid, , DEAE sepharose, dialysis bags, Guanidine-HCl, glucose, glycine, KI, N'.N'.N'.N'. tetramethyl ethylenediamine, N-acetylglucosamine, N-bromosuccinimide, potato starch, N-ethylmaleimide, protein molecular weight markers (native/SDS), phenyl sepharose matrix, sodium dodecylsulphate, Tweens (20-80) and urea

Sigma, USA

2. 2,2-Bipyridine, ammonium ferric sulphate, bromocresol green, bromophenol blue, malachite green, riboflavin, sodium sulphite and thiamine

CDH, India

3. Ampholytes and pI markers

Bio-Rad, USA

4. 2,3-Butanedione

Hi-media, India

5. Ammonium chloride, ammonium nitrate, ammonium sulphate, bactopeptone, carboxymethyl cellulose, citric acid, cobalt chloride, copper chloride, diammonium hydrogen orthophosphate, ethanol, ethylenediaminetetra acetic acid disodium salt, formaldehyde, glycerol, hydrochloric acid, hydrogen peroxide, Iodoacetamide, lactose, manganese chloride, peptone, perchloric acid, phenol, sodium chloride, sodium citrate, sodium thiosulphate, soluble starch, sucrose, trehalose, Triton X-100, Tween-80 and zinc chloride

Merck, India

6. Acetic acid, acetone, agar agar, aluminium sulphate, ammonium molybdate, barium chloride, beef extract, benzene, boric acid, butanol, calcium chloride, citric acid, cobalt chloride, copper sulphate, di potassium hydrogen phosphate, disodium hydrogen phosphate, ferric chloride, ferrous chloride, formic acid, fructose, galactose, gallic acid, glacial acetic acid, glucose, glycine, hydrochloric acid, iodine, isoamyl alcohol,

Qualigens (India)


58

lactic acid, lactose, magnesium chloride, magnesium sulphate, manganese sulphate, n-hexane, oxalic acid, p-di methyl aminobenzaldehyde, peptone, periodic acid, phenol, potassium chloride, potassium dichromate, potassium dihydrogen phosphate, potassium iodide, potassium nitrate, silver chloride, silver nitrate, sodium acetate, sodium azide, sodium bicarbonate, sodium carbonate, sodium citrate, sodium hydrogen phosphate, sodium hydroxide, sodium molybdate, sodium molybdate, sodium nitrate, sodium potassium tartarate, sucrose, sulphuric acid, toluene, tryptone, urea, yeast extract and zinc sulphate

7. Acetone, acetyl-methylcarbinol, anthrone, biotin, calcium pantothenate, casein, copper sulphate, cyanocobalamine, dithiothreitol, dinitro salicylic acid (DNSA), folic acid, Folin-Ciocalteu's reagent, glucose-6-phosphate, Iodoacetate, isoamyl alcohol, malic acid, methanol, pepsin, p-nitrophenyl palmitate, p-nitrophenyl phosphate, propionic acid, pyruvic acid, riboflavin, sorbitol, sucrose, trichloroacetic acid, tris and trypsin

SRL, India

8. Wheat bran Local market

2.2. ISOLATION OF THERMOPHILIC FUNGI

2.2.1. Collection of samples The environmental samples (soil, compost, water, straw and others) were

collected in sterile polyethylene bags/bottles from different geographical regions

of the Thar desert, Rajasthan such as Jodhpur and Bikaner and brought to the

laboratory and preserved in the refrigerator until use for the isolation of

thermophilic moulds.

2.2.2. Isolation and maintenance of thermophilic fungi One gram of sample was suspended in 100 ml normal saline (0.85%) and

incubated at 45ºC and 200 rpm for 1 h. Dilutions of the suspension (10-1-10-5)

were spread plated on YpSs agar (Emerson, 1941) agar (g L-1: starch soluble

15.0, yeast extract 4.0, MgSO4.7H2O 0.5, K2HPO4 1.0, Agar 20.0; pH 7.0).)

plates. The pH of the medium was adjusted to 7.0 and it was supplemented with


59

ampicillin/streptomycin (60 µg ml-1) to suppress bacterial growth. The medium

was autoclaved at 15 lb psi for 15 min. The YpSs agar plates were then

incubated at 45 ºC for 3-5 d. The fungal colonies that appeared were

transferred to fresh YpSs agar plates and incubated at 45ºC for 48 h and later

stored at 4ºC.

2.3. SCREENING FOR CHITINASE

2.3.1. Qualitative screening: plate assay for chitinase The fungal isolates were point-inoculated on Petriplates containing modified

Emerson’s YpSs agar medium supplemented with 0.1% colloidal chitin and

incubated at 45°C for 48 h. Chitinase producing organisms produced a clear

zone of chitin hydrolysis against turbid background.

2.3.2. Quantitative screening: screening for chitinase in shake flasks The isolates were screened in YpSs liquid medium supplemented with 0.1%

colloidal chitin. Fifty ml of the autoclaved medium in 250 ml Erlenmeyer flasks

were inoculated with 4 discs of 10 mm diameter from 3d-old culture plate and

incubated in an incubator shaker at 45oC and 200 rpm for 5 days. The contents

of the flask were filtered through Whatman No. 1 filter paper discs and

centrifuged at 10,000 rpm for 10 min. Chitinase was assayed in the supernatant

by determining chitin hydrolysis products liberated using dinitrosalicylic acid

reagent (Miller 1959).

2.3.3. Enzyme assay

2.3.3.1. Preparation of standard curve of N-acetylglucosamine Standard curve was drawn by measuring the absorbance of solutions containing

varied N-acetylglucosamine levels using dinitrosalicylic acid (DNSA) reagent

(Miller 1959). Stock solution of N-acetylglucosamine (1 mg ml-1) was prepared in

distilled water. A dilution series ranging from 20-1000 μg ml-1 were prepared

from the stock solution. To 1 ml of solution, 1 ml of DNSA reagent was added,

and the mixture was incubated in a boiling water bath for 10 min. After the

addition of 400 μl of 33% Na-K-tartarate and cooling to room temperature the

absorbance was recorded in a spectrophotometer at 540 nm.


60

2.3.3.2. Quantitative assay for chitinase The chitinase enzyme assay was carried out with colloidal chitin as substrate

prepared from commercial chitin according to Tanaka et al. (1999). The reaction

mixture contained 0.5 ml 0.5% colloidal chitin in 50 mM acetate buffer (pH 4.0)

and 0.5 ml crude enzyme solution. The reaction mixture was incubated for 30

min at 55°C. The reducing sugars liberated were determined using DNSA

reagent. One unit of chitinase is defined as the amount of enzyme required to

release 1 nmol of reducing sugars, as N-acetylglucosamine, from colloidal chitin

per second under the assay conditions.

2.3.3.3. Preparation of colloidal chitin Ten grams of chitin (Sigma, USA) was mixed with 50 ml of 85% phosphoric acid

and stirred for 12-16 h at 37°C. The resulting brown coloured suspension was

filtered and 5 liters of distilled water was poured on it, resulting in the

appearance of white colloidal chitin. This colloid was then centrifuged at 12,000

rpm for 10 min. The resulting precipitate was washed with distilled water and

then neutralized by addition of 6 N NaOH. The suspension was centrifuged at

12,000 rpm for 10 min and washed with 3 liters of distilled water for desalting.

The resulting precipitate was suspended in distilled water. The chitin content in

the suspension was determined by drying a sample (final concentration, 1%).

2.4. SELECTION OF POTENT CHITINASE PRODUCING THERMOPHILIC MOULD

Based on above assays, a potent chitinase producing thermophilic mould was

selected from among the 134 isolates of thermophilic fungi.

2.5. IDENTIFICATION AND CHARACTERIZATION OF THE ISOLATE

2.5.1. Colony morphology The thermophilic mould was point-inoculated on YpSs agar plates and

incubated for 120 h and observed for recording colony morphological

characteristics.

2.5.2. Microscopic observation and identification of thermophilic mould

2.5.2.1. Light microscopy A drop of distilled water was taken on a slide and the fungal mycelium was

placed over it. The mycelium was spread with needle and stained with


61

lactophenol and cotton blue stain. The mycelium was covered with a clean

cover slip and observed under the microscope (Olympus-BX51, Japan) at

40 and 100X magnification, for vegetative cells and spores.

2.5.2.2. Scanning electron microscopy (SEM) Forty eight hour old fungal mycelia were washed with phosphate buffer

(0.1 M, pH 7), fixed for 4h in glutaraldehyde (2.5%) and then washed again with

phosphate buffer. This was followed by dehydration in ascending grades of

acetone. After drying, specimens were mounted on stubs with a silver glue for

conduction. The cells were examined under a scanning electron microscope

(Philips SEM-50B) at AIIMS, New Delhi.

2.5.3. Molecular identification The mycelial biomass was suspended in the extraction buffer (50 mM Tris-HCl,

pH 8; 50 mM EDTA; 2% SDS; 1% Triton X 100) along with glass beads (diam.

0.5 mm) [1:1.6:0.6] and homogenized for 2 min. in a bead beater (20 sec pulses

with intermittent cooling in ice). After centrifugation, the cell-free supernatant

was used as the source of crude genomic DNA. The genomic DNA was purified

using phenol, chloroform and isoamylalcohol (Lee et al., 2000). The DNA was

precipitated with isopropanol and washed with ethanol and resuspended in

milliQ water and the purified genomic DNA was used as template for PCR

amplification of ITS sequences.

For amplification of ITS sequence, universal primer pair ITS 1 (TCCGTAG-

GTGAACCTGCGG) and 4 (TCCTCCGCTTATTGATATGC) were used. PCR

was performed in a 0.2 ml tube with a total volume of 50 µl reaction mixture

containing 0.8 µM forward and reverse primer, 200 µM dNTPs, 2.5 U of Taq

DNA polymerase, 2 µl of template DNA in 5 µl PCR buffer (2 mM MgCl2).

Gradient PCR was carried out in a thermocycler (C1000 Thermal Cycler,

BioRad) with the program: (1) initial denaturation- 95°C for 5 min. (2) 30 cycles-

94°Cfor 30 sec.; 56-62°C for 30 sec.; 72°C for 1.5 min. (3) final extension at

72°C for 10 min.

The PCR product was electrophoresed on 0.8% agarose gel and analyzed after

staining with ethidium bromide. The amplicon of 0.5 kbp was excised and

purified with DNA extraction kit (Geneaid) and sequenced. The sequence was


62

used for identifying the fungus with the help of the BLASTn program

(www.ncbi.nlm.nih.gov/BLAST) and multiple-sequence alignments using Clustal

W program.

2.5.4. Growth Kinetics Growth curve of the strain was plotted by growing the organism in chitinase

production medium. Growth was monitored by withdrawing the samples at the

desired time intervals and measuring the fungal biomass.

Specific growth rate (µ) was calculated according to the equation:

µ = dx / dt x 1 / x

where, x is the mean biomass between intervals during log phase. The

generation time (G) was calculated according to the equation:

G = 0.693 / µ

2.6. INDUCTION STUDIES The starch in Emerson’s YpSs medium was substituted with various inducers of

chitinase (chitin, N-acetylglucosamine, lactose and glucosamine) and their

effect on chitinase production was assessed. Fifty ml of the medium was

dispensed in 250 ml Erlenmeyer flasks and inoculated with 0.1 ml conidiospore

suspension of the fungus. Flasks were incubated at 45°C for 5 days, and

thereafter cell-free culture filtrates were harvested by filtration using Whatman

No. 1 filter paper and used in chitinase assays.

2.7. CHITINASE PRODUCTION IN SUBMERGED FERMENTATION

2.7.1. Preparation of spore suspension of M. thermophila as inoculum Spore suspension of the mould was prepared from 5d-old slants grown on

Emerson YpSs agar by adding 20-40 ml of 1N saline containing Tween-80

(0.1% v/v) followed by shaking and filtration. The viable spore count of the spore

suspension was carried out by plating 0.1 ml of a suitable dilution on Emerson

YpSs agar plates incubated at 45°C for 24 h followed by counting the number of

colonies. Spore suspension with a viable spore count of ~1x107 and ~1x108

(CFU ml-1) was used for inoculating the media in SmF and SSF, respectively.

2.7.2. Selection of a suitable medium for enzyme production The composition of five different media tested for chitinase production is given

in Table 2.2. The liquid medium (50 ml) in 250 ml flasks was incubated at 45oC

and 200 rpm after inoculation.


63

Table 2.2 Components of different media used for chitinase production

M1 (%) CoCl2.6H2O 0.2 Lactose 0.5 Na2MoO4.2H2O 0.2 Yeast extract 0.4 ZnCl2.4H2O 0.2 K2HPO4 0.1 CuCl2 0.1 MgSO4 0.05 CaCl2.2H2O 0.1 H3BO3 0.05 M2 (%) HCl 10 ml Colloidal chitin 0.5 Yeast extract 0.4 M6 (%) K2HPO4 0.1 Crab shell chitin 1.25 MgSO4.7H2O 0.05 NH4)2SO4 0.42 NaHPO4 0.69 M3 (%) KH2PO4 0.2 Glucose 3.4 MgSO4.7H2O 0.03 Yeast extract 1.3 Tween-80 0.02 Shrimp and crab shell powder 0.3 Trace element solution 0.1 protein extract 0.5 Trace element solution composition: FeSO4.7H2O 0.5 M4 (%) MnSO4 0.16 Dextrose 1 ZnSO4 0.14 (NH4)2SO4 0.42 CaCl2.H2O 0.2 NaH2PO4 0.69 KH2PO4 0.2 M7 (%) MgSO4.7H2O 0.03 Colloidal chitin 0.5 Peptone 0.1 KH2PO4 0.1 Ctric acid monohydrate 1.05 NaH2PO4 0.1 Urea 0.03 KCl 0.05 MgSO4.7H2O 0.02 M5 (%) CaCl2.H2O 0.01 Colloidal chitin 0.5 α-asparagine 0.05 Peptone 0.1 yeast extract 0.05 MgSO4.7H2O 0.1 (NH4)2SO4 0.2 M8 (%) K2HPO4 0.1 Colloidal chitin 1 NaCl 0.1 Yeast extract 0.2 Trace element solution 0.1 KH2PO4 0.1 MgSO4.7H2O 0.05 Trace element solution composition: KCl 0.05 FeCl2.7H2O 2.7 FeSO4.7H2O 0.001

2.7.3. Effect of incubation period

The effect of incubation days was assessed by incubating the culture flasks at

45°C for 2-8 days. The flasks were harvested after regular intervals and the

culture filtrates were used in chitinase assays.


64

2.7.4. Effect of inoculum size Various inoculum levels (1x106 - 1x108) were used to inoculate the production

medium. The culture filtrate was used in chitinase assay.

2.7.5. Effect of agitation Erlenmeyer flasks (250 ml) containing 50 ml medium were inoculated and

incubated at 45°C for 144 h in an incubator shaker agitated at different speeds

of 0, 100, 150, 200, 250 and 300 rpm. Chitinase production was determined in

each case.

2.7.6. Effect of pH The effect of pH on chitinase production was studied by cultivating the

mould in a set of media prepared by adjusting the pH to 3.0-8.0 at 45°C and 200

rpm for 120 h.

2.7.7. Effect of temperature

The culture flasks were incubated at different temperatures (30°C, 35°C, 40°C,

45°C and 50°C) for 144 h at 200 rpm. Culture filtrates were used in chitinase

assays for determining the effect of temperature on chitinase production.

2.7.8. Selection of a suitable carbon source for enzyme production To select a suitable carbon source for chitinase production, the lactose in the

production medium was substituted with other carbon sources (0.1% w/v) such

as glucose, galactose, arabinose, sucrose, maltose, fructose and colloidal

chitin. The flasks were incubated at 45°C, 200 rpm for 144 h and the enzyme

activity in the culture filtrates was determined.

2.7.9. Effect of different concentrations of colloidal chitin The mould was cultivated in the production medium with different

concentrations of colloidal chitin in 250 ml Erlenmeyer flasks. After incubation

and harvesting, the cell-free culture filtrates were used in chitinase assays.

2.7.10. Effect of different nitrogen sources M. thermophile was cultivated in chitinase production broth containing different

organic and inorganic nitrogen sources (with equimolar nitrogen content).

After incubation and harvesting, cell-free culture filtrates were used in chitinase

assays.


65

2.7.11. Effect of different concentrations of potassium nitrate in the medium

The thermophilic mould was grown in a set of media prepared by incorporating

different concentrations (0.1-3%) of potassium nitrate for 6 days, and the cell-

free culture filtrates were used in chitinase assays.

2.7.12. Effect of dipotassium hydrogen phosphate A set of media was prepared by incorporating different concentrations (0.05-1%)

of dipotassium hydrogen phosphate. The flasks were autoclaved, inoculated

and incubated at 45°C for 6 days and subsequently the culture filtrate was

harvested and used in chitinase assays.

2.7.13. Effect of magnesium sulphate The mould was cultivated in a set of media was prepared by incorporating

different concentrations (0.05-1%) of magnesium sulphate into the medium for 6

days and the culture filtrate were used in chitinase assay.

2.7.14. Effect of Vitamins Vitamin B1, B2, B3, B5, B6 and B12 were included (200 µM) in the medium, and

the mould was grown for 6 days, and subsequently chitinase activities were

determined.

2.7.15. Optimization of Medium Components Using Statistical Designs

2.7.15.1. Identification of important culture variables using Plackett-Burman design

The critical physico-chemical parameters were screened for chitinase

production using Plackett-Burman design (Plackett and Burman, 1946). According to Plackett-Burman if n is the number of variables, then a total of

(n+1) experiments are conducted. Thus, nine variables (chitin, lactose,

potassium nitrate, tryptone, vitamin B12, magnesium sulphate, di-potassium

hydrogen phosphate, mineral salt solution and incubation period) were

screened along with two dummy variables and twelve experiments were

conducted in triplicates. Each variable is represented at two levels, high and low

denoted by (+) and (-), respectively. Each column in Plackett-Burman design

contains an equal number of positive and negative signs. The individual effect of


66

each variable on chitinase production was determined by calculating the

difference between the average of the six measurements made at the high level

of that factor and the average of the measurements made at the low level of that

factor, given by the following equation:

E(Xi) = 2(ΣCi+- ΣCi-) N

Where E(Xi) is the concentration effect of the tested variable. Ci+ and Ci- are the

chitinase activities from the trials where the variable (Xi) under study was

present at high and low concentration, respectively and N is the number of

experiments.

Standard error (S.E.) of the concentration effect was the square root of the

variance of an effect and the significant level (p-value) of the effect of each

concentration was determined using Student’s t-test as given by the equation:

t(Xi) = E(Xi) / S.E.

where, E(Xi) is the effect of variable Xi

2.7.15.2. Optimization of the important media components using RSM

The important variables having maximum effect on the enzyme production in

the Plackett-Burman experiment [potassium nitrate (A), magnesium sulphate (B)

and incubation days (C)] were further optimized by response surface

methodology in the optimized medium (lactose 0.4%; colloidal chitin, 1.5%;

KNO3 variable; MgSO4, variable; K2HPO4, 0.1%; pH 6). Central composite

design (CCD) was used to find out the optimal values of the parameters and to

study their interactions. Each variable in the design was studied at five different

levels (Table 2.3).

Table 2.3. Range of variables used for the response surface methodology

-α -1 0 1 -α

Potassium nitrate 0.21 0.35 0.55 0.75 0.89

Incubation days 3.96 5.6 8 10.4 12.04

Magnesium sulphate 0.11 0.23 0.4 0.57 0.69

……………………...1

……………………...2


67

A 23 factorial design, with eight axial points and six replicates at the center point

with a total number of 20 experiments were employed according to the

statistical software package Design-Expert (Version 6.0.7, Stat-Ease,

Minneapolis, MN, USA). The behavior of the system was explained by the

following quadratic equation:

Y=β0+β1A+β2B+β3C+β11A2+β22B2+β33C2+β1β2AB+β1β3AC+β2β3BC

where, Y is predicted response, β0 is intercept, β1, β2, β3 are linear coefficients,

β1,1, β2,2, β3,3, are squared coefficients, β1,2, β1,3, β2,3, β2,4, are interaction

coefficients and A, B, C, A2, B2, C2, AB, AC, BC are independent variables.

2.7.15.3. Validation and Scale Up of Chitinase Production The validation of the model and feasibility of chitinase production was tested in

shake flasks of varied volumes (0.25 -2.0L), and 7.5 L laboratory fermenter (Applikon, Netherlands) under the optimized conditions. The fermenter

containing 4 L medium (% - colloidal chitin, 1.5; potassium nitrate, 0.4; Vitamin

B12, 200 µl; K2HPO4, 0.1 and MgSO4, 0.05) was operated at 45oC, 250 rpm, 1

vvm of aeration and the pH was maintained at 6.0 + 0.05. The samples were

withdrawn at the desired intervals aseptically and the culture filtrates were used

for the determination of chitinase activity, soluble protein and fungal biomass.

2.8. CHITINASE PRODUCTION IN SOLID STATE FERMENTATION Wheat bran was used as the solid substrate for production of wheat bran. Five

grams of wheat bran was taken in Erlenmeyer flasks and moistened with 25 ml

salt solution containing 0.1% K2HPO4 and 0.05% MgSO4.7H2O. The flasks were

autoclaved at 15 lb psi for 20 min, cooled and inoculated with 0.1 ml

conidiospore suspension of M. thermophila and incubated at 45°C in a

humidified incubator (RH 65%).

2.8.1. Enzyme extraction The enzyme was extracted twice with distilled water with 0.1% Tween-80 (10 ml

g-1 substrate). The flasks were kept on a rotary shaker at 200 rpm for 2 h. The

enzyme was extracted by squeezing the mouldy residue through a wet muslin

cloth. The enzyme extract was further centrifuged at 10,000 x g for 15 min at

…………...3


68

4oC in order to remove any particulate matter. The supernatant was used in

enzyme assays. The dry weight of mouldy residue (DMR) was determined

gravimetrically by drying at 80oC to constant weight.

2.8.2. Effect of solid substrate level on chitinase production Different quantities of wheat bran (5, 10, 15, 20 g) were taken in 250 ml flasks,

moistened with the salt solution (1:5 w/v), inoculated and incubated at 45°C for

4 d. After enzyme extraction, the chitinase was assayed for determining the

enzyme titre.

2.8.3. Effect of different inducers Chitin flakes, powdered chitin and colloidal chitin [(0.1% (w/w)] were added to

the wheat bran medium for induction of chitinase. The flasks were inoculated

and incubated at 45°C for 4 days and subsequently harvested and assayed for

chitinase.

2.8.4. Effect of different concentrations of flake chitin Different quantities of flake chitin (0.1-0.8 g) were added to the SSF medium.

The flasks were autoclaved, inoculated and incubated at 45°C for 4 days.

2.8.5. Incubation time vs. enzyme production Five g substrate in 250 ml flask was moistened with 25 ml salt solution and

autoclaved at 15 lb psi for 30 min, cooled and inoculated with spore suspension

prepared from 5 d-old culture of M. thermophila. The contents of the flasks were

mixed and incubated at 45°C. At the desired intervals (2, 3, 4, 5, 6, 7 and 8d),

the flasks were harvested, and the clear supernatant was used in chitinase

assays.

2.8.6. Effect of water activity (aw) on enzyme production Myceliophthora thermophila was cultivated in Erlenmeyer flasks containing

wheat bran (5 g) moistened to attain varied aw values (with glycerol) according

to Grajek and Gervais (1987) [Table 2.4].

2.8.7. Effect of pH on enzyme production To study the effect of initial pH on chitinase production, two sets of media were

prepared. In first set the wheat bran was moistened with distilled water of varied


69

pH values (3, 4, 5, 6, 7 and 8) adjusted with HCl and NaOH. In another set of

experiment, the buffers of different pH were used as moistening agents. All

flasks were inoculated and incubated at 45°C for 6 d and the culture filtrates

were used in chitinase assays.

Table 2.4. Showing adjustment of water activity with glycerol

2.8.8. Effect of temperature on enzyme production The mould was cultivated on wheat bran in flasks at different temperatures (30,

35, 40, 45 50 and 55 °C) for 5 d and the culture extract was used for the

estimation of chitinase activity.

2.8.9. Effect of various moistening agents on enzyme production The various salt solutions (Table 2.5), distilled water and tap water were used

for moistening wheat bran to assess their effect on the production of chitinase.

The pH of all the salt solutions was adjusted to 6.0 using 1N HCl/NaOH.

2.8.10. Effect of moisture level on enzyme production Different ratios of wheat bran to moistening agent (1:2, 1:3, 1:4, 1:5, 1:6 and 1:7

(w/v) were used to evaluate the effect of moisture level on chitinase production.

2.8.11. Effect of inoculum level/size on enzyme production The effect of inoculum level on chitinase secretion was assessed by inoculating

wheat bran with 1x106, 1x107 and 1x08 conidiospores per 5 g of substrate. The

contents of flasks were mixed by gentle tapping at the bottom of the flasks and

incubated at 45°C for 10 d, and subsequently harvested and assayed for

chitinase.

aw Water (ml) Glycerol (ml) 0.95 70 0

0.92 60 10

0.87 50 20

0.85 47 23

0.80 45 25

0.75 35 35


70

Table 2.5. Composition of moistening agents used in SSF

Salt Solution I (% w/w) Salt Solution III (% w/w) K2HPO4 0.1 (NH4)2SO4 0.5 (NH4)2SO4 1 MgSO4.7H2O 0.5 MgSO4.7H2O 0.3 FeSO4.7H2O 0.03 CaCl2 0.1 NaCl 0.1 FeSO4 0.1 MnSO4 0.1 Salt Solution IV (% w/w) K2HPO4 1 Salt Solution II (% w/w) (NH4)2SO4 0.4 Asparagine 0.1 MgSO4.7H2O 0.3 MgSO4.7H2O 0.5 KCl 0.05 Solution V Distilled water FeSO4 0.01 MnSO4 0.01 Solution VI Tap water

2.8.12. Nitrogen supplementation Various organic and inorganic nitrogen sources were added to the solid

substrate (0.2%, w/w). The flasks were inoculated and incubated at 45°C for 10

days.

2.8.13. Carbon supplementation The mould was cultivated in the SSF medium supplemented with simple sugars

like glucose, sucrose, lactose, arabinose and polysaccharides like starch (0.1%

w/w) in flasks.

2.8.14. Statistical Optimization of Process Parameters

2.8.14.1. Identification of important culture variables using Plackett-Burman design

Plackett-Burman design was followed again to find out the critical medium

components (Plackett and Burman 1946). Eleven (n) medium components were

screened in 12 (n+1) trials. Each of the eleven variables were represented at

two levels, high and low denoted by (+) and (-), respectively. The Plackett-

Burman experiment is designed in such a manner that one half of the trials i.e. 6

trials consists of the high levels of a variable and another half consists of low

level of that variable. The effect of each variable or factor is the difference

between the average of the measurements made at the high level of that factor


71

and the average of the measurements made at the low level of that factor,

which was determined by the following equation:

E(Xi) = 2(ΣCi+- ΣCi-)

N

Where, E(Xi) is the concentration effect of the tested variable. Ci+ and Ci- are the

chitinase activities from the trials where the variable (Xi) measured was present

at high and low concentration, respectively and N is the number of trials

(experiments i.e. 12).

Standard error (S.E.) of the concentration effect was the square root of the

variance of an effect and the significant level (p-value) of the effect of each

concentration was determined using Student’s t-test as given by the equation:

t(Xi) = E(Xi) / S.E. ………..………..........5

where’ E(Xi) is the effect of variable Xi

2.8.14.2. Optimization of selected variables using RSM To find out the optimum level of the screened variables (wheat bran, glucose

and moisture level) and to study their interactions, RSM using central composite

design (CCD) was applied. The levels of three variables, viz. wheat bran (A),

glucose (B) and moisture level (C), identified by Plackett-Burman design were

optimized by CCD experimental plan using the statistical software package

Design-Expert (Version 6.0.7, Stat-Ease, Minneapolis, MN, USA). Each variable

in the design was studied at five different levels (Table 2.6).

Table 2.6. Range of variables used for the response surface methodology

-α -1 0 +1 +α

A: Wheat bran 2.48 3.5 5 6.5 7.52

B: Glucose 0.15 1 2.25 3.5 4.35

C: Moisture level 15.13 17 19.75 22.5 24.37

A 23 factorial design, with eight axial points and six replicates at the centre point

with a total number of 20 experiments were employed. The behavior of the

……………………...4


72

system was explained by the following quadratic equation:

Y=β0+β1A+β2B+β3C+β11A2+β22B2+β33C2+β1β2AB+β1β3AC+β2β3BC ...................6

where, Y is predicted response, β0 is intercept, β1, β2, β3, β4 are linear

coefficients, β1,1, β2,2, β3,3, β4,4 are squared coefficients, β1,2, β1,3, β1,4, β2,3, β2,4, β3,4

are interaction coefficients and A, B, C, A2, B2, C2, AB,AC, BC are independent

variables.

2.8.15. Effect of Bed Depth on Chitinase Production in SSF To assess the effect of bed depth on enzyme production, the substrate was

taken in different quantities in enamel coated metallic trays (20x14x5 cm), so

that the depth of substrate bed varies between 0.5 cm and 4.0 cm. It was

moistened with distilled water containing 1.9% (w/w) glucose. The ratio of

substrate to moistening agent was 1:3 (w/v). The trays were covered with

aluminium foil and autoclaved at 15 lb psi for 20 min and incubated at 45°C for 6

days in a humidified chamber after inoculation.

2.8.16. Fungal Biomass Determination in SSF Fungal biomass in the fermented solid substrate was estimated by determining

the adenosine triphosphate (ATP). ATP was extracted from the mycelium by

constantly stirring for 15 min with 1.2 volume cold 0.51 M trichloroacetic acid

(TCA) + 17 mM EDTA per culture volume (Lundin and Thore, 1975). The ATP

content was determined by the bioluminescent luciferin/luciferase reaction using

a commercial ATP monitoring kit (LK Wallac, Turko, Finland). The light emitted

was measured using a LKB Wallac 1250 luminometer and the voltage signal

was recorded on a potentiometric recorder. The assay was performed at room

temperature by injecting 100 µl of the luciferase reagent into a polystyrene

cuvette, housed in the luminometer, which held a 100 µl of suitably diluted

sample.

2.8.17. Biochemical Analysis of Crude SSF Extract

2.8.17.1. Soluble protein The soluble protein content in the cell-free culture filtrates was determined

according to Lowry et al. (1951) using bovine serum albumin (BSA) as the

standard.


73

Reagent A: 2% Na2CO3 in 0.1% NaOH

Reagent B: 0.5% CuSO.5H2O in 1% sodium-potassium tartrate

Reagent C: 49 ml of reagent A plus 1 ml of reagent B

Reagent D: Folin-Ciocalteau reagent and distilled water (1:1)

Half a milliliter of suitably diluted culture filtrate was mixed with 2.5 ml of reagent

C and allowed to stand at room temperature for 10 min. To this, 0.25 ml of

reagent D was added, the contents were vortexed and incubated in dark for 30

min. The absorbance was measured in a spectrophotometer at 660nm.

The soluble protein content of the enzyme sample was used in determining the

specific enzyme activity (SEA) [U mg-1 protein].

2.8.17.2. Other hydrolytic enzymes secreted by the strain

2.8.17.2.1. Protease assay The reaction mixture comprised 0.5 ml of suitably diluted enzyme sample and

0.5 ml acetate buffer (pH 4.0). Control contained 0.5 ml diluted enzyme and 0.5

ml 10% TCA (trichloro acetic acid) to denature the enzyme. One ml of 1.0 %

casein was dispensed in to each tube and incubated at 50°C for 30 min. The

reaction was stopped by adding 4 ml of 5% TCA to each tube. The tubes were

kept on ice for 15 min, and the contents were centrifuged at 13000 rpm at 4°C.

To 1 ml of supernatant, 5 ml of 0.4M Na2CO3 was added. The tubes were kept

at room temperature for 10 min and 0.5 ml of Folin’s reagent was added. The

tubes were kept in dark for 30 min and A660 was recorded.

One unit (U) of protease is defined as the amount of enzyme required to liberate

one nmol of amino acids ml-1 s-1 as tyrosine under the assay conditions.

2.8.17.2.2. Lipase assay Lipase activity was estimated by quantitating liberation of p-nitrophenol from

p-nitrophenyl palmitate at pH 7.0 and 40°C for 30 min.

Enzyme Activity (U ml-1) Specific Enzyme Activity =

Soluble protein (mg ml-1)


74

One international unit (U) of lipase is defined as the amount of enzyme required

to liberate one nmol of p-nitrophenol ml-1 s-1 under assay conditions.

2.8.17.2.3. Amylase assay The reaction mixture contained 250 µl starch (1%) prepared in acetate buffer

(pH 4.0; 0.1M) and 250 µl enzyme sample. Enzyme control had 250 µl enzyme

and 250 µl buffer; substrate control had 250 µl starch and 250 µl buffer. The

tubes were incubated at 55°C for 30 min. The reaction was stopped by

dispensing 0.5 ml DNSA reagent into the tubes and exposing them in a boiling

water bath for 10 min. To each tube, 0.2 ml of 33% sodium potassium tartarate

was added, and the absorbance values were recorded at 540 nm.

One unit (U) of amylase is defined as the amount of enzyme required to liberate

one nmol of reducing sugars as glucose ml-1 s-1 under the assay conditions.

2.8.17.2.4. Xylanase assay Xylanase was assayed according to Archana and Satyanarayana (1998).

The reaction mixtures containing 250 µl ml of 1% Birchwood xylan in acetate

buffer (0.1M; pH 4.0) and 250 µl ml of enzyme sample were incubated at 55°C

for 30 min. After incubation, 0.5 ml of DNSA were dispensed into the tubes and

they were kept in a boiling water bath for 10 min and then 0.2 ml of 33.0 %

sodium potassium tartarate solution were added and A540 was recorded.

One unit (U) of xylanase is defined as the amount of enzyme required to liberate

one nmol of xylose ml-1 s-1 under the assay conditions.

2.8.17.2.5. Cellulase assay The reaction mixtures containing 250 µl of carboxymethylcellulose (CMC) in

acetate buffer (0.1M; pH 4.0) and 250 µl of enzyme sample were incubated at

55°C for 30 min. After incubation, 0.5 ml of DNSA was added to the tubes and

they were kept in a boiling water bath for 10 min, after which 0.2 ml of 33%

sodium potassium tartarate were added and A540 was recorded.

One unit (U) of cellulase is defined as the amount of enzyme required to liberate

one nmol of glucose ml-1 s-1 under the assay conditions.


75

2.9. ENZYME PURIFICATION A series of conventional methods like concentration of protein by lyophilization,

precipitation with ammonium sulphate or acetone, affinity adsorption and

chromatography have been used for purifying the chitinase from crude culture

filtrate of M. thermophila.

2.9.1. Concentration of the enzyme by lyophilization The cell-free culture filtrate in round bottom flasks was concentrated by

lyophilization using a freeze dryer (FD-1) and freezing bath (EYELA, Japan).

The lyophilized sample was reconstituted in Na-acetate buffer (0.1M, pH 4.0).

2.9.2. Concentration of the enzyme by Ultrafiltration The culture filtrate was subjected to ultrafiltration using Pelicon II membrane

cartridges (Millipore, USA) for concentrating as well as partial purification of the

enzyme. Membrane cartridges of different MW cutoff sizes (5 and 10 kDa) were

tested for the same. The flow rate and pressure during the study was

maintained constant (1 bar). The retentate and permeate collected were

analyzed for chitinase activity and protein concentrations.

2.9.3. Concentration of enzyme by precipitation

2.9.3.1. Ammonium sulfate precipitation The enzyme was concentrated by adding finely powdered ammonium sulfate

(AR grade) to 80% saturation at 4°C, followed by overnight incubation at -20°C.

After centrifugation at 10,000 x g for 30 min, the pellet was dissolved in 10 ml of

acetate buffer (0.1M; pH 4.0) and dialyzed against the same buffer with frequent

changes of the buffer till no more ammonium sulfate could be detected. The

undissolved dialysate was removed by centrifugation (10,000 x g, 4°C, 20 min).

The supernatant was collected and assayed for chitinase. The protein content

was determined according to Lowry et al. (1951).

2.9.3.2. Concentration of enzyme by organic solvent (acetone) The concentration of the enzyme was subsequently done by adding chilled

acetone (at -20°C) to 80% saturation, followed by overnight storage at –20°C.

After centrifugation at 10,000 xg for 20 min, the precipitate was dissolved in 10

ml acetate buffer (0.1M, pH 5.0) and dialyzed against the same buffer with


76

frequent changes of buffer. The undissolved dialysate was removed by

centrifugation (10,000 x g, 4°C, 20 min). The supernatant was collected and

assayed for chitinase. The soluble protein was estimated according to Lowry et

al. (1951).

2.9.4. Affinity Adsorption Affinity purification with colloidal chitin has also been attempted in case of

chitinase as in the initial concentration step. Crude culture filtrate was mixed

with colloidal chitin (3mg/mg protein) and stirred on a magnetic stirrer at 0°C for

4 hrs. Colloidal chitin was then collected by centrifugation at 10,000 xg for 10

min and washed twice with chilled deionized water. For elution, 0.1 M acetate

buffer was added and tubes were left overnight at room temperature.

2.9.5. Ion exchange chromatography

2.9.5.1. Selection of suitable conditions The net charges on protein and matrix are important determining factors in

separation of proteins by ion exchange chromatography. Thus it becomes

necessary to select the buffer parameters like the initial pH and ionic strength,

at which the protein of interest binds maximally to the ion exchange matrix. Test

tube method was used to determine the most favorable buffer parameters.

2.9.5.2. Test tube method for selecting starting pH Ten test tubes were set up and 0.1g DEAE-Sepharose (Sigma, USA), ion

exchanger or chromatographic matrix was added to each tube. The matrix in

each tube was equilibrated to a different pH by washing the gel 10 times with 10

ml of 0.1M buffer of range 3.0 to 9.0 with 1.0 pH unit intervals between tubes.

The tubes were then equilibrated at lower ionic strength (0.05M) by washing 5

times with 10 ml of buffer of the same pH but lower ionic strength. One hundred

µl of enzyme sample was added to each tube and mixed gently for 5-10 min.

The matrix was then allowed to sediment and the supernatant was assayed for

the enzyme activity. The tube showing the least activity in the supernatant has

maximum binding capacity, and thus, the pH of the buffer of this tube was

selected for chromatography. The pH to be used should allow the enzyme to be

bound, but should be as close to the point of release as possible. If too low or


77

high a pH is chosen, elution may become more difficult and high salt

concentrations may have to be used.

2.9.5.3. Test tube method for selecting starting ionic strength Different test tubes were set up and 0.1g of ion exchanger resin was added to

each one of them and was equilibrated with 0.05M buffer as described earlier.

The tubes were then equilibrated to different ionic strengths, ranging between

0.05M and 0.5M by five 10 ml washes, at the pH selected in the earlier step.

One hundred µl of the enzyme sample was added to each tube, mixed gently for

some time and allowed to sediment. The enzyme was assayed in the

supernatant for determining the maximum ionic strength that permits binding of

the enzyme and the minimum ionic strength required for complete desorption of

the enzyme.

2.9.5.4. Purification using ion-exchange chromatography A pre-packed 1 ml resource Q column was equilibrated with 0.1 M acetate

buffer (pH 4). The protein sample eluted after affinity adsorption was

concentrated with speed vac and applied onto the column. The flow rate was

maintained at 1 ml min-1. After extensive washing of the column, the protein was

eluted with a discontinuous gradient of NaCl (0 to 1 M) in the same buffer. The

protein elution was conducted in 1 ml fractions. The protein content of the

fractions was determined by taking A280 and the enzyme was assayed in the

fractions.

The fractions showing the enzyme activity were pooled and concentrated using

Speed vac and loaded on SDS- and native-PAGE to visualize the band(s).

2.9.6. Hydrophobic Interaction Chromatography Pre-swollen phenyl-sepharose slurry of the beads (Sigma, USA) was carefully

poured into a 15x1.5cm plastic column taking extreme care to avoid capturing

air bubbles. The column was then washed with five bed volumes of 0.1 M

acetate buffer (pH 4) followed five bed volumes of the same buffer consisting

0.5 M ammonium sulphate. The flow rate was maintained at 1 ml min-1.

Two ml of sample, eluted after affinity adsorption, was concentrated with speed

vac and applied onto the column. After extensive washing of the column, the


78

protein was eluted with a discontinuous gradient of ammonium sulphate (0.5 to

0 M) in the same buffer. The protein elution was conducted in 1 ml fractions.

The protein content of the fractions was determined by taking A280 and the

enzyme was assayed in the fractions. The samples were simultaneously loaded

on electrophoretic gel to determine the protein purity in the fractions.

2.9.7. Electrophoretic Analysis of the Purified Chitinase Electrophoretic analysis of the purified chitinase was carried out under native

and denaturing conditions to ascertain the enzyme activity and purity,

respectively. The purity of the enzyme was ascertained by SDS-PAGE while its

activity was demonstrated by native-PAGE using 10% gels.

2.9.7.1. Reagents for polyacrylamide gel electrophoresis (PAGE)

2.9.7.1.1. SDS-PAGE The reagents for SDS-PAGE were prepared as given below:

Resolving gel (10%) 10ml ml Distilled water 4.0

30% Acrylamide mix 3.3

1.5M Tris (pH 8.8) 2.5

10% SDS 0.1

10% Ammonium persulphate 0.1

TEMED 0.01

Stacking gel (5%) 4mL Distilled water 2.7

30% Acrylamide mix 0.67

1.0M Tris (pH 6.8) 0.5

10% SDS 0.04

10% Ammonium persulphate 0.04

TEMED 0.06

Tris-glycine electrophoresis buffer 25mM Tris

250mM Glycine (pH 8.3)

0.1% SDS


79

SDS Gel loading buffer 50mM Tris (pH 6.8)

100mM Dithiothreitol

2% SDS

0.1% Bromophenol blue

10% Glycerol

2.9.7.1.2. Native-PAGE The reagents for the native-PAGE were the same as that of SDS-PAGE except

that in place of SDS, equal volume of distilled water was added.

2.9.7.1.3. Reagents for staining and destaining of polyacrylamide gels

2.9.7.1.3.1. Coomassie stain and destain

Coomassie brilliant blue 0.25 g

Glacial acetic acid 10 ml

Methanol: water (1: 1 v/v) 90 ml

Destain The composition was the same as that of the Coomassie stain except that the

dye was not added.

2.9.7.1.3.2. Silver staining

• Gel fixation solution: Trichloroacetic acid (TCA) solution, 20% (w/v).

• Sensitization solution: 10% (w/v) glutaraldehyde solution.

• Silver diamine solution: 21 ml of 0.36% (w/v) NaOH was added to 1.4 ml

of 35% (w/v) ammonia followed by drop wise addition of 4 ml of 20% (w/v) silver

nitrate with stirring.

Note: When the mixture failed to clear with the formation of a brown precipitate,

further addition of a minimum amount of ammonia resulted in the dissolution of

the precipitate. The solution is made up to 100 ml with distilled water. Since

silver diamine solution is unstable, the solution was used within 5 min.


80

• Developing solution : 2.5 ml of 1% (w/v) citric acid, 0.26 ml of 36% (w/v)

formlaldehyde made up to 500 ml with water.

• Stopping solution : 40% (v/v) ethanol, 10% (v/v) acetic acid, in water.

• Farmer's reducer : 0.3% (w/v) potassium ferricyanide 0.6% (w/v)

sodium thiosulfate, 0.1% (w/v) sodium carbonate.

Note: All solutions were prepared freshly in clean glassware using

deionized/distilled water.

2.9.7.2. Preparation of gel and methods of staining

2.9.7.2.1. Casting the gel The gel was prepared by pouring the resolving gel components immediately

after the addition of TEMED, between two electrophoresis plates sealed by agar

after placing spacers between the plates. The gel was left undisturbed for 30

min to allow complete polymerization after which the stacking gel was poured

between the plates, comb was inserted and the gel left undisturbed for another

30 min. Then the comb was taken out and the wells were washed. The gel was

then connected to the electrophoresis apparatus and the samples were loaded

into separate wells created by the comb. The apparatus was run at 50mV till the

dye front was in stacking gel after which it was increased to 70mV.

2.9.7.2.2. Coomassie Blue staining After the completion of the run, the gel was taken out of the glass plates and put

in Coomassie stain. The gel was then placed on gel rocker for three hours after

which the stain was removed and the gel was placed in destain and again put

on the rocker for 4-8 h. The more thoroughly the gel is destained, the smaller

the amount of protein that can be detected by staining with Coomassie Brilliant

Blue. Destaining for 24h usually allows as little as 0.1 μg of protein to be

detected in a single band.

2.9.7.2.3. Silver staining

Fixation

• After electrophoresis, the gel was immediately fixed in 200 ml of TCA (20%

w/v) for 1h at room temperature. Overnight soaking was done for thick and

high percentage gels.


81

• The gel was placed in 200 ml of stopping solution for 2 x 30 min.

• The gel was washed in the excess water for 2 x 20 min facilitating the

rehydration of the gel and the removal of methanol. The loss of hydrophobic

nature of the gel indicated rehydration.

• Sensitization The gel was soaked in 10% (v/v) glutaraldehyde solution for 30 min at room

temperature followed by washing with water for 3 x 20 min to remove excess

glutaraldehyde.

• Staining The gel was soaked in the silver diamine solution for 30 min, followed by 3 x

5 min washings with water.

• Development The gel was placed in developing solution. Protein bands were visualized as

dark brown lines. The staining was terminated by immersing the gel in

stopping solution and can be stored in the same or distilled water.

• Destaining The over stained gels were destained with the help of Farmer's reducing

reagent for the controlled removal of background staining. Destaining was

terminated by returning the gel to the stopping solution.

2.9.7.3. Determination of homogeneity of the purified enzyme The purified fraction containing the enzyme was loaded on a 10% SDS-

polyacrylamide gel. The electrophoretic separation was carried out for about

4-5h at a constant voltage (50mV) while the dye front remains in the stacking

gel and at 70mV after the dye front moves into the separating gel. After the run

the gel was stained with Coomassie Brilliant Blue R-250 (Laemmli, 1970) for 3-4

hours and then destained for several hours till the protein bands were clearly

seen. Gels were also silver stained to reveal protein bands.

2.9.7.4. Zymogram analysis The activity of the purified enzyme was demonstrated on native polyacrylamide

gels. Band corresponding to chitinase activity was visualized by zone of

hydrolysis on substrate gel. After electrophoresis, the native gel was


82

equilibrated in 0.1 M acetate buffer (pH 4.0) for 5 min. A substrate gel was

prepared in 0.1 M acetate buffer with 1% colloidal chitin in a petri dish. The

native gel was then overlayed on substrate gel having 1% colloidal chitin and

the two gels were incubated at 45ºC for 12-16h.

2.9.7.5. Molecular weight determination and glycoprotein staining Molecular weight of the purified enzyme was determined using a 10% SDS- and

native-PAGE (polyacrylamide gel electrophoresis). The purified protein was

run along with molecular weight protein markers (Pharmacia Biotech).

PAS staining was carried out to identify glycosylated proteins where

oligosaccharides were oxidized with periodic acid and stained with Schiff's

reagent (Leach et al., 1980).

Reagents for glycoprotein staining Solution A : Acetic acid 7.5%

Solution B : 0.1M Periodic acid in 5% acetic acid

Solution C : 0.2% Sodium sulphite in 7.5% acetic acid

Solution D : NaOH 4.0 N

Solution E : Iodoacetamide 0.1M

Solution F : 2,3,5-Triphenyltetrazolium chloride (TTC) 0.1% in

O.5 N NaOH

Upon completion of electrophoresis, the protein gel was fixed with Solution A for

30 min at room temperature. The gel was then immersed in Solution B and

incubated at room temperature for 1.5 h. The gel was washed and transferred to

Solution C and kept at room temperature for 2.5 to 3 h. The sodium sulphite

solution that gets discolored must be changed repeatedly until the gel becomes

completely colorless. The colorless gel was made alkaline by immersing in

Solution D for 5-10 min.

The gel was then rinsed with double distilled water immersed in ‘solution E’

and kept for 5 min at room temperature. After washing the gel was immersed in

a freshly prepared solution F and heated in boiling water bath for 1 to 2.0 min

with gentle agitation. The reaction was stopped by washing the gel in 7.5%

acetic acid as soon as pink background appeared. The gel was stored in 7.5%

acetic acid.


83

2.9.7.6. Isoelectric focusing/ determination of isoelectric point

2.9.7.6.1. Reagents

Monomer concentrate

24.25g of acrylamide and 0.75g of N-N’ methylene-bis-acrylamide was

dissolved in distilled water (pH 7.0) up to a total volume of 100ml. The solution

was stored in dark bottle and used within 30 days.

Ammonium per sulfate (APS-10% w/v)

Prepared by dissolving 0.1g of APS in 1ml of distilled water. The solution was

prepared afresh each time.

25% w/v glycerol

25ml glycerol was added to 50ml distilled water. The volume was made up to

100ml with distilled water.

Monomer- ampholyte solution

Monomer concentrate 2.0ml 25% glycerol 2.0ml Ampholyte* 0.5ml

APS (10%) 15μl

TEMED 3μl

Distilled water 1000ml

*Bio- Lyte® 3/10 ampholyte with pH operating range 3.7-9.3.

Fixative

12.5% w/v tricholroacetic acid (TCA) 30% v/v methanol

Staining solution

27% v/v isopropanol 10% v/v acetic acid 0.04% v/v Coomasie brilliant blue 0.5% w/v CuSO4 CuSO4 was dissolved in water before adding isopropanol.


84

Destaining solution I

12% v/v isopropanol 7% v/v acetic acid

0.5% w/v CuSO4

CuSO4 was dissolved in water before adding isopropanol.

Destaining solution II

25% v/v isopropanol 7% v/v acetic acid

2.9.7.6.2. Casting of the IEF gel and electrophoretic separation A few drops of water were pipetted onto the glass plate and the hydrophobic

surface of the gel supporting film was placed onto the plate. The gel support

film-plate was placed on the casting tray with the gel support film facing

downwards. The monomeric ampholyte solution was pipetted between the glass

plate and the casting tray and allowed to set for 1h. 2μl of the sample was

applied onto the gel using the template and the samples were allowed to diffuse

into the gel for 5min. Broad range IEF standard with pI ranging from 3-10

(Bio-Red, USA) was used as pI marker. The template was removed carefully

and isoelectric focusing was carried out using the BioRad Mini IEF Cell Model

111 at 4°C. Initial voltage conditions were 100V for 15min followed by 200V for

15min. The voltage was finally increased to 450V for 60min. After focusing, the

protein was detected by fixing, staining and destaining at room temperature

(25±1°C).

2.10. CHARACTERISTICS OF PURIFIED CHITINASE

2.10.1. Enzyme kinetics

2.10.1.1. Effect of pH The pH optimum of the enzyme activity was determined by conducting enzyme

assay at different pH using different 100 mM buffers [glycine–HCl buffer

(pH 3.0-5.0), NaH2PO4–Na2HPO4 buffer (pH 6.0-8.0), borate buffer (pH 8.0-9.0),

and glycine–NaOH buffer (pH 10-12)] at 55 °C.


85

2.10.1.2. Effect of temperature on enzyme activity The optimum temperature for the enzyme was determined by assaying the

enzyme activity at different temperatures (37-60°C).

2.10.1.3. Effect of substrate concentration Colloidal chitin was added in different concentrations (0.25-10mM prepared in

sodium acetate buffer, pH 4.0) to the reaction mixture. The enzyme assays

were carried out at 55°C for 30 min. The Km and Vmax for the enzyme were

calculated under these conditions by plotting the reciprocals of the reaction

velocity and the substrate concentration.

2.10.1.4. Effect of different substrates To determine the substrate specificity of chitinase, it was incubated in the

presence of powdered chitin, acid and alkali treated chitin and chitosan

(20 mg/ml) in the reaction mixtures and chitinase was assayed under standard

assay conditions.

2.10.1.5. Effect of detergents Ionic detergent (sodium dodecyl sulphate), non-ionic detergents (Triton X-100,

Tween-80, Tween-20), and chelators (EDTA) were included in the reaction

mixtures at concentration 0.1% or 1mM, and chitinase was assayed.

2.10.1.6. Effect of organic solvents The effect of various solvents on the enzyme activity was assessed by

incorporating them into the reaction mixtures at 10 % concentration.

2.10.1.7. Effect of cations Cations such as Na+, Ca2+, Co2+, Fe3+, Ba2+(as chloride salts) Mn2+, Mg2+, Fe2+,

Cu2+, Al3+ and Zn2+ (as sulphate salts) were added in the reaction mixture and

the enzyme activity was determined.

2.10.1.8. Effect of chaotropic reagents The effect of chaotropic agents (Gnd-HCl, Urea and KI, at 0.5 and 2M

concentration) on chitinase activity was assessed. The enzyme was incubated

with various concentrations of the chaotropic agents at 55oC and residual

chitinase activity was measured.


86

2.10.2. Thermostability, pH stability and half-life of chitinase Thermostability and half-life of chitinase were determined by incubating 50 ml of

suitably diluted enzyme sample at 45, 60 and 70°C over a period of 24h, and

subsequent assays at 55°C at the desired intervals.

The pH stability of chitinase at 70oC was determined by subjecting it to pH 4.0

and 7.0 using acetate and phosphate buffers (0.1M) for different time intervals,

and then residual activities were determined.

2.10.3. Effect of stabilizers on thermostability Sucrose, trehalose, glycerol and colloidal chitin were added to the enzyme

solution at a concentration 10%w/v. The mixture was incubated at 70°C for,

followed by the enzyme assay to find out whether any of these could stabilize

the enzyme against thermal denaturation.

2.10.4. Determination of active site amino acid residues involved in catalysis

The reaction mixtures containing the purified enzyme and specific

inhibitors such as 2,3-butanedione (arginine); n-bromosuccinimide (tryptophan);

n-ethylmaleimide (tryptophan); iodoacetate; β-mercaptoethanol, dithioerithritol

(cysteine); PMSF (serine) at 5 and 10 mM were incubated and assayed in order

to find out the reactive active site amino acid residue involved in catalysis.

2.10.5. Shelf-life of the enzyme

The purified enzyme was kept at -20, 4 and 37°C for varying time intervals up to

6 month, while estimating the residual enzyme activity intermittently.

2.10.6. MALDI-LC-MS/MS analysis The purified protein bands fractionated by SDS-PAGE were excised and sent to

TCGA (The Centre for Genomic Application, New Delhi) for peptide mass

spectrometry analysis by LC/MS (Agilent 1100 series 2D NanoLC MS). Mass

spectrometry data were compared with data in the NCBI and Swiss Prot

databases using the Mascot search algorithm.


87

2.11. APPLICATIONS 2.11.1. Enzymatic hydrolysis of chitin The effect of enzyme dosage on chitin hydrolysis was assessed by

incorporating varied amounts of enzyme (20-140 U) in the reaction mixtures

containing 100 mg swollen chitin. As the t1/2 of chitinase at 55°C was 9 hours,

the initial enzyme concentration was replenished after 9 hours of incubation.

The supernatant after centrifugation were analyzed using DNSA reagent

(Miller, 1959). The yield of NAG was estimated from a calibration curve of

standard NAG.

2.11.2. Biocontrol potential of the chitinase 2.11.2.1. Activity against pathogenic fungi Antifungal activity of the purified chitinase was estimated by a hyphal extension-

inhibition assay as described by Kopparapu et al. (2011). The selected fungi

were cultured in 100 x 15 mm Petri dishes containing 10 ml of potato dextrose

agar. The plates were incubated at 30 °C until fungal growth was observed.

Purified chitinase (35 U) was spotted on sterile paper discs (6 mm in diameter),

at a distance of 0.5 cm away from the rim of the mycelia colony. The plates

were incubated at 30 °C for 72 h until mycelial growth had enveloped disks and

formed zones of inhibition around disks containing samples with antifungal

activity.

2.11.2.2. Biocontrol against nematode eggs

Raising eggs masses of Meloidogyne incognita

Azuki beans (Vigna angularis) seeds were soaked in 1% sodium hypochlorite

for 8 min. and rinsed with 2% SDS. The seeds were then kept well separated on

a moist filter paper in a petri dish and incubated at 28°C for 3-4 days for

germination. Germinated seeds were kept in cyg growth pouches (3 seeds per

pouch) and watered. These pouches were kept in vertical position in a tray and

incubated at 28°C for 2-3 days. After which the root tips were inoculated with J2

stage juveniles hatched from M. incognita egg masses previously collected and

incubated overnight in water.


88

The pouches were cut open to expose the roots. A small filter paper disc

(Whatman no. 1 filter paper) was kept under the root tip and inoculated with

10 µl of J2 suspension. Another disc was overlaid covering the root tip so that

the juveniles stay near the root tip and are not washed away while watering the

plants. The pouches are again incubated for 3-4 days at 28°C. After incubation

the filter paper disc are removed and the infected seedling are again incubated

for 10-12 days.

Treatment of egg masses with the enzyme

Approximately equal sized egg masses were taken in microtitre plate (one egg

mass per well) and 500 µl of purified enzyme (17.5 U) was added to a well.

Water and buffer (0.4M acetate buffer, pH 4.0) were taken as control. The plate

was incubated at 28°C for 12 days. The plate was observed under microscope

(16X) after 3, 6, 9 and 12 days for hatching of eggs and appearance of

juveniles. Juveniles in each well were counted.

2.11.2.3. Biocontrol against insects The biocontrol efficacy the enzyme samples against 3rd instar larvae of Aedes

aegypti and grape mealy bugs was determined at NCL, Pune by Dr. M.V.

Deshpande and his coworkers. Five larvae of Aedes aegypti were kept in 1:5

dilution of enzyme in tap water and observed for 5 days. Corrected mortality

was calculated by Abbott’s formula (Abbott, 1925):

% Corrected Mortality = % Kill in treated - % kill in control

100 - % Kill in control x 100

For bioassay with Maconellicoccus hirsutus, 20 mealy bugs after treatment with

lyophilized chitinase, were transferred on sprouted potato and observed for 7

days. Mortality was calculated as above.

II. MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/26651/8/08_chapter...

Documents

Transcript of II. MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/26651/8/08_chapter...