Estradiol Represses Human T-Cell Leukemia Virus-type 1

Tax Activation of Tumor Necrosis Factor-α Gene

Transcription

Christina Tzagarakis-Foster1, Romas Geleziunas2, Abderrahim Lomri1,

Jinping An1 and Dale C. Leitman1*

1Department of Obstetrics, Gynecology and Reproductive Sciences, Center for Reproductive Sciences, University of California, San Francisco, 513 Parnassus Avenue, San Francisco CA 94143, USA. 2 Merck Research Laboratories, West Point, PA 19486 Present address for Abderrahim Lomri: Hop Lariboisiere, INSERM, U349, F-75475 Paris, France

Running Title: E2 Repression of the TNF-α Gene Address correspondence to Dale C. Leitman: University of California, San Francisco Center for Reproductive Sciences, HSE 1619 P.O. Box 0556 San Francisco, CA 94143-0556 Tel. (415) 502-5261 FAX (415) 753-3271 email: leitmand@obgyn.ucsf.edu

Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on September 16, 2002 as Manuscript M205355200 by guest on M

arch 27, 2018http://w

ww

.jbc.org/D

ownloaded from

Adult T-cell leukemia is caused by human T-Cell Leukemia Virus type I (HTLV-I).

HTLV-I Tax protein is essential for clinical manifestations because it activates viral and

cellular gene transcription. Tax enhances production of TNF-α, which may lead to bone

and joint destruction. Because estrogens might prevent osteoporosis by repressing TNF-α

gene transcription, we investigated whether estrogens inhibit the transcriptional effects of

Tax on the TNF-α promoter. Tax activated the –1044, -163 and –125 TNF-α promoters by

9-25-fold, but not the –82 promoter, demonstrating that Tax activation requires –125 and –

82 region, known as the TNF-RE. Three copies the TNF-RE upstream of the minimal

thymidine kinase promoter conferred a similar magnitude of activation by Tax. We

demonstrated that c-jun, NFκB p50 and p65 interact with and activate the TNF-RE by

using mutational analysis of the TNF-RE, Tax mutants that selectively activate NFκB or

CREB/ATF pathway, and gel shift assays with nuclear extracts. Estradiol markedly

repressed Tax activated transcription of the TNF-α gene with ERα or ERβ. Nuclear

extracts from U2OS cells stably transfected with ERα demonstrated that ERs interact with

the TNF-RE. Our studies provide evidence that ERs repress Tax activated TNF-α

transcription by interacting with a c-jun and NFκB platform on the TNF-RE. Estrogens

may ameliorate bone and inflammatory joint diseases in patients infected with HTLV-I by

repressing transcription of the TNF-α gene.

2

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

INTRODUCTION

The human T-cell leukemia virus type 1 (HTLV-1) is the causative agent of adult T-cell

leukemia (ATL), which is a fatal T-lymphoproliferative disorder (1,2), and a chronic progressive

disease of the central nervous system termed HTLV-1 associated myelopathy/tropical spastic

paraparesis (3). HTLV-1 infection is also associated with several autoimmune disorders, such as

Sjogren’s syndrome, and arthropathy, which is a chronic inflammatory disorder of joints similar

to idiopathic rheumatoid arthritis (4,5).

In addition to genes encoding retroviral structural proteins, such as gag, pol and env, HTLV-

1 also encodes for regulatory proteins, such as Tax (6,7). Tax is a 40 kDa zinc-finger protein

involved in the etiology of ATL and its associated diseases by stimulating viral and cellular gene

expression (8). Tax regulates gene expression mainly by activating a variety of transcription

factors that interact with promoters of target genes (9-14) (15,16). Tax likely participates in the

pathogenesis of diseases associated with HTLV-I infection by inducing multiple cytokine genes,

including IL-2, IL-2Rα, granulocyte-macrophage colony stimulating factor, IL-6, and tumor

necrosis factor-α (TNF-α) (17-24).

Transgenic mice expressing Tax display thymic aplasia, neurofibromas and skeletal

alterations, such as an increased number of osteoclasts (25-28). Tax expressing mice also exhibit

a bone phenotype similar to that observed in HTLV-1 infected humans. Tax promotes bone

diseases and hypercalcemia by increasing the expression of several cytokines. For example, T-

cells infected with HTLV-1 express constitutively high levels of TNF-α (29) leading to increased

serum levels of TNF-α (30). Because TNF-α acts as an inhibitory factor for proliferation of

osteoblasts and promotes the differentiation of precursor cells to mature osteoclasts (31),

3

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

excessive TNF-α production leads to bone resorption and hypercalcemia (32), two characteristic

features of ATL.

Albrecht et al. reported that Tax could activate the TNF-α promoter in a region that binds

NFκB (33). We previously identified a region in the TNF-α promoter, the TNF-response element

(TNF-RE) that is activated by TNF-α (34). We also found that estradiol (E2) represses TNF-α

activation of the TNF-α promoter in the presence of estrogen receptor α (ERα) or β (ERβ) (35).

Intriguingly, repression by ERs does not require direct DNA binding, as deletion of the DNA

binding domain of ER does not prevent E2 from inhibiting TNF-α activation of the TNF-α gene

(35). This observation suggests that repression by ERs is not mediated through DNA binding, but

most likely through protein-protein interactions with other transcription factors at the TNF-α

promoter.

Several studies indicate that HTLV-1 infection exhibits gender specific differences in clinical

outcomes, which are thought to result from different levels of sex hormones. Women infected

with HTLV-1 have a lower level of Tax expression and viral load as well as a decreased incidence

of ATL compared to men (36). Furthermore, Hisada et al. reported that the mortality from ATL

is 4-fold higher in males relative to females (37). These observations suggest that higher levels of

estrogens in women may attenuate the clinical effects of HTLV-1 by inhibiting the action of Tax.

To test this hypothesis, we investigated if estrogens repress Tax-mediated stimulation of TNF-α

expression. The results shown here demonstrate that ERs repress Tax activation of TNF-α gene

transcription in the presence of E2 by interacting with c-jun and NFκB. E2 repression of Tax-

induced of TNF-α gene expression, suggests that estrogens may provide a potential therapeutic

approach to ameliorate HTLV-1 associated bone and inflammatory joint diseases.

4

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

MATERIALS AND METHODS

Cell Culture, Transient Transfection and Luciferase Assays–U937 (human monocytic

leukemia cells) and U2OS (human osteosarcoma cells) were maintained as previously described

(38). For transient transfection assays, cells were collected, transferred to a cuvette and

electroporated using a Bio-Rad gene pulser as previously described (38,39). Following

electroporation, cells were resuspended in phenol red free DMEM/F-12 media containing 5%

fetal bovine serum, 2 mM glutamine, 50 units/ml penicillin, and 50 µg/ml streptomycin and

plated in 12-well tissue culture dishes. Cells were treated with 17β-estradiol (E2) for 24 hours

following transfection and then collected and lysed in 200 µl 1X lysis buffer (Promega Co.,

Madison, WI). Luciferase assays were performed according to the manufacture’s instructions

(Promega Co., Madison, WI) using a Monolight luminometer. All experiments presented in the

figures were performed at least three times, and the data were similar between experiments.

U20S cells stably transfected with a plasmid that expresses a Tet repressor were purchased from

Invitrogen (Invitrogen Life Technologies, Carlsbad, CA). These cells were then stably transfected

with full-length ERα cloned downstream of a CMV promoter that contains two Tet responsive

elements (pcDNA TO vector). The U20S-ERα cells were selected with hygromycin and zeocin.

Individual clones were screened for the presence of ERα by RT-PCR and western blotting.

Electrophoretic Mobility Shift Assays–Binding reactions were performed using purified NFκB

p50 or c-jun (Promega Co., Madison, WI). 1 µl undiluted c-jun or 1 µl diluted NFκB p50

[diluted 1:25 in buffer containing 20mM HEPES (pH 7.9), 400 mM KCl, 1 mM EDTA (pH 8.0),

1 mM EGTA (pH 8.0), 1 mM DTT, 1 mM PMSF, 10% glycerol] was added to 15 µl total of

binding buffer [10 mM HEPES, (pH 7.9), 50 mM KCl, 0.2 mM EDTA (pH 8.0), 0.6 mM EGTA

(pH 8.0), 10% glycerol, 2.5 mM DTT, 200 µg BSA, 2 µg poly (dI-dC)]. Binding reactions were

5

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

incubated for 15 minutes at 4°C. Following binding, anti-c-jun (Cell Signaling Technologies) or

anti-NFκB p50 (gift from Dr. Warner Greene, Gladstone Institute of Virology and Immunology,

San Francisco, CA) were added to the reactions, which were incubated for an additional 15

minutes at 4°C. Radiolabeled wild-type TNF-RE (containing the –125 to –82 region of the TNF-

α promoter) probe was then added (40,000 cpm per reaction) and binding reactions were allowed

to incubate for an additional 15 minutes at room temperature. Resulting complexes were

electrophoresed through a 5% non-denaturing polyacrylamide gel with 1X TBE running buffer

(200 volts, 4°C). Following electrophoresis, gels were dried and exposed to film or examined

using a Storm Phosphorimager and analysis software (Molecular Dynamics).

Quantitative real-time PCR–U2OS-vector control or U2OS-ERα stable cells were transiently

transfected with 0.5 µg Tax expression plasmid (a gift from Dr. Warner Greene) and treated with

E2 or ethanol for 24 hours. Following treatment, total RNA was isolated using Trizol (Invitrogen

Life Technologies, Carlsbad, CA). Reverse transcription reactions were performed using 500 ng

total RNA, 250 ng random primers (Invitrogen Life Technologies, Carlsbad, CA), 200 units

MuLV Reverse Transcriptase (Invitrogen Life Technologies, Carlsbad, CA), 1X RT buffer, 1

mM dNTP mix, 7.5 mM MgCl2 and 40 units RNAse inhibitor (Boehringer Mannheim,

Indianapolis, IN). Reactions were incubated at 25 °C for 10 minutes, 48 °C for 40 minutes, and

95 °C for 5 minutes. Real-time PCR detection of TNF-α expression was performed using the

Pre-Developed TaqMan Assay Reagents Target Kit for TNF-α (PE Biosystems, Foster City, CA)

and the ABI PRISM® 7700 (Applied Biosystems, Foster City, CA). Control reactions were

performed using primers and a probe to detect β-glucuronidase (GUS). Gus primers were: (GUS

forward) CTCATTTGGAATTTTGCCGATT, (GUS reverse)

CCGAGTGAAGATCCCCTTTTTA and probe 6FAM-

6

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

TGAACAGTCACCGACGAGAGTGCTGG-TAMRA (Operon, Alameda, CA). Average Ct

(threshold cycle) was calculated using the sequence detection software supplied with the ABI

PRISM® 7700.

RESULTS

Tax Activation and ERα and ERβ Repression of the TNF-α Promoter in U937 Cells–We used

the human monocytic leukemia cell line, U937 to identify regions within the TNF-α promoter

that may be responsive to HTLV-I Tax. This cell line is known to express the TNF-α gene in

response to cytokines (34). U937 cells were co-transfected with the luciferase reporter

containing several deletions of the TNF-α promoter (-1044 to -82) and a Tax expression vector.

Tax activated the –1044, –163 and –125 TNF-α promoter constructs by about 9-25-fold (Fig. 1).

Deleting the TNF-α promoter from –125 to -82 abolished Tax activation. The -125 to -82 region

of the TNF-α promoter was previously termed the TNF-response element, because it is activated

by TNF-α (34). Tax activated three copies of the TNF-RE upstream of the minimal thymidine

kinase promoter by a similar magnitude to the -1044 TNF-α promoter (Fig. 2A). This finding

demonstrates that the TNF-RE contains elements that confer responsiveness to Tax. Expression

of ERα or ERβ resulted in a marked repression (88% and 73%, respectively) of Tax-stimulated

TNF-RE activity in response to E2. The repression by E2 was dose-dependent with maximal

effect observed at 1 nM (Fig. 2B). E2 also repressed Tax activation of the TNF-RE in an adult

human osteoblastic (AHTO) cell line (40) that is immortalized by SV-40 Large T oncogene (Fig.

2C), demonstrating that the effect of E2 also occurs in bone cells.

ERα and ERβ Repress Endogenous TNF-α Expression in U2OS Cells–In order to investigate

if the repression by E2 is physiologically relevant, we performed quantitative real time-PCR

7

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

analysis to determine if E2 also represses Tax-mediated activation of the endogenous TNF-α

gene. For these studies, we used U2OS-ERα cells, which are human osteosarcoma cells stably

transfected with a tetracycline inducible CMV promoter that drives the expression of the ERα

cDNA. The U2OS-ERα cells or a vector control cell line (U2OS-vector) were induced with

doxycycline, transfected with the Tax expression plasmid and treated with E2 for 12 hours.

Quantitative PCR analysis demonstrates that Tax activates the endogenous TNF-α gene by 3-fold

compared to the U2OS-vector control cells without Tax (Fig. 3). E2 produces a 50% reduction in

Tax induced TNF-α mRNA levels in the U2OS-ERα cells. These results demonstrate that

similar to transient transfection assays, ERα represses Tax activation of the endogenous TNF-α

gene expression in an E2-dependent manner.

c-jun/CRE and NFATp/NFκB Elements are Required for Tax Activation of the TNF-RE–We

next sought to explore the mechanism whereby Tax activates the TNF-α promoter. Several

studies showed that ETS, ATF-2, NFATp, NFκB and c-jun/CREB-related transcription factors

bind to the TNF-RE in the TNF-α promoter (34,41-43). NFATp/NFκB and c-jun/CRE are

apparently the most critical elements that regulate the TNF-α promoter function because previous

studies eliminated the ETS binding site as being central to TNF-α promoter activity (44). To

investigate the role of NFATp/NFκB (5’ GGGTTTCTCC 3’) and c-jun/CRE (5’ TGAGCTCA 3’)

elements in Tax activation of the TNF-α promoter, transfection assays were performed using

luciferase reporters containing the wild type TNF-RE or mutations of the c-jun/CRE or

NFATp/NFκB binding sites upstream of the tk promoter. As observed in previous experiments,

Tax activates the wild type TNF-RE approximately 10-fold (Fig. 4), whereas mutations in the c-

jun/CRE or NFATp/NFκB binding site severely diminished Tax activation. As expected,

mutations in both c-jun/CRE and NFATp/NFκB binding sites also dramatically impairs Tax

8

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

activation. No differences were observed between the levels of Tax activation with the single

mutation reporters compared to the double mutation reporter constructs. Therefore, maximal Tax

activation of the TNF-α promoter requires both c-jun/CRE and NFATp/NFκB elements.

NFκB Activity is Necessary for Tax-mediated Activation of the TNF-RE–To further dissect the

pathways involved in Tax activation of the TNF-α promoter, we utilized two previously

characterized Tax mutants, Tax M22 and Tax M47. The Tax M22 mutant is unable to activate

NFκB while maintaining its ability to activate transcription factors of the CREB/ATF family

(45-47), whereas the Tax M47 mutant activates the NFκB pathway, but not the CREB/ATF

pathway (48). As shown in Fig. 5, wildtype and Tax M47 activated the TNF-RE, which was

inhibited by E2. In contrast, Tax M22 was ineffective at activating the TNF-RE and no repression

by E2 was observed. These results demonstrate that Tax has to activate NFκB, but not

CREB/ATF in order to stimulate the TNF-α promoter.

Purified NFκB p50 and c-jun Bind to the TNF-RE–We investigated the ability of c-jun and

NFκB to bind the TNF-RE by electrophoretic mobility shift assays. Binding reactions were done

with purified p50 and c-jun, the DNA binding component of NFκB and AP-1, respectively. As

shown in Fig. 6, both purified NFκB p50 and c-jun bind to the TNF-RE probe (lanes 1 and 2

respectively). When reactions containing both NFκB p50 and c-jun were incubated for 15

minutes or 60 minutes prior to binding to the TNF-RE probe, there are shifted complexes that

correspond to the individual proteins (compare lanes 3 and 4 with lanes 1 and 2). By using

selective antibodies it is clear that the slower migrating complex (marked by arrow) contains

both NFκB p50 and c-jun. (lanes 5 and 6). These results indicate that NFκB p50 and c-jun bind

simultaneously to the TNF-RE.

9

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

ERα Binds to a c-jun/NFκB Complex in the TNF-RE–To begin to probe the mechanism

whereby E2 represses Tax-mediated activation of the TNF-α promoter, we investigated our

hypothesis that ERs bind to the TNF-α promoter indirectly via interactions with transcription

factors bound to the TNF-RE, because we previously reported that ERs do not bind directly to

the TNF-RE (35). For these studies, we used U20S cells stably transfected with ERα. Following

treatment with doxycycline to induce ERα expression, the cells were transfected with the Tax

expression plasmid and treated with E2 for 12 hours. Binding reactions were performed with

U20S-ERα nuclear extracts and specific antibodies to c-jun, NFκB p50, NFκB p65, ATF-2 and

ERα to identify candidate proteins that bind the TNF-RE promoter (lanes 2 – 6 respectively). A

predominant single shifted band is observed with the nuclear extract (Fig. 7). This band is

supershifted with antibodies to c-jun, NFκB p50, and NFκB p65, but not with an antibody to

ATF-2. This pattern demonstrates that a p50 and p65 heterodimer binds to the NFκB site in the

TNF-RE. Furthermore, c-jun binds to the TNF-RE, but not ATF-2, suggesting that the complex

that binds to the c-jun/CRE element is a homodimer of c-jun or more likely a heterodimer with

another transcription factor. There is also a strong supershift with the ERα antibody indicating

that it is also present in the complex bound to the TNF-RE. Taken together, these data suggest

that the complex that binds to the TNF-RE contains c-jun and NFκB, and that ERα represses the

TNF-α promoter by binding to these factors via protein-protein interactions.

10

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

DISCUSSION

Our studies demonstrate that ERs repress Tax activation of TNF-α promoter in transient

transfection assays. The results from quantitative PCR analysis showed that the repression by E2

is not an artifact of reporter plasmids, because E2 produced a similar magnitude of repression of

the endogenous TNF-α gene. Deletion studies showed that the -125 to -82 region of the TNF-α

promoter is necessary for Tax activation. This region contains binding sites for ETS, c-jun, ATF-

2, NFATp and NFκB transcription factors that might mediate the Tax activation of the TNF-α

promoter. Tsai et al. reported that a c-jun/ATF-2 heterodimer binds to the c-jun/CRE in the TNF-

RE (42). The CREB/ATF defective M47 Tax mutant activated the TNF-RE more than wild-type

Tax, suggesting that CREB and ATF-2 are not the factors activated by Tax in these cells. Carter

et al. showed that M47 Tax is more stable then wildtype tax (49), which can explain the finding

that M47 Tax produced a greater activation of the TNF-RE, compared to wildtype Tax.

Activation of the NFκB element by Tax is essential for maximum activation of the TNF-α

promoter, because the M22 Tax mutant deficient in activating the NFκB pathway is unable to

stimulate the TNF-RE reporter. Our in vitro DNA binding studies using nuclear extracts from

Tax-stimulated human osteosarcoma cells showed that NFκB p50, NFκB p65, c-jun and ERα, but

not ATF-2 interact with TNF-RE element. These results indicate that the activation of the TNF-α

promoter by Tax requires c-jun and NFκB, but not ATF-2. Furthermore, c-jun and NFκB must

bind simultaneously to the TNF-RE to activate the TNF-α promoter, because a mutation in either

site abrogates activation by Tax. Other studies reported that related factors, such as c-fos do not

interact with the TNF-RE (34).

Our results suggest the following model whereby ER represses the activation by Tax at the

TNF-RE. After the activation of NFκB by Tax, the NFκB p50/p65 complex binds next to c-jun

11

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

on the TNF-RE leading to the activation of the TNF-α promoter. ER is then recruited to the

promoter by binding to a platform comprised of c-jun and NFκB. Support for this model of ER

action is provided by evidence that ERα or ERβ do not directly bind to the TNF-α promoter (35)

and that NFκB p65 and ER can interact (50-53). Furthermore, ERα and c-jun proteins interact

directly (54) in glutathione S-transferase pull-down and mammalian two-hybrid assays (55).

Alternatively, ER could be recruited to the TNF-α promoter through a bridging protein in direct

contact with the c- jun/NFκB complex.

Examination of the sequence within the TNF-RE region of the TNF-α promoter reveals that

there is only 1 nucleotide separating the c-jun/CRE and NFATp/NFκB elements. Previous

experiments have found that nucleotide insertions resulting in either 0.5, 1 or 1.5 extra turns of the

DNA helix abolishes TNF-α activation (44). Therefore, it is likely that c-jun and NFκB on the

TNF-α promoter are critical for providing the initial platform for ER binding to the TNF-α

promoter, and disruption of the platform prevents the assembly of other factors necessary for

activation of the TNF-α gene by Tax.

One key question that remains is what are the additional proteins in the complex that mediate

repression. There is evidence suggesting that coactivators, such as glucocorticoid receptor

interacting protein-1 (GRIP1) are involved in steroid receptor repression of gene transcription.

GRIP1 potentiates ER-mediated repression of the TNF-α gene (35) and glucocorticoid receptor-

mediated repression of the collagenase gene (56). Another protein that may be part of the

repression complex is p300/CBP, because it is involved in Tax-mediated activation of HTLV-1

transcription in vitro (57). Whether these proteins are an integral part of the repression complex

at the TNF-α promoter or if other proteins participate in repression remains to be determined.

12

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Individuals infected with HTLV-1 suffer from various bone and joint diseases most likely

due to an increased expression of various cytokines, including TNF-α. Hypercalcemia, which

results from enhanced bone resorption, is a prevalent complication observed in patients with ATL,

and has been linked to early death (58). The cause of hypercalcemia in ATL patients is unknown,

but it has been suggested that TNF-α plays a role in this disease because it is associated with

increased serum levels of TNF-α (30). Tax is also strongly expressed in human synovial cells,

which leads to joint destruction. In a transgenic mouse model of HTLV-I infection, mice

expressing Tax exhibit skeletal alterations resembling Paget’s disease, a chronic disorder that

results in enlarged and deformed bones and have chronic inflammatory polyarthropathy (8,59).

Analysis of the joints in these transgenic mice demonstrated enhanced expression of several

cytokines including TNF-α (59).

Intriguingly, similar to HTLV-I infected patients, many postmenopausal women develop

bone and joint diseases that might occur from excessive TNF-α production. A prominent role for

TNF-α in the pathogenesis of osteoporosis is supported by animal studies. For example,

overexpression of TNF-α in mice produces profound hypercalcemia from enhanced bone

resorption (60). Furthermore, the loss of bone mineral density observed in mice after

oophorectomy can be prevented with TNF binding proteins (61) or a soluble TNF receptor that

prevents the action of TNF-α (62). TNF-α might cause osteoporosis by inducing several proteins

responsible for differentiating precursor monocytic cells into bone resorbing osteoclasts (63,64).

Estrogens are used extensively in postmenopausal women to prevent osteoporosis (65,66).

Several studies indicate that the bone sparing effect of estrogens is at least in part due to its ability

to repress TNF-α gene transcription and down regulate TNF-α levels (67,68). Other studies

indicate that TNF-α is involved in the destruction of articular cartilage that is observed in

13

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

osteoarthritis (69). Osteoarthritis is a prevalent condition that is exacerbated by estrogen

deficiency in postmenopausal women and shows some improvement with estrogen replacement

(70), possibly by decreasing TNF-α levels. Whereas estrogens are useful in postmenopausal bone

and joint diseases, our study suggests that they also might be a potential therapeutic approach for

HTLV-1 associated bone and inflammatory joint diseases by directly targeting TNF-α gene

expression. Estrogens are known to exhibit anti-inflammatory properties (71), but it is not known

if this effect occurs through ERα, ERβ or both ERs. Our results demonstrating that ERβ is more

effective than ERα at inhibiting TNF-α and Tax-activation of TNF-α gene transcription, suggest

that ERβ may be the predominate receptor that mediates the anti-inflammatory effects of

estrogens. The finding that E2 is a potent repressor of Tax activation of TNF-α gene may also

account for the observations that females infected with HTLV-I exhibit less severe clinical

manifestations and lower mortality compared to males (37).

ACKNOWLEDGEMENTS

We thank P. Chambon, J-A Gustafsson, and W. Greene for providing plasmids. This

work was supported by a NIH postdoctoral training grant and Bank of America Giannini

postdoctoral fellowship to C. T-F, and grants to D. C. L. from the Paul Beeson Physician Faculty

Scholars in Aging Research Program (funded by Alliance for Aging Research, John A. Hartford

Foundation, Commonwealth Fund and Starr Foundation), National Institute of Child Health and

Human Development Women’s Reproductive Health Research Program and Susan B. Komen

Foundation.

14

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

FIGURE LEGENDS

FIG. 1. A Tax-responsive element is localized to the –125 to –82 region in the TNF-α

promoter. U937 cells were transfected with plasmids containing a luciferase reporter fused to

various regions of the TNF-α promoter or three copies of the TNF-RE (-125 to -82) upstream of

the minimal thymidine kinase promoter in the presence or absence of a Tax expression plasmid

(1 µg). After 24 hours cells were harvested and luciferase activity was assayed. Each data point

is the average of triplicate determinations. The S.E. was < 10%.

FIG. 2. A, ERα and ERβ repress Tax-activated transcription of the TNF-RE in U937 cells.

U937 cells were transfected with TNF-RE-tk-luc plasmid (3 µg), a Tax expression vector (500

ng) and an expression vector for ERα (1 µg) or ERβ (1 µg). Cells were treated with 10 nM E2 for

24 hours and luciferase activity was measured. B, dose-dependent repression of ER mediated

repression of Tax activation of the TNF-RE. U937 cells were transfected as described above and

then treated with increasing concentrations (10–13 M to 10–6 M) of E2. After 24 hours cells were

harvested and luciferase activity was assayed. C, ERα and ERβ repress Tax-activated

transcription of the TNF-RE in human (AHTO) osteoblasts. AHTO cells were transfected with

TNF-RE-tk-luc plasmid (3 µg), a Tax expression vector (500 ng) and an expression vector for

ERα (1 µg) or ERβ (1 µg). Cells were treated with 10 nM E2 for 24 hours and then luciferase

activity was measured. Each data point is the average of triplicate determinations. The S.E was

< 10%.

15

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

FIG. 3. Tax stimulates endogenous TNF-α gene expression. Tetracycline-inducible

U2OS-ERα cells were transfected with the Tax expression plasmid. The cells were treated with

doxycycline to induce ERα expression and maintained in the absence or presence of 10 nM E2

for 24 hours. Quantitative real time-PCR was performed for TNF-α mRNA, which was

normalized to β−glucoronidase mRNA.

FIG. 4. Tax activation of the TNF-α promoter requires c-jun/CRE and NFκB/NFATp

binding sites. Mutations were made in either the c-jun/CRE or NFκB/NFATp elements located

within the –125 to +93 TNF-α promoter. U937 cells were cotransfected with the Tax expression

plasmid (500 ng) and luciferase reporter constructs containing wildtype TNF-RE, c-jun/CRE

mutation, NFκB/NFATp mutation or c-jun/CRE – NFκB/NFATp double mutation upstream of

the tk promoter. Cells were treated with 10 nM E2 for 24 hours and luciferase activity was

measured. Each data point is the average of triplicate determinations. The S.E. was < 10%.

FIG. 5. Tax activation of the TNF-α promoter requires activation of NFκB. U937 cells

were cotransfected with TNF-RE tk-luc, ERα or ERβ expression plasmid (1 µg) and either a

wildtype Tax expression plasmid, a Tax M22 mutant (NFκB -/CREB-ATF +), or a Tax M47

mutant (NFκB +/CREB-ATF -). Cells were maintained in the absence or presence of 10 nM E2

for 24 hours and luciferase and renilla luciferase activity were measured. Renilla luciferase

activity was used to normalize for transfection efficiency. Each data point is the average of

triplicate determinations. The S.E. was < 10%.

16

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

FIG. 6. Purified NFκB p50 and c-jun bind to the TNF-RE. Electrophoretic mobility shift

assays were performed using purified NFκB p50 or c-jun. Binding reactions containing either

purified proteins were allowed to incubate for either 15 minutes or 60 minutes at 4 °C prior to

the addition of NFκB p50 or p65 specific antibodies. The presence of c-jun and NFκB p50 is

confirmed by supershifting with specific antibodies (marked by the asterisk). The arrow

indicates supershifted complexes.

FIG. 7. ERα, NFκB and c-jun interact on the TNF-RE. Tetracycline-inducible U2OS-ERα

cells were transfected with the Tax expression plasmid and then treated with 10 nM E2 for 24

hours, and doxycycline to induce ERα expression. Nuclear extracts were prepared and then

incubated with c-jun, NFκB p50, NFκB p65, ATF-2 or ERα antibodies. Proteins or protein

complexes that bound to a radiolabeled TNF-RE probe were detected by autoradiography. The

arrow indicates supershifted complexes.

17

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

References

1. Poiesz, B. J., Ruscetti, F. W., Gazdar, A. F., Bunn, P. A., Minna, J. D., and Gallo, R. C.

(1980) Proc Natl Acad Sci U S A 77(12), 7415-9.

2. Yoshida, M., Miyoshi, I., and Hinuma, Y. (1982) Proc Natl Acad Sci U S A 79(6), 2031-

5.

3. Gessain, A., Barin, F., Vernant, J. C., Gout, O., Maurs, L., Calender, A., and de The, G.

(1985) Lancet 2(8452), 407-10.

4. Terada, K., Katamine, S., Eguchi, K., Moriuchi, R., Kita, M., Shimada, H., Yamashita, I.,

Iwata, K., Tsuji, Y., Nagataki, S., and et al. (1994) Lancet 344(8930), 1116-9.

5. Watanabe, T. (1997) Int J Hematol 66(3), 257-78.

6. Lenzmeier, B. A., Baird, E. E., Dervan, P. B., and Nyborg, J. K. (1999) J Mol Biol

291(4), 731-44.

7. Johnson, J. M., Harrod, R., and Franchini, G. (2001) Int J Exp Pathol 82(3), 135-47.

8. Ruddle, N. H., Li, C. B., Horne, W. C., Santiago, P., Troiano, N., Jay, G., Horowitz, M.,

and Baron, R. (1993) Virology 197(1), 196-204.

9. Zhao, L. J., and Giam, C. Z. (1991) Proc Natl Acad Sci U S A 88(24), 11445-9.

10. Fujii, M., Tsuchiya, H., Chuhjo, T., Akizawa, T., and Seiki, M. (1992) Genes Dev 6(11),

2066-76.

11. Hirai, H., Suzuki, T., Fujisawa, J., Inoue, J., and Yoshida, M. (1994) Proc Natl Acad Sci

U S A 91(9), 3584-8.

18

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

12. Franklin, A. A., Kubik, M. F., Uittenbogaard, M. N., Brauweiler, A., Utaisincharoen, P.,

Matthews, M. A., Dynan, W. S., Hoeffler, J. P., and Nyborg, J. K. (1993) J Biol Chem

268(28), 21225-31.

13. Wagner, S., and Green, M. R. (1993) Science 262(5132), 395-9.

14. Caron, C., Rousset, R., Beraud, C., Moncollin, V., Egly, J. M., and Jalinot, P. (1993)

Embo J 12(11), 4269-78.

15. Suzuki, T., Hirai, H., Fujisawa, J., Fujita, T., and Yoshida, M. (1993) Oncogene 8(9),

2391-7.

16. Beraud, C., Sun, S. C., Ganchi, P., Ballard, D. W., and Greene, W. C. (1994) Mol Cell

Biol 14(2), 1374-82.

17. Siekevitz, M., Feinberg, M. B., Holbrook, N., Wong-Staal, F., and Greene, W. C. (1987)

Proc Natl Acad Sci U S A 84(15), 5389-93.

18. Ballard, D. W., Bohnlein, E., Lowenthal, J. W., Wano, Y., Franza, B. R., and Greene, W.

C. (1988) Science 241(4873), 1652-5.

19. Miyatake, S., Seiki, M., Yoshida, M., and Arai, K. (1988) Mol Cell Biol 8(12), 5581-7.

20. Ruben, S., Poteat, H., Tan, T. H., Kawakami, K., Roeder, R., Haseltine, W., and Rosen,

C. A. (1988) Science 241(4861), 89-92.

21. Leung, K., and Nabel, G. J. (1988) Nature 333(6175), 776-8.

22. Hoyos, B., Ballard, D. W., Bohnlein, E., Siekevitz, M., and Greene, W. C. (1989) Science

244(4903), 457-60.

23. Mori, N., Shirakawa, F., Shimizu, H., Murakami, S., Oda, S., Yamamoto, K., and Eto, S.

(1994) Blood 84(9), 2904-11.

19

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

24. Cowan, E. P., Alexander, R. K., Daniel, S., Kashanchi, F., and Brady, J. N. (1997) J Virol

71(9), 6982-9.

25. Hinrichs, S. H., Nerenberg, M., Reynolds, R. K., Khoury, G., and Jay, G. (1987) Science

237(4820), 1340-3.

26. Hausmann, S., Biddison, W. E., Smith, K. J., Ding, Y. H., Garboczi, D. N., Utz, U.,

Wiley, D. C., and Wucherpfennig, K. W. (1999) J Immunol 162(9), 5389-97.

27. Ozden, S., Coscoy, L., and Gonzalez-Dunia, D. (1996) J Acquir Immune Defic Syndr

Hum Retrovirol 13(Suppl 1), S154-61.

28. Coscoy, L., Gonzalez-Dunia, D., Tangy, F., Syan, S., Brahic, M., and Ozden, S. (1998)

Virology 248(2), 332-41.

29. Tschachler, E., Bohnlein, E., Felzmann, S., and Reitz, M. S., Jr. (1993) Blood 81(1), 95-

100.

30. Shimamoto, Y., Funai, N., Watanabe, M., and Suga, K. (1996) Int J Hematol 64(2), 111-

8.

31. Centrella, M., McCarthy, T. L., and Canalis, E. (1988) Endocrinology 123(3), 1442-8.

32. Beutler, B., and Cerami, A. (1989) Annu Rev Immunol 7, 625-55

33. Albrecht, H., Shakhov, A. N., and Jongeneel, C. V. (1992) J Virol 66(10), 6191-3.

34. Leitman, D. C., Ribeiro, R. C., Mackow, E. R., Baxter, J. D., and West, B. L. (1991) J

Biol Chem 266(15), 9343-6

35. An, J., Ribeiro, R. C., Webb, P., Gustafsson, J. A., Kushner, P. J., Baxter, J. D., and

Leitman, D. C. (1999) Proc Natl Acad Sci U S A 96(26), 15161-6

36. Hisada, M., Okayama, A., Tachibana, N., Stuver, S. O., Spiegelman, D. L., Tsubouchi,

H., and Mueller, N. E. (1998) Int J Cancer 77(2), 188-92.

20

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

37. Hisada, M., Okayama, A., Spiegelman, D., Mueller, N. E., and Stuver, S. O. (2001) Int J

Cancer 91(4), 497-9.

38. An, J., Tzagarakis-Foster, C., Scharschmidt, T. C., Lomri, N., and Leitman, D. C. (2001)

J Biol Chem 276(21), 17808-14.

39. Leitman, D. C., Mackow, E. R., Williams, T., Baxter, J. D., and West, B. L. (1992) Mol

Cell Biol 12(3), 1352-6

40. Lomri, A., Fromigue, O., Hott, M., and Marie, P. J. (1999) Calcif Tissue Int 64(5), 394-

401.

41. Goldfeld, A. E., McCaffrey, P. G., Strominger, J. L., and Rao, A. (1993) J Exp Med

178(4), 1365-79.

42. Tsai, E. Y., Jain, J., Pesavento, P. A., Rao, A., and Goldfeld, A. E. (1996) Mol Cell Biol

16(2), 459-67.

43. Tsai, E. Y., Falvo, J. V., Tsytsykova, A. V., Barczak, A. K., Reimold, A. M., Glimcher,

L. H., Fenton, M. J., Gordon, D. C., Dunn, I. F., and Goldfeld, A. E. (2000) Mol Cell Biol

20(16), 6084-94.

44. Yao, J., Mackman, N., Edgington, T. S., and Fan, S. T. (1997) J Biol Chem 272(28),

17795-801.

45. Smith, M. R., and Greene, W. C. (1990) Genes Dev 4(11), 1875-85.

46. Sun, S. C., Elwood, J., Beraud, C., and Greene, W. C. (1994) Mol Cell Biol 14(11), 7377-

84.

47. Kanno, T., Brown, K., Franzoso, G., and Siebenlist, U. (1994) Mol Cell Biol 14(10),

6443-51.

21

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

48. Yin, M. J., Christerson, L. B., Yamamoto, Y., Kwak, Y. T., Xu, S., Mercurio, F.,

Barbosa, M., Cobb, M. H., and Gaynor, R. B. (1998) Cell 93(5), 875-84.

49. Carter, R. S., Geyer, B. C., Xie, M., Acevedo-Suarez, C. A., and Ballard, D. W. (2001) J

Biol Chem 276(27), 24445-8.

50. Stein, B., and Yang, M. X. (1995) Mol Cell Biol 15(9), 4971-9.

51. Galien, R., and Garcia, T. (1997) Nucleic Acids Res 25(12), 2424-9.

52. Galien, R., Evans, H. F., and Garcia, T. (1996) Mol Endocrinol 10(6), 713-22.

53. McKay, L. I., and Cidlowski, J. A. (1998) Mol Endocrinol 12(1), 45-56.

54. Doucas, V., Spyrou, G., and Yaniv, M. (1991) Embo J 10(8), 2237-45.

55. Teyssier, C., Belguise, K., Galtier, F., and Chalbos, D. (2001) J Biol Chem 276(39),

36361-9.

56. Rogatsky, I., Zarember, K. A., and Yamamoto, K. R. (2001) Embo J 20(21), 6071-83.

57. Jiang, H., Lu, H., Schiltz, R. L., Pise-Masison, C. A., Ogryzko, V. V., Nakatani, Y., and

Brady, J. N. (1999) Mol Cell Biol 19(12), 8136-45.

58. Kiyokawa, T., Yamaguchi, K., Takeya, M., Takahashi, K., Watanabe, T., Matsumoto, T.,

Lee, S. Y., and Takatsuki, K. (1987) Cancer 59(6), 1187-91.

59. Iwakura, Y., Saijo, S., Kioka, Y., Nakayama-Yamada, J., Itagaki, K., Tosu, M., Asano,

M., Kanai, Y., and Kakimoto, K. (1995) J Immunol 155(3), 1588-98.

60. Johnson, R. A., Boyce, B. F., Mundy, G. R., and Roodman, G. D. (1989) Endocrinology

124(3), 1424-7.

61. Kimble, R. B., Bain, S., and Pacifici, R. (1997) J Bone Miner Res 12(6), 935-41.

62. Ammann, P., Rizzoli, R., Bonjour, J. P., Bourrin, S., Meyer, J. M., Vassalli, P., and

Garcia, I. (1997) J Clin Invest 99(7), 1699-703.

22

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

63. Riggs, B. L. (2000) J Clin Invest 106(10), 1203-4.

64. Teitelbaum, S. L. (2000) Science 289(5484), 1504-8.

65. Johnson, S. R. (1998) Med Clin North Am 82(2), 297-320

66. Kenny, A. M., and Prestwood, K. M. (2000) Rheum Dis Clin North Am 26(3), 569-91

67. Pacifici, R., Brown, C., Puscheck, E., Friedrich, E., Slatopolsky, E., Maggio, D.,

McCracken, R., and Avioli, L. V. (1991) Proc Natl Acad Sci U S A 88(12), 5134-8.

68. Pacifici, R. (1996) J Bone Miner Res 11(8), 1043-51

69. Goldring, M. B. (2000) Curr Rheumatol Rep 2(6), 459-65.

70. Dennison, E. M., Arden, N. K., Kellingray, S., Croft, P., Coggon, D., and Cooper, C.

(1998) Br J Rheumatol 37(11), 1198-202.

71. Bruce-Keller, A. J., Keeling, J. L., Keller, J. N., Huang, F. F., Camondola, S., and

Mattson, M. P. (2000) Endocrinology 141(10), 3646-56.

23

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from

C. LeitmanChristina Tzagarakis-Foster, Romas Geleziunas, Abderrahim Lomri, Jinping An and Dale

gene transcriptionαnecrosis factor-Estradiol represses human T-cell Leukemia virus-type 1 tax activation of tumor

published online September 16, 2002J. Biol. Chem. 

  10.1074/jbc.M205355200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on March 27, 2018

http://ww

w.jbc.org/

Dow

nloaded from