1

A Standard Method to Inactivate Bacillus anthracis Spores to Sterility Using γ-Irradiation 1

Christopher K. Cote1, Tony Buhr

2, Casey B. Bernhards

3,4, Matthew D. Bohmke

2, Alena M. 2

Calm3, Josephine S. Esteban-Trexler

1, Melissa C. Hunter

1, Sarah E. Katoski

3, Neil Kennihan

2, 3

Christopher P. Klimko1, Jeremy A. Miller

1, Zachary A. Minter

2, Jerry W. Pfarr

3, Amber M. 4

Prugh3, Avery V. Quirk

1, Bryan A. Rivers

4, April A. Shea

1, Jennifer L. Shoe

1, Todd M. Sickler

3, 5

Alice A. Young2 David P. Fetterer

1, Susan L. Welkos

1, Joel A. Bozue

1, Derrell McPherson

2, 6

Augustus W. Fountain III3, and Henry S. Gibbons

3* 7

1Bacteriology Division, United States Army Research Institute of Infectious Diseases, Fort 8

Detrick, MD 9

2Naval Surface Warfare Center, Dahlgren Division, Dahlgren, VA 10

3United States Army Edgewood Chemical Biological Center, Aberdeen Proving Ground, MD 11

4Defense Threat Reduction Agency/National Research Council Research Associate Program, 12

Aberdeen Proving Ground, MD 13

Acknowledgements 14

15

We thank Angelo Madonna and the members of the Bacillus anthracis Irradiation and Viability 16

Technical Working Groups for valuable discussions during the design of the study. We thank 17

Mark Karavis and Alvin Liem (ECBC) for assistance with whole-genome sequencing and 18

informatics. Funding was provided by the Office of the Deputy Assistant Secretary of Defense 19

for Chemical and Biological Defense and by the Defense Threat Reduction Agency/National 20

Research Council Post-doctoral Fellowship Program (to C.B.B.) 21

AEM Accepted Manuscript Posted Online 13 April 2018Appl. Environ. Microbiol. doi:10.1128/AEM.00106-18This is a work of the U.S. Government and is not subject to copyright protection in the United States.Foreign copyrights may apply.

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

2

22

Abstract 23

In 2015, a laboratory of the United States Department of Defense (DoD) inadvertently shipped 24

preparations of γ-irradiated spores of Bacillus anthracis that contained live spores. In response, 25

a systematic, evidence-based method for preparing, concentrating, irradiating, and verifying 26

inactivation of spore materials was developed. We demonstrate consistency of spore 27

preparations across multiple biological replicates and show that two different DoD institutions 28

arrive independently at comparable dose-inactivation curves for a monodisperse suspension of B. 29

anthracis spores containing 3 × 1010

colony forming units (CFU). Spore preparations from three 30

different institutions in three strain backgrounds yielded similar decimal-reduction (D10) values 31

and irradiation doses required to assure sterility (DSAL) to the point at which the probability of 32

detecting a viable spore is 10-6

. Furthermore, spores of a genetically-tagged strain of B. 33

anthracis Sterne were used to show that high densities of dead spores suppress the recovery of 34

viable spores. Together, we present an integrated method for preparing, irradiating, and 35

verifying the inactivation of spores of B. anthracis for use as standard reagents for testing and 36

evaluating detection and diagnostic devices and techniques. 37

Importance: The inadvertent shipment by a U.S. Department of Defense (DoD) laboratory of 38

live Bacillus anthracis (anthrax) spores to U.S. and international destinations revealed the need 39

to standardize inactivation methods for materials derived from Biological Select Agents and 40

Toxins (BSAT) and for the development of evidence-based methods to prevent the recurrence of 41

such an event. Following a retrospective analysis of the procedures previously employed to 42

generate inactivated B. anthracis spores, a study was commissioned by the DoD to provide the 43

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

3

data required to support the production of inactivated spores for the biodefense community. The 44

results of this work are presented in this publication, which details the method by which spores 45

can be prepared, irradiated and tested such that the chance of finding residual living spores in 46

any given preparation is 1/1,000,000. These irradiated spores are used to test equipment and 47

methods for detection of agents of biological warfare and bioterrorism. 48

Introduction 49

Like other species of the genus Bacillus, Bacillus anthracis, the causative agent of the disease 50

anthrax, forms hardy, metabolically dormant endospores upon exhaustion of nutrient supplies. 51

These spores are highly resistant to desiccation, temperature extremes, predation, exposure to 52

ultraviolet light, and ionizing radiation, and can survive for extended periods in conditions 53

unfavorable to the survival of vegetative bacteria (1-3). The environmental persistence, overall 54

hardiness, and the relative simplicity of production methods also have made B. anthracis a 55

favorite amongst nations that have historically pursued biological warfare including the United 56

States (pre-1972), the former Soviet Union, Iraq, and several other states that have been 57

suspected of harboring biological weapons programs (4, 5). 58

Because of its known history as a biological weapon, B. anthracis spores have also been utilized 59

as instruments of bioterrorism, notably by Aum Shinrikyo (6) and by the perpetrator of the 2001 60

anthrax attacks (7, 8) through the United States Postal Service. Therefore, development of 61

methods to detect and quantify B. anthracis spores in samples has been of great interest to the 62

public health and military sectors. However, the rigid, relatively impermeable spore structure (9-63

11) also renders the spores refractory to various molecular and biochemical detection methods 64

(12), as harsh mechanical disruption is required to extract nucleic acids in particular, 65

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

4

complicating the development of detection modalities. In addition to the intrinsic physical 66

properties of the spores, costly Biosafety Level-3 (BSL-3) procedures are generally required 67

during the development and testing of new detection and decontamination methods. Therefore, 68

methods of inactivating spores without destroying their physical and molecular characteristics 69

are highly desired and have been utilized over the past decades (13-16). 70

Methods for inactivating spores have historically included wet heat, chemical treatment methods, 71

and irradiation, many of which are reviewed elsewhere (13, 16). Wet heat forces steam under 72

high pressure through the otherwise relatively impermeable spore envelope, resulting in the 73

denaturation of protein components. As a result, wet heat methods compromise the integrity of 74

epitopes recognized by antibody-based detection methods (17, 18). Likewise, chemical methods 75

of decontamination (primarily using bleach, hydrogen peroxide, or ethylene oxide) result in 76

extensive free-radical damage that destroys important components of the spore, preventing 77

germination (19, 20). Because of its high penetrating power and more selective effects on large 78

macromolecular targets (e.g. DNA), γ-irradiation has become a favored method of inactivating 79

biological materials in implantable medical devices, food, and in the sterilization of laboratory 80

equipment (21-25), as irradiation can reduce the risk of contamination and provide assurance of 81

sterility with minimal remaining risks. 82

γ-irradiation was first reported as a suitable method for irradiating B. anthracis spores in 1959 83

(14). Subsequent work showed that spores of various Bacillus species typically exhibited 84

decimal reduction values (D10, the dose required to reduce the population by one log) of between 85

1.8 and 5.5 kGy, with marginal effects on spore ultrastructure, physical properties, and the 86

response to antibody- or PCR-based detection assays (13, 18, 26-29). Because of the perceived 87

efficacy of irradiation in yielding a safe yet responsive product that could mimic the essential 88

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

5

properties of live agent, irradiated spores of B. anthracis became a critical reagent for the 89

development of systems and devices to detect agents of biological warfare and bioterrorism. 90

Many of the experiments describing irradiation procedures, doses, and determination of D10 91

values for B. anthracis were summarized in the US DoD’s analysis of the inadvertent shipments 92

of live, virulent B. anthracis spores to unregistered laboratories in 2015 (30). However, as the 93

DoD report indicated, conditions under which the spores were grown, prepared, concentrated, 94

and handled were inconsistent from one experiment to another, preventing the direct comparison 95

of these data. Thus, the need for reproducible, standardized methods for producing such 96

materials was highlighted. 97

In many inactivation procedures, the risk that live organisms are present following sterilization is 98

approximated by the parameter known as the Sterility Assurance Level (SAL)(31). For medical 99

devices and pharmaceutical products sterilized with radiation, acceptable SALs range from 10-3

100

to 10-6

, depending on the sensitivity of the product itself to the effects of ionizing radiation (24). 101

The SAL represents the probability that a viable organism will be found in a sample subjected to 102

a given dose of radiation (e.g. an SAL of 10-6

indicates that one sample in 106 identically treated 103

samples will contain a viable organism). The SAL is typically extrapolated from the linear 104

portion of dose inactivation curves (“kill curves”) generated with a defined bioburden — usually 105

an appropriate, well-characterized, surrogate organism (25) — and depends on the linearity of 106

the inactivation curve up to the point of complete inactivation. To our knowledge, the concept of 107

the SAL has not been applied to inactivation of B. anthracis spore preparations or to the 108

preparation of biological materials per se (14, 15, 18, 19, 26, 32, 33), particularly for DoD 109

laboratories charged with preparing and distributing inactivated materials (30). 110

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

6

In this work, we present a method for preparing and inactivating B. anthracis spores to a SAL of 111

10-6

using γ-irradiation. In an inter-laboratory comparison performed in parallel at the United 112

States Army Edgewood Chemical Biological Center (ECBC) and the United States Army 113

Medical Research Institute of Infectious Disease (USAMRIID), we establish dose-inactivation 114

curves and decimal reduction values for multiple biological replicates using two different 115

irradiation platforms and use those data to extrapolate radiation doses sufficient to inactivate 116

spores of attenuated B. anthracis Sterne and fully virulent B. anthracis Ames to an SAL of 10-6

. 117

Finally, we characterize and define methods of detecting low levels of viable spores amidst a 118

background of inactivated spores. If followed stringently, the procedure for preparing and 119

irradiating spores presented here should prevent any further inadvertent distribution of live B. 120

anthracis spores and ensure that distributing laboratories remain in compliance with laws and 121

regulations governing biological select agents. 122

123

Results 124

Each independent spore preparation was completed on an independent date and surpassed the 125

quality/quantity requirements stipulated for preparation of B. anthracis spores as a standard 126

reagent for biodefense research. These requirements are delineated in Table 1. We reasoned that 127

each spore preparation should be derived from a well-sporulating parent strain with a known 128

passage history relative to the original isolate. Ideally, spore cultures should exhibit final spore 129

titers of at least 1 × 108 CFU/ml of sporulation medium (target is 1 × 10

9 CFU/ml) prior to spore 130

harvest and purification. The entire spore preparation was not heat shocked, but an aliquot was 131

removed for heat shocking. An aliquot of at least 1 × 107 spores from each spore preparation 132

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

7

exhibited heat resistance (65 °C, 30 min) using a standard quantitative plate assay. The spore 133

mode size should be consistently between 1.0-1.5 µm volume-equivalent spherical diameter 134

determined using a Beckman-Coulter Multisizer (BCM) (Figure 1). Spores were at least 95% 135

pure as judged by light microscopy counting of at least 100 particles per spore preparation 136

(Figure 1, inset). Spore dispersion was confirmed by examining at least 100 spores with light 137

microscopy (Figure 1, inset) and at least 500 spores with particle analysis via the BCM. The 138

BCM measurements of three independent preparations showed reproducible, single, uniformly 139

distributed particle size peaks demonstrating that there was no detectable spore clumping. 140

141

Determination of inactivation kinetics and sterilizing dose of B. anthracis - To determine the 142

batch-to-batch variability of radiation sensitivity and whether the irradiator configuration affects 143

inactivation, we conducted dose-inactivation studies on 3 ml aliquots of three independently 144

prepared batches of B. anthracis Sterne and B. anthracis Ames at 1010

CFU/ml. Because B. 145

anthracis Sterne lacks pXO2 and is exempt from select agent regulations, we utilized the Sterne 146

strain as a surrogate for virulent B. anthracis to develop the procedure prior to validating the 147

results using fully virulent strains. Dose-inactivation of a geographically diverse isolate, B. 148

anthracis Zimbabwe, was also tested. Spore preparations were treated incrementally with ~5 149

kGy increments, and the population of viable spores remaining was determined by serial dilution 150

and plating. Actual radiation doses delivered were monitored by measuring the increase in 151

absorbance of radiochromic film dosimeters that had been attached to each 15 ml conical tube 152

containing the spore aliquots. Dose-inactivation curves from USAMRIID and ECBC are shown 153

in Figure 2. Curves were similar across all batches studied, and were similar between both 154

institutions and among three differing genetic backgrounds. From the slopes of the plots and the 155

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

8

intercepts, D10 and SALs of 10-6

were determined, which are listed in Table 2. We conducted a 156

statistical analysis to determine the average dose for each institute and the 95% confidence 157

intervals for each of the parameters. D10 values for each batch ranged from 1.66 to 2.98 kGy, 158

and DSAL ranged between 29.8 and 46.2 kGy, with the upper bound of the 95% CI of 3.55 kGy 159

and 52.4 kGy for D10 and SAL(10-6

), respectively (Table 3). Our statistical comparison revealed 160

neither significant differences between spore batches nor between institutions (i.e., differences in 161

irradiators and experimental processing), with the exception of a modest but statistically 162

significant difference between the mean DSAL determined for the Ames strain between ECBC 163

and USAMRIID (43.77 versus 37.95 kGy, respectively, p = 0.0089). Overall, averaged over 15 164

inactivation curves covering three different strain backgrounds, the mean D10 was 2.32±0.09 165

kGy, and the mean DSAL was 40.10±1.20 kGy (Table ). 166

167

Analysis of spore integrity/morphology - To determine whether extensive damage to the spore 168

structure had occurred as a result of γ-irradiation, we examined the spores under phase-contrast 169

microscopy. Unirradiated spores were highly refractile (as expected), whereas irradiated Sterne 170

spores had lost much of their refractility (Figure 3). The spore darkening suggests at least partial 171

loss of Ca-dipicolinate and partial rehydration of the spore core. Comparison of varying doses 172

(up to 50 kGy) of unirradiated and irradiated spores by transmission electron microscopy 173

revealed no gross structural damage or morphological alterations (i.e. coat fragmentation or 174

significant damage to the exosporia). 175

At γ-irradiation doses of 15-25 kGy, the morphology of recovered colonies exhibited 176

progressively dramatic variation (Figure 4). While colonies originating from unirradiated spores 177

displayed uniform morphology, spore preparations that had been irradiated with ~15 kGy yielded 178

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

9

heterogeneous colonies in both size and morphology. When spores treated with ~20 kGy were 179

plated, the morphologies were highly variable. Some colonies appeared to expand in a 180

filamentous or “dendritic” pattern, whereas others retained the typical flat, circular, rough 181

morphology with undulate edges. 182

Detection of viable spores in irradiated materials - Since spore recovery at high densities has 183

been shown to be impaired due to the presence of high levels of alanine racemase enzyme (45), 184

we also sought to test whether direct plating yields accurate counts of viable spores, particularly 185

when viable spores are plated along with large numbers of dead spores. We hypothesized in 186

particular that high densities of non-viable spores would inhibit recovery of viable spores due in 187

part to the remaining activity of alanine racemase in the irradiated/dead spores. To test this 188

hypothesis, we spiked irradiated Sterne spores at densities of 1010

CFU/ml with known quantities 189

(~2000 CFU/ml) of viable, unirradiated spores of a strain of B. anthracis Sterne that contains a 190

short genetic tag or “barcode” in the chromosome. Recovery of viable spores by plating was 191

reduced by approximately half in the presence of 109 inactivated spores (Figure 5A). Some of 192

the recovered colonies exhibited a dendritic morphology reminiscent of colonies recovered from 193

near the sterility point (Figure 5A, inset). We then tested whether higher concentrations of dead 194

spores would further inhibit recovery of viable spores. When irradiated spores were 195

concentrated to 1011

CFU/ml prior to spiking (resulting in a mass of 1010

inactivated spores in 196

100 µl samples), recoveries were reduced by 80-95% (Figure 5B). In contrast, recovery of 197

viable spores was not appreciably inhibited when the density of irradiated spores plated with the 198

viable spores was less than 108 (data not shown). All colonies recovered in this experiment 199

(n=88) were shown by barcode-specific PCR to contain the barcode (data not shown). When we 200

pre-treated the viable, barcoded spores with the germinants alanine and inosine (10 mM of each 201

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

10

germinant) prior to adding them to the dead spore mass, near complete recovery of spiked spores 202

was achieved (Figure 5C). However, addition of the germinants after the viable spores were 203

added to the dead spore mass did not promote complete recovery of the viable spores (not 204

shown). 205

Dilution of irradiated spores into liquid culture - We also tested whether dilution of the 206

irradiated spore mass into liquid broth would aid in recovery of viable spores. 100% of 207

irradiated aliquots (one from each spore preparation) were diluted 1:500 (v/v) into three culture 208

flasks containing 500 ml of tryptic soy broth (TSB) and grown in shaking culture at 37 °C for 209

two weeks. The OD600 of the culture decreased within 24 h by approximately 50%, which 210

corresponded to the loss of spore refractility in the irradiation-exposed spores. The OD600 of the 211

suspensions then remained steady at ~0.03 for two weeks, suggesting that no viable spores were 212

detectable in the samples. Furthermore, no viable spores could be cultured from the culture 213

flasks at any point following inoculation. 214

215

Evaluation of effect of post-irradiation incubation on potential spore reactivation - After the 216

unintended shipment of viable spores by the DoD, it was proposed that spores could potentially 217

possess mechanisms to allow for recovery after exposure to radiation, a hypothesis colloquially 218

referred to as the “Zombie Spore Hypothesis” (30). Under this hypothesis, spores “recover” due 219

to DNA repair mechanisms that are active prior to the initiation of the germination program. We 220

tested this hypothesis in several different experiments. Initially, we examined the impact of short 221

term post-irradiation storage at 4 °C and at room temperature. After realizing that multiple 222

institutions have different procedures for viability testing, it became clear that the time between 223

irradiation and viability confirmation could be a confounding variable. In order to address this, 224

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

11

we performed viability testing on samples within 30 min of irradiation and then stored the 225

irradiated material at 4C for long term storage. We re-tested the viability of the irradiated 226

spores at 2 and 4 weeks post-irradiation. No increase in titer was noted for lethally irradiated 227

materials (Figure 6A). As described in Figures 6B and 6C, there was evidence for a slight 228

increase in viability but only at very specific suboptimal doses of radiation (approximately 10-20 229

kGy). The same trends were observed with spores of both Sterne strain (Figure 6B) and the 230

Ames strain (Figure 6C) of B. anthracis. 231

We also examined the impacts of extreme holding times of greater than 1 year. B. anthracis 232

Sterne samples that had been exposed to 35 or 40 kGy and then held for greater than 1 year at 4 233

C were suspended in TSB or brain-heart infusion (BHI) broth to look for any evidence of spore 234

viability. Eight samples were tested at USAMRIID and six samples were tested at ECBC, and 235

there was no evidence of viable B. anthracis in any of the samples (data not shown). Lastly, we 236

examined Sterne spores that were irradiated, frozen at -80 C, and then thawed; again neither 237

USAMRIID nor ECBC observed any restored viability in this scenario (data not shown). 238

The impact of radiation on enzyme activity and DNA integrity – We sought to determine the 239

effects of γ-irradiation on the integrity of known spore components. We reasoned that large 240

macromolecules such as DNA would be more susceptible to degradation than smaller targets 241

such as proteins. We therefore examined the activity of alanine racemase, an important spore 242

enzyme that is localized in both the exosporium and the spore coat, and the integrity of DNA 243

from B. anthracis Sterne spores. The alanine racemase activity was suggested to play a role in 244

the “masking” of viable spores during viability testing. In order to address this concern, we 245

wanted to establish baseline effects of radiation on the alanine racemase activity associated with 246

B. anthracis spores. As presented in Figure 7A, the enzymatic activity associated with spore 247

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

12

preparations was assayed using whole spores that were either boiled (positive control for 248

decrease in enzymatic activity), exposed to 0 kGy, or exposed to 50 kGy. The spores that were 249

exposed to 50 kGy were either irradiated on wet ice or at ambient temperature of the irradiator, 250

representing USAMRIID’s and ECBC’s irradiator configurations, respectively. A dose of 50 251

kGy had a significant effect on the alanine racemase activity associated with B. anthracis Sterne 252

spores irradiated at room temperature (P <0.01) or on wet ice (P = 0.01) compared to untreated 253

spores (0 kGy). There was also a statistically significant difference observed when comparing the 254

alanine racemase activity associated with spores irradiated at ambient temperature compared to 255

spores irradiated on wet ice (P <0.01). The enzymatic activity was determined within 24 h of 256

irradiation and again at 14 days post-irradiation. There was no recovery of alanine racemase 257

activity during this hold time at 4 °C, suggesting that there was no apparent repair of enzyme 258

function associated with time after 14 d at 4 °C. 259

To determine the degree of fragmentation of DNA in irradiated samples, we analyzed 260

genomic DNA isolated from vegetative cells, spores, and irradiated spores. As expected, 261

preparations from spores and vegetative cells yielded DNA of high-molecular weight. DNA 262

from spores also had some lower-molecular weight components. In contrast, DNA from 263

irradiated spores was highly sheared with little high-molecular weight DNA visible (Figure 7B). 264

Effects of γ-irradiation on spore detection assays – We isolated genomic DNA from irradiated 265

and unirradiated spores and performed quantitative qPCR on equal quantities of genomic DNA. 266

No difference in the sensitivity of the assays employed was noted (data not shown). These 267

results were consistent with previous reports (17, 18, 29). Likewise, lateral flow immunoassays 268

specific for B. anthracis were obtained from the Defense Biological Product Assurance Office 269

(DBPAO). No differences in limit of detection of these assays was noted when irradiated spores 270

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

13

were utilized, although the intensity of the positive signal was reduced when irradiated spores 271

were applied to the test strips of the lateral flow assay. 272

Discussion 273

In this work we present an integrated, end-to-end procedure for the standardized production of 274

irradiated spores of B. anthracis. We were able to apply the quantitative concept of the Sterility 275

Assurance Level to the residual risk of recovering a viable spore in preparations of irradiated 276

spores. 277

The spore preparation method described here yields a high concentration (approximately 1010

278

CFU/ml) of viable spores in a monodisperse suspension of uniformly sized particles. It is based 279

on previous work in our laboratories with B. thuringiensis Al Hakam and B. anthracis ΔSterne 280

(41, 43, 44, 46, 47). Including 0.1% Tween-80 in our suspension buffer and all diluent buffers to 281

reduce aggregation minimizes the effects of clumping on downstream analyses and reduces any 282

protective effects that aggregation may have during exposure to γ-radiation. Spores of 283

exosporium-containing Bacillus spp. tend to agglomerate and stick to surfaces (34) due to spore 284

hydrophobicity (35-39) which can be specifically attributed to the exosporium. Species lacking 285

exosporia, such as Bacillus subtilis or B. atrophaeus (40, 41), are considerably less prone to 286

aggregation. produces consistent results, as shown by the ability not only to produce three 287

virtually identical batches using multiple shake flasks per batch, but to do so at three different 288

institutions with comparable results in three different genetic backgrounds. 289

Likewise, the irradiation procedure described here produced almost superimposable results in 290

two different institutions with two differently configured irradiators. USAMRIID’s irradiator is 291

configured such that multiple 60

Co source elements surround the sample, producing a uniform 292

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

14

field of radiation, whereas ECBC’s irradiator has three independently operable sources at the rear 293

of an approximately cubic chamber, producing a field that attenuates with increasing distance 294

from the source. In addition, USAMRIID’s irradiator configuration permitted the use of ice to 295

keep the sample cold, whereas this was not possible in ECBC’s irradiator due to the size 296

limitation of the chamber. In both cases, D10 and DSAL values extrapolated from the inactivation 297

curves were nearly identical, although the differences in irradiator configuration may contribute 298

to some of the higher variability observed in the ECBC runs. By utilizing independent biological 299

replicates, we also accounted for batch-to-batch variability as a potential contributor to 300

differences in radiation sensitivity, provided that conditions for production of the initial spore 301

material are kept consistent. 302

Unlike previous reports (15, 17, 18, 26, 33), our method incorporates the known inhibitory 303

effects on germination of plating spores at high spore densities into our standard procedure for 304

quantitating residual viable spores (45). This experiment was motivated by our findings that 305

viable spores were not recovered at doses of at least 30 kGy, whereas the material distributed 306

prior to 2015 by DoD had been irradiated with considerably higher doses, yet was shown to 307

contain low concentrations of viable B. anthracis spores (30). It is unlikely that the absence of 308

detectable viable spores in our study is due to complete inhibition of germination of remaining 309

viable spores, since the dead spore mass plated in the generation of the kill curves only 310

marginally inhibited recovery of viable spores from deliberately spiked samples. At the upper 311

end of the dose range utilized in the kill curves, we would have expected only ~50% inhibition 312

when 100 µl of the inactivated material was plated (Figure 5A). This inhibition of germination 313

could be due to spatial contraints limiting contact of viable spores with the TSB or more likely 314

due to residual alanine racemase activity associated with the dead spore mass. Plating spores at 315

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

15

higher densities than those we routinely utilized in this study (e.g. 1011

CFU/ml, such as those 316

formerly produced by the DoD (30)) resulted in 80-95% inhibition of recovery of the barcoded, 317

spiked spores (Figure 5B). It is theoretically possible that residual viable spores in the material 318

formerly produced by DoD may have escaped initial detection due to inhibition of germination 319

and/or outgrowth by the dense mass of dead spores. However, the differences between our 320

conditions and those used to grow, prepare, and irradiate the material formerly distributed by 321

DoD make direct comparison of the two scenarios impossible. Our results indicate that, due to 322

the inhibitory effect of the dead spore mass, approximately 20% of the undiluted inactivated 323

material would need to be plated to achieve the equivalent of the suggested 10% sample for 324

determining non-viability (48). Alternately, our results indicate that diluting the inactivated 325

spores by a factor of 10 prior to plating for viability generally eliminates the inhibitory effect of 326

the dead spore mass. 327

It is also unlikely that B. anthracis spores irradiated to a SAL of 10-6

can recover from radiation 328

damage after extended periods of storage before plating. Our DNA profiles show extreme 329

degrees of fragmentation (Figure 7), a type of damage that is typically repaired by non-330

homologous end-joining (NHEJ) in irradiated spores of Bacillus subtilis. NHEJ is thought to 331

occur during germination with the resumption of metabolic activity (49, 50), and would not be 332

active in ungerminated spores. When viable spores can be detected immediately post-irradiation, 333

the number of recoverable CFUs from stored (“held”) samples increases only marginally within 334

approximately 1 week of irradiation. However, it is not clear whether this observation is due to 335

actual germination and proliferation of bacilli within the sample or whether the increase in 336

recoverable CFUs represents the ongoing disaggregation of clusters of spores that may have 337

protected a minuscule fraction of the spores from irradiation. We consider the latter possibility 338

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

16

unlikely due to the monodisperse nature of our spore suspensions, but we cannot formally 339

exclude the possibility that a small number of spores are present in clusters that are not readily 340

found in the microscopic surveys performed here. In contrast, when viable spores were not 341

detected immediately post-irradiation, even extended hold times of up to 4 weeks at room 342

temperature or at 4° C, or over a year at 4° C, did not promote significant recovery of viable 343

spores from these materials. We therefore believe that, under the conditions described here, 344

irradiation to an SAL of 10-6

is sufficient to render a 3 ml suspension containing 3 x 1010

spores

345

inactive and non-viable. 346

Because the spore preparation described here is intended for use across the Chemical and 347

Biological Defense Enterprise as a standard reagent to test DoD-fielded and candidate detection 348

systems, it was necessary that the requisite properties of the spore be preserved through the 349

irradiation process. The damage to spores in the irradiation experiments likely results from a 350

combination of direct radiation and of oxidative and thermal damage, the latter of which may be 351

mitigated by maintaining the spores on ice during the procedure (Figure 7B). We have 352

documented several altered colony morphologies associated with apparent -radiation damage 353

(Figure 4). The “dendritic” morphology may be due in part to effects of the mass of dead spores, 354

as colonies recovered from unirradiated, barcoded spores exhibited a dendritic morphotype when 355

plated on high densities on dead spores. However, the small colony morphotypes likely arise 356

from irradiation-induced damage. While the exact causes of the phenotypic changes are 357

unknown, their observation is important as an indication that the dose of -radiation delivered is 358

clearly sub-optimal but likely approaching the lethal dose which would result in high confidence 359

SALs. Based on our results with a standard hand-held lateral-flow immunoassay, sensitivity is 360

not substantially compromised when irradiated material is applied to the assay tickets, nor is the 361

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

17

utility of the material diminished for detection using qPCR assays, in accordance with previous 362

work (17, 18, 29). We cannot exclude the possibility that spores may be damaged in ways not 363

accounted for in this study, particularly with respect to membrane and coat components. Of 364

particular concern may be the integrity of the polymeric components of the spore coat and the 365

structure of the exosporium. Notably, the spore germ cell wall and cortex consist of high-366

molecular weight peptidoglycan components that would form large macromolecular targets for 367

radiation or free-radical damage (3, 9, 51, 52). These larger molecular complexes would likely 368

be more sensitive to radiation than individual proteins, since radiation sensitivity is a function of 369

molecular target size (53). Our previous work indicated that irradiated B. atrophaeus spores lose 370

the ability to bind malachite green spore stain (29), suggesting that irradiation can impact the 371

integrity of the spore coat, and the loss of refractility observed in this study suggests that 372

irradiated spores may have suffered similar damage to one or more components of the spore 373

envelope . 374

We experienced a single instance (out of a total of 65 samples irradiated at >30 kGy) in which 375

viable spores were recovered after irradiation. Analysis of the procedure used to dilute and plate 376

for viable spores in that experiment revealed that the samples had been diluted and plated 377

beginning with the un-irradiated materials and concluding with the highest dose points. 378

Subsequently, we ensured that the samples were plated in order of increasing expected titer of 379

viable spores, and no viable organisms were detected in the high-dose samples from subsequent 380

irradiation experiments. Given the high titers of viable spores in these samples, cross-381

contamination of inactivated samples is possible — a 1 nl droplet of spore materials prepared as 382

described here would contain 104

viable spores, a level which would contaminate a 3 ml aliquot 383

of inactivated spores to a level of 3 × 103 CFU/ml. The latter titer is well within the range 384

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

18

observed in the samples analyzed for the DoD report (reference (30) and S. Sozhamannan, 385

personal communication). Based on the consistency of our dose-inactivation curves and the 386

number of samples successfully inactivated in this study, we believe that previous “irradiation 387

failures” (26, 30) may actually have been the result of inadvertent contamination with extremely 388

small volumes of high-titer spore material. Therefore, principles of aseptic technique must be 389

practiced stringently, with particular attention to any potential exposure of irradiated spore 390

suspensions to materials or surfaces (e.g. pipettors) containing viable spores. At a minimum, 391

irradiated materials should be manipulated in a rigorously cleaned biosafety cabinet in which no 392

viable spores have been handled prior to the experiment. To further reduce the risk of cross-393

contamination of material destined for removal from containment facilities, a dedicated set of 394

pipettors should be utilized for irradiated material that should be distinct from any pipettor used 395

for preparing or characterizing the unirradiated spore preparation. Finally, we recommend that 396

both the irradiated material itself and any cultures used to check for viability be transferred from 397

the biosafety cabinet prior to any manipulation of viable spores. 398

We believe that it is critical to note that the irradiation procedure presented here is applicable 399

only to those conditions described in this study. Significant deviations from the procedure 400

described here (e.g. changes in spore concentration, volume of spore suspension, media or 401

diluent composition, irradiation dose rate, etc.) could potentially result in unpredicted effects on 402

radiation sensitivity. Indeed, resistance of B. subtilis spores to UV, wet heat, and hydrogen 403

peroxide can be altered by changing the growth conditions (54, 55). Thus, it is recommended 404

that, prior to producing irradiated spore material in a new laboratory setting or following changes 405

to the spore preparation methods, D10 and DSAL values determined in this work be independently 406

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

19

verified, and that 100% sampling of the initial batches of produced material be conducted to 407

ascertain that no viable spores escape either irradiation or detection. 408

Materials and methods 409

Bacillus anthracis strains - The Sterne strain (34F2) was obtained from the Unified Culture 410

Collection at USAMRIID (Frederick, MD): Unified Culture Collection Identifier AGD 0000844 411

BACI012. The parent strain for construction of a barcoded Sterne variant was obtained from S. 412

Leppla (National Institutes of Allergy and Infectious Diseases, Bethesda, MD). The Ames strain 413

utilized in this study was obtained from the USAMRIID collection or the Lovelace Research 414

Institute. The Zimbabwe strain utilized in this study was obtained from the USAMRIID culture 415

collection. Strains were routinely cultured on tryptic soy agar (TSA, Difco), TSA containing 5% 416

sheep’s blood (TSAB, Remel), or on brain heart infusion (BHI) Agar (Difco). Spectinomycin 417

and kanamycin were utilized (when required) at 250 and 20 µg/ml, respectively. 418

Strain construction – Barcode sequence and oligonucleotide primers used for construction of the 419

barcoded B. anthracis Sterne strain are listed in Table 5. Btk-Barcode1 is a 148 bp unique DNA 420

sequence designed in silico using the Barcoder algorithm (Lux et al., manuscript in preparation) 421

and synthesized by Integrated DNA Technologies Inc. A neutral chromosomal location for 422

barcode insertion, between the convergently transcribed genes BAS2302 and BAS2303 of the B. 423

anthracis Sterne chromosome (RefSeq accession number NC_005945.1), was selected using the 424

TargetFinder algorithm (details to be published elsewhere). We adopted selection rules from (56) 425

in combination with the PATRIC database (57) and RNA-seq data (58, 59) to ensure the absence 426

of annotations and transcription within the region. Approximately 500 bp flanking each side of 427

the barcode insertion point were separately PCR amplified from the B. anthracis Sterne 34F2 428

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

20

chromosome. Btk-Barcode1 was PCR amplified from the synthesized plasmid (pSMART-Btk1). 429

The three amplicons were joined by overlap extension PCR (60) using primers Ba1_UpFlank_F 430

and Ba1_DownFlank_R (Table 5) and mediated by the overlapping DNA ends generated during 431

the initial PCR step. The resulting DNA fragment contained Btk-Barcode1 flanked on both 432

sides by B. anthracis DNA. Following gel extraction (QIAquick Gel Extraction Kit, QIAGEN), 433

the DNA fragment was cloned into plasmid pRP1028 (61) by digestion with the restriction 434

enzymes BamHI-HF and KpnI-HF (New England BioLabs Inc.) and ligation. This pRP1028-435

derivative was introduced into B. anthracis Sterne 34F2 and Btk1-Barcode1 was incorporating 436

into the chromosome using the markerless allelic exchange strategy described previously (61). 437

Btk-Barcode1 insertion at the desired site was confirmed by PCR amplification and sequencing. 438

Whole-genome sequencing (MiSeq, Illumina) was also performed to verify the absence of 439

substantial off-target mutations. When used to spike irradiated materials, barcoded strains were 440

prepared and titered according to the procedure described below, diluted in PBS/0.1% Tween 80 441

and added to irradiated spore suspensions to a final concentration of ~2000 CFU/ml. In some 442

experiments the barcoded spores were exposed to L-alanine and inosine (10 mM) prior to being 443

spiked into the dead spore mass. In other experiments, L-alanine (100 mM final concentration) 444

and inosine (6.7 mM final concentration) were added to the dead spore mass before the latter was 445

spiked with the barcoded spores. 446

Preparation of B. anthracis spores – Spores were prepared in broth and characterized as 447

previously published (41, 47, 62, 63). Sporulation medium was 2.5% nutrient broth (NB) 448

amended with CCY salts (41, 62, 64, 65) at pH 7.0, as described previously (46). A 2.63% 449

solution of nutrient broth and 30x KPO4 buffer (pH 7.0) (CCY buffer) were sterilized as 450

independent components. CCY divalent cations were sterile-filtered and stored at -80°C. 451

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

21

Nutrient broth and CCY buffer were combined before addition of CCY divalent cations to 452

mitigate divalent cation-phosphate precipitation. TSA was streaked with primary glycerol stocks 453

of B. anthracis that were frozen in long-term storage at -80 °C. After incubation for 16±2 h at 37 454

°C, a single colony from a TSA plate was transferred to 10 ml of sporulation medium (pre-heated 455

to 37 °C) and vortexed for 30 s. Pre-aerated and pre-heated sporulation medium (200 ml medium 456

in 1-1 baffled flasks with filter caps; Corning #431403) was inoculated with 0.6 ml from the 10 457

ml of inoculum. The Erlenmeyer flasks were then incubated at 34 °C with shaking (300 rev min-

458

1) for 72 ± 2 h in a New Brunswick Scientific shaker/incubator. Sporulated cultures were 459

amended with 35.5 ml of 20% Tween-80 (final concentration 3%) and incubated an additional 24 460

± 2 h, 34 °C at 300 rev min-1

to disperse (“unclump”) spores. Spores were harvested by 461

centrifugation at 2,000 × g, 20 °C for 10 min. Spores were washed twice with 200 ml of 3% 462

Tween-80 at room temperature (22±4 °C) for 24±2 h at 200 rev min-1

. Spores were resuspended 463

in 10-20 ml of 0.1% Tween-80 as previously published (34, 41-44) to a final concentration of ~1 464

× 1010

CFU/ml, aliquoted into 3 ml portions, and then characterized via light microscopy, and 465

BCM analysis (47, 62, 63). Titers of heat-resistant spores were obtained by heating spore 466

preparations to 65 °C for 30 min and plating serial dilutions of untreated versus heat-treated 467

spore preparations. BCM analysis was used to assess spore clumping, determine spore size, and 468

quantify spore cleanliness. TSAB were used to verify that the starting strains and subsequent 469

isolates were non-β-hemolytic. B. anthracis Ames strain spores were made as described above, 470

with the exception being the Ames strain and Zimbabwe strain spores produced at USAMRIID 471

were incubated with shaking at 200 rev min-1

. 472

Irradiation of spores – Three ml aliquots of spores in 15 ml conical tubes were packaged either 473

into a Safe-T-Pak STP-100 Category A Reusable Shipping System (Saf-T-Pak, Inc., Hanover, 474

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

22

MD) at ECBC or into triple sealed plastics bags at USAMRIID and irradiated in a JL Shepherd 475

irradiator (ECBC: Model 484; USAMRIID: Model 109-68). The differences in irradiation 476

procedures at this stage arose because spore preparation and irradiation at ECBC were carried 477

out in separate buildings, requiring transport of Select Agent materials in appropriate containers 478

between facilities. In most cases, USAMRIID maintained samples on ice during irradiation, 479

whereas temperature of the samples could not be regulated at ECBC due to the space constraints 480

of the irradiator. Irradiation times to achieve the desired dose were determined by the position of 481

the sample in the irradiator and extrapolating the administered dose based on the age of the 482

respective cobalt sources. 483

Radiation dosimetry – In most experiments presented here, B3 WINdose radiochromic film 484

dosimeters (GEX Corporation, Centennial, Colorado, USA) were applied to the outside of the 15 485

ml conical tubes. Following irradiation, dosimeters were heat-fixed at 60 °C for 15 min. Films 486

were read at 525 nm on a spectrophotometer (Genesys 20, Thermo Scientific) containing a 487

dosimeter holder. Using a reference table provided by GEX, the absorbance value was translated 488

to irradiation dose received. 489

Electron microscopy - Standard methods for transmission electron microscopy (EM) were 490

employed. B. anthracis spore samples receiving varying doses of irradiation were fixed with 1% 491

glutaraldehyde and 4% formaldehyde in 0.1M phosphate buffer. Post fixation was performed for 492

1 h at room temperature in phosphate buffer containing 1% osmium tetroxide and contrasted in 493

ethanolic uranyl acetate before dehydration in a graded series of ethanol rinses and propylene 494

oxide. The samples were embedded into EMbed-812 embedding medium (Electron Microscopy 495

Sciences; Hatfield, PA) overnight at room temperature, and the samples were then sectioned into 496

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

23

90-nm sections. These sections were counterstained with uranyl and lead salts. All EM samples 497

were examined using a JEOL 1011 transmission electron microscope. 498

Detection and enumeration of viable spores – Following irradiation, spore suspensions were 499

serially diluted 1:10 (v/v) into PBS containing 0.1% Tween-80, briefly vortexed, and plated in 500

triplicate (100 µl) onto TSAB. Plates were incubated at 37 °C and plates with well-separated 501

colonies were enumerated after 24 and 48 hr. Plates with no growth were incubated for up to 30 502

days and monitored for the appearance of colonies. For each lot of spores, the log10 of the 503

concentration of viable spores at 48 h incubation was plotted versus the dose of irradiation 504

received to produce a kill curve. The D10 value, the dose that kills 90% of the spore population, 505

was calculated as the negative reciprocal of the slope following linear regression analysis. The 506

irradiation dose to achieve a SAL of 10-6

was extrapolated from the regression plot. 507

In some experiments, viable spores of a genetically-tagged strain of B. anthracis Sterne (see 508

above) were spiked into the irradiated spore suspension to a final concentration of ~2000 509

CFU/ml. In spiking experiments, 10 µl of barcoded spores at 2 × 104

CFU/ml in PBS/0.1% 510

Tween-80 were added to 100 µl of irradiated spore suspension or, as a control, to 100 µl of 511

diluent buffer. The spiked samples were held at room temperature for 4 hours before being 512

plated onto TSAB. Plates were enumerated following overnight incubation at 37 °C. 513

Three independent batches of irradiated B. anthracis Sterne spores were evaluated for viability 514

using 100 percent sampling of one (3 ml) aliquot irradiated at 40 kGy. The aliquot was diluted 515

to a volume of 15 ml in tryptic soy broth (TSB) and split evenly into three 2 l non-baffled 516

disposable sterile flasks with filtered caps, each with 500 ml TSB, to obtain cultures with optical 517

densities at 600nm (OD600) of approximately 0.05. The cultures were incubated at 37 °C with 518

shaking at 225 rpm for two weeks. The OD600 was monitored at 0, 1, 3, 7, and 14 days post-519

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

24

inoculation. Microscopic morphology under 100x magnification was monitored at day 0, 1, and 520

14, and viability was assessed by plating on solid medium on days 7 and 14. For viability 521

assessment by plating, one ml of culture was centrifuged for 10 min at 3000 x g, 900 µl of 522

supernatant was removed, and the remaining 100 µl was used to resuspend the spores prior to 523

plating the entirety on sheep TSAB plates. The plates were incubated at 37 °C and evaluated for 524

1 week to ensure non-viability of the spores. 525

526

Evaluation of post-irradiation hold time and temperature on viability assessment - Four tubes 527

from each of the three NSWC batches of B. anthracis Sterne were prepared for irradiation at 528

either ECBC or USAMRIID as described above. The turntable of the irradiator at ECBC was 529

non-functional; therefore, the container was rotated manually by 90° at 5 kGy intervals. One 530

tube from each batch was removed following irradiation with nominal doses of 15, 20, 25, and 531

40 kGy. Actual doses for each experiment were verified by dosimetry as described above. In 532

some experiments, the samples were divided following irradiation. Half of the material was held 533

at room temperature, and the other half of the material was held at 4 °C. All of the material was 534

plated in triplicate on TSAB plates at several weeks post irradiation (hold time is indicated in 535

each figure). All plates were incubated at 37 °C and were counted 24 and 48 h after plating. 536

Additionally, irradiated Sterne spores were maintained at 4 °C for over 1 year. 537

Evaluation of freeze-thaw cycle effects on viability assessment - B. anthracis samples that were 538

used to generate the kill curve data were used to evaluate the effect of a freeze/thaw cycle on 539

irradiated B. anthracis spores. 300 µl aliquots of ~40 kGy irradiated spores were placed at -80 540

°C overnight. The next day the samples were thawed at room temperature, plated in triplicate on 541

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

25

TSAB plates (100µl per plate), and incubated at 37 °C. Plates were observed at 24 and 48 h for 542

growth. 543

Alanine racemase activity assay – Assays were performed to measure alanine racemase on the 544

surface of B. anthracis spores (66, 67) . Two individual preparations of B. anthracis Sterne 545

spores were diluted to a working stock concentration of 1 × 108 CFU/ml. Each diluted spore 546

stock was aliquoted into twelve separate screw cap tubes. Four tubes of each stock were boiled 547

for 1 h. Four separate tubes of each stock were irradiated at 50 kGy, on either wet ice or at room 548

temperature, and the remaining aliquots were untreated and stored at 4 °C. Boiled control 549

samples were boiled the same day on which the experimental samples were irradiated. After the 550

sample preparation, a reaction mixture was prepared with the following final concentrations of 551

reagents in water for injection: 10 mM tricine pH 8.5, 10 mM β-nicotinamide adenine 552

dinucleotide sodium salt (β-NAD), 0.15 U/ml L-alanine dehydrogenase, and 0.1 mM D-alanine. 553

This reaction mixture was made fresh for every assay and kept on ice in dark conditions before 554

use. A 90 µl aliquot of the reaction mixture was added to the experimental wells in a Costar 555

black/clear bottom microtiter plate. A 120 µl volume of reaction mixture was added to the plate 556

as a medium control and 120 µl of Tris buffer (50mM Tris, pH 8.0) was added to separate 557

background wells. Spores were dispensed into a separate Falcon 3007 clear U-bottom plate to 558

prevent the reaction from starting until all media had been added to the appropriate wells. The 559

spores (30 µl) were then transferred to the experimental wells. After 15 min at room temperature, 560

the plate was inserted into a SpectraMax i3x Multimode Detection Platform. The fluorescence 561

was measured every 20 min for 1 h (Ex 340/ Em 460). 562

563

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

26

Statistical analysis - For each trial, the relationship between radiation dose (kGy) and colony 564

count (CFU) was estimated under the generalized-linear regression model having a structural 565

component 566

𝑙𝑜𝑔( 𝐴𝑣𝑒𝑟𝑎𝑔𝑒(𝐶𝑜𝑙𝑜𝑛𝑦 𝐶𝑜𝑢𝑛𝑡) ) = ∝ + 𝛽 ∗ 𝐷𝑜𝑠𝑒 + log ( 𝑉𝑜𝑙𝑢𝑚𝑒 ∗ 𝐷𝑖𝑙𝑢𝑡𝑖𝑜𝑛)

with errors following a negative binomial distribution. The free parameters ∝ and 𝛽 were 567

estimated from the data, and represent the intercept and slope of the log-linear model, 568

respectively. This model is equivalent to the standard single-target single-hit model as discussed 569

by Bodgi et al (68). The dose required for each 10 fold reduction in the colony count (D10) is 570

estimated as log (0.1)

𝛽. The dose required to achieve an expected colony count of 10

-6 is estimated 571

as log( 10−6) − 𝛼

𝛽 . Confidence intervals are based on large sample delta-method approximation. 572

Analysis was implemented in SAS®

PROC NLMIXED SAS3 version 9.4. A few outliers were 573

removed prior to model fitting. In the NSWC/20170620 experiment, the 15.4 kGy dose level, 574

dilutions -6 and -7 were removed along with a single observation labeled as likely hemolysis. 575

These were technical errors, marked as such in the data. In the ECBC2/20170705 colonies were 576

observed in a single aliquot that had been irradiated with 44.4 kGy. As these were likely due to 577

contamination with unirradiated spores (see Results and Discussion, above), these data were not 578

included in the fit and were marked as a technical error in the source data files. Several of the 579

experiments showed a pronounced shouldering effect at low doses, wherein the dose response 580

did not take effect at doses near 0 kGy. To improve the overall model fit at higher dose levels, 581

the 0 kGy points were not considered for the purpose of model fitting. The statistical 582

significances of strain and institute effects were obtained by entering the unweighted estimates of 583

D10 and DSAL into Welch’s t-test. No adjustment was applied for multiple comparisons. The 584

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

27

alanine racemase assays were processed as follows: For each preparation, plate blanks were 585

subtracted, technical replicates were averaged, and the maximum linear rate (RFU per min.) was 586

estimated by ordinary least squares linear regression. Rates were compared between treatment 587

groups by an ANOVA model, controlling for the effect of spore stock. Arithmetic mean rates 588

are reported as ratios to boiled control, with confidence intervals obtained by standard delta 589

method approximations to the variance of the ratio of statistically independent arithmetic means. 590

Analysis is implemented in SAS version 9.4 SAS PROC GLIMMIX. 591

592

593

Table 1: Specifications for standarized spore preparation for B. anthracis strains and surrogates 594

Property Requirement Method

Titer 108 heat-resistant CFU/ml in initial

sporulation medium; 1010 CFU/ml in

final preparation

Heat-shock 107 spores for 30 min

at 65 C, quantitate by serial

dilution plating on TSA medium

Size 1.0 – 1.5 µm volume-equivalent

spherical diameter Measure 500 spores using a

BCM

Purity 95% pure spores with minimal

vegetative cell debris

Examine 100 particles per spore

preparation by light microscopy.

Spores are bright, refractive

particles.

Clumping or

aggregation

Unclumped, individual spores Prepare and dilute spores in

buffer containing 0.1% Tween-

80. Examine 100 spores by light

microscopy and 500 spores by

particle analysis via BCM

595

596

Table 2: Results of individual dose-inactivation experiments 597

Strain Irradiator Spore Preparation/Irradiation

Date

D10 (95% CI)

kGy

DSAL (95% CI)

kGy

AMES ECBCc NSWC/20170620 2.35 ( 2.03 , 2.67 ) 43.86 ( 40.23 , 47.48 )

ECBC1/20170627 2.02 ( 1.10 , 2.95 ) 41.53 ( 30.19 , 52.86 )

ECBC2/20170705 2.33 ( 2.22 , 2.45 ) 44.05 ( 42.66 , 45.44 )

ECBC3/20170906 2.46 ( 2.23 , 2.70 ) 45.65 ( 42.89 , 48.41 )

USAMRIID USAMRIID1/20170419 2.19 ( 2.18 , 2.20 ) 37.79 ( 37.55 , 38.04 )

USAMRIID2/20170524 2.04 ( 1.92 , 2.16 ) 36.32 ( 34.93 , 37.72 )

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

28

NSWC/20170621 2.28 ( 2.12 , 2.45 ) 39.75 ( 37.96 , 41.53 )

STERNE ECBCc NSWC1/20160513 2.75 ( 2.48 , 3.01 ) 42.59 ( 39.67 , 45.50 )

NSWC1/20160416a 5.11 ( 4.29 , 5.94 ) --

NSWC2/20160517 2.20 ( 1.95 , 2.45 ) 37.02 ( 34.06 , 39.98 )

NSWC3/20170519 1.66 ( 1.23 , 2.10 ) 29.83 ( 25.18 , 34.48 )

USAMRIID NSWC1/20160422a,b 2.81 ( 2.63 , 2.99 ) 46.22 ( 44.38 , 48.06 )

NSWC2/20160429a,b 2.25 ( 2.16 , 2.34 ) 37.24 ( 36.29 , 38.19 )

NSWC3/20160512 2.98 ( 2.76 , 3.19 ) 44.45 ( 42.27 , 46.64 )

NSWC1/20160607c 2.08 ( 1.99 , 2.17 ) 34.30 ( 33.37 , 35.22 )

ZIMBABWE USAMRIID USAMRIIDZimbabwe20170705 2.45 ( 2.39 , 2.51 ) 40.86 ( 40.17 , 41.56 )

D10: Decimal reduction value. Dose required for 10 fold reduction. 598 DSAL: Sterility assurance level. Dose required for rate per mLl of 10-6. 599 -- Indicates statistics not estimable from the observed data. 600 CI: Confidence Interval. 601 a Tween-80 not present in diluent buffer 602 b Dosimetry not utilized 603 c No ice utilized during irradiation 604 605

606

607 608

Table 3: Inter-laboratory comparison dose-inactivation experiments 609

kGy - Ames kGy - Sterne Difference (P-Value)

D10 ECBC/Dahlgren 2.29 ( 1.99 , 2.59 ) 2.20 ( 0.86 , 3.55 ) 0.09 (P = 0.8089)

USAMRIID 2.17 ( 1.87 , 2.48 ) 2.53 ( 1.84 , 3.21 ) -0.36 (P = 0.1967)

Difference (P-Value) 0.12 (P = 0.3511) -0.32 (P = 0.4441)

DSAL ECBC/Dahlgren 43.77 ( 41.07 , 46.48 ) 36.48 ( 20.59 , 52.37 ) 7.29 (P = 0.1818)

USAMRIID 37.95 ( 33.69 , 42.22 ) 40.55 ( 31.49 , 49.62 ) -2.60 (P = 0.4415)

Difference (P-Value) 5.82 (P = 0.0089) -4.07 (P = 0.4303)

Excluding experiment NSWC1/20160416 610 Values indicate mean (95% CI). 611 P-Values indicate result of Welch’s T-test. 612

613

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

29

614

615

Table 4: D10 and DSAL Overall Summary 616

Statistic N

Mean

(kGy)

SEM

(kGy)

Std Dev

(kGy)

D10 15 2.32 0.09 0.34

DSAL 15 40.10 1.20 4.65

Excluding experiment NSWC1/20160416 . 617

618

Table 5: Oligonucleotide sequences utilized in this study 619

620

621

Primer or

sequence name

Sequence (5ʹ to 3ʹ) a Use

Ba1_UpFlank_F CTGAGGATCCGATGCACA

ACTGCCATCC

Amplification of ~500 bp fragment upstream of barcode

insertion point and amplification during overlap extension

PCR

Ba1_UpFlank_R GACAGAGCTCCTTATCTG

CTTTCTCTGTATATTTTTTAA

G

Amplification of ~500 bp fragment upstream of barcode

insertion point

Ba1_Barcode1_F GCAGATAAGGAGCTCTGT

CTCCAACTC

Amplification of Btk-Barcode1

Ba1_Barcode1_R GGTTCTTCAGCTAGCGGTT

TGAGGCAG

Amplification of Btk-Barcode1

Ba1_DownFlank_F CCGCTAGCTGAAGAACCTA

CCTGCTTC

Amplification of ~500 bp fragment downstream of barcode

insertion point

Ba1_DownFlank_R CGTGGTACCGTTGAAGTA

ATTGGTACAG

Amplification of ~500 bp fragment downstream of barcode

insertion point and amplification during overlap extension

PCR

Ba1_UpOut CGTACTAGCCCCTCTGATG

ATG

Amplification of entire barcode insertion region/sequencing

Ba1_DownOut ACCGCAGTCCGTTCTAATA

TCA

Amplification of entire barcode insertion region/sequencing

Btk-Barcode1 GAGCTCTGTCTCCAACTC

CCAGTATCTTATTTTCTTA

ATAGATTATATCAAGACT

ATTAATTTTACCCGACGC

AGGACCCCACTAAGTGAT

TTCAATATTTAGAAATTA

TTGTAAAATATCTTAACT

TCGCTGCCTCAAACCGCT

AGC

Barcode sequence. Barcode is flanked by SacI and NheI

restriction sites (bold) and was obtained in plasmid

pSMART-Btk1.

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

30

622

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

31

623

Figure Legends 624

Figure 1: Standardized spore preparation of B. anthracis Sterne. Particle size distribution 625

analysis of three independent spore preparations prepared according to methods described in this 626

work. Inset shows monodisperse, phase-bright spores visualized by phase-contrast microscopy. 627

Figure 2: Summary of dose-inactivation curves from 16 independent inactivation experiments 628

performed at A) ECBC and B) USAMRIID. Except as noted, experiments performed at 629

USAMRIID maintained spore suspensions on ice during irradiation. Shaded area represents the 630

95% confidence interval. aDiluent was PBS with no Tween-80.

bIce omitted. 631

Figure 3: Spore ultrastructure analysis. Irradiated and unirradiated B. anthracis Sterne spores 632

were visualized by transmission electron microscopy and phase-contrast microscopy (50 and 40 633

kGy doses, respectively). Bars in electron microscopy represent 500 nm. Phase-contrast images 634

were taken using an oil immersion objective at 1000x magnification. 635

Figure 4: Abnormal morphologies of B. anthracis Sterne colonies recovered from samples 636

irradiated with near-sterilizing doses of 15 and 20 kGy (nominal dose) of γ-radiation. 637

Unirradiated and irradiated spores were diluted to yieldcountable numbers of colonies upon 638

plating. Experiment shown is representative of three independent biological replicates irradiated 639

and plated at two different institutions. Black arrows represent small colony morphotypes; white 640

arrows represent “dendritic” morphotype. 641

Figure 5: Recovery of viable spores is inhibited by the presence of high densities of dead spores. 642

A) Viable spores were spiked to a concentration of ~2000 CFU/ml into 100 µl of irradiated 643

spores at 1010

CFU/ml or diluent buffer and plated onto TSAB. Inset: abnormal morphology of 644

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

32

recovered colonies. B) Effects of concentrating dead spores to 1011

CFU/ml on viable spore 645

recovery. 100 ul of each spore suspension was spiked with 2000 CFU/ml of barcoded B. 646

anthracis Sterne spores and plated onto TSAB. C) Effects of germinants and hold time on spore 647

recovery. Alanine and inosine (AI) were added (10 mM each) to viable spores prior to spiking 648

into slurry of dead spores. PBS was added in lieu of alanine and inosine as a control. Results are 649

the average of two independent experiments. Error bars represent standard deviation. Addition 650

of AI to dead spore mass prior to addition of live spores did not promote recovery of viable 651

spores (not shown) 652

Figure 6: Effects of extended hold times on recovery of spores in irradiated samples of B. 653

anthracis Sterne and Ames spores. A) Representative absolute CFU titers of Sterne spores after 654

post-irradiation holds of 1-4 weeks at 4 °C. B) Increase in viable counts in comparison to t0 655

initial counts performed immediately after exposure to radiation (fold increase). Post-irradiation 656

storage of Sterne spores for 2-4 weeks at 4 °C leads to a relative increase in viable spore titer. A 657

modest increase in recovered viable CFU was observed in some cases when sub-optimal doses of 658

radiation were administered (i.e. 10-20 kGy). C. The same effects were observed for spores of 659

the fully-virulent Ames strain. In cases where there was no detectable growth, a value of 1 660

CFU/ml was used to calculate the respective fold increase, as that was the limit of detection of 661

the plating assay. 662

Figure 7: Spore irradiation affects DNA and enzymatic integrity. A) Alanine racemase activity 663

in unirradiated spores (0 kGy), spores irradiated at room temperature (RT), and spores irradiated 664

on wet ice (ICE). The data depict relative enzymatic activities compared to boiled spores. Two 665

individual spore preparations were used to calculate enzymatic activities. For each test-treatment 666

(radiation on ice or ambient temperature) N=4 or for the unirradiated-0 kGy samples N=8 and 667

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

33

the bars depict 95% confidence intervals (CI). A dose of 50 kGy had a significant effect on the 668

alanine racemase activity associated with B. anthracis Sterne spores irradiated at room 669

temperature (P <0.01) or on wet ice (P = 0.01) compared to untreated spores (0 kGy). There was 670

also a statistically significant difference observed when comparing the alanine racemase activity 671

associated with spores irradiated at ambient temperature compared to spores irradiated on wet ice 672

(P <0.01). The enzymatic activity was determined within 24 h of irradiation and again at 14 days 673

post-irradiation; there was no recovery of alanine racemase activity during this hold time at 4 °C. 674

B) Agarose gel electrophoresis of genomic DNA isolated from vegetative bacilli (Veget.), 675

unirradiated spores, and irradiated spores. Genomic DNA isolated from B. thuringiensis 676

vegetative cells is also shown as a quantitation standard. MwM = 1 kb Molecular weight marker. 677

Gel was loaded to optimize visualization of the degree of DNA arising from irradiation. 678

679

References 680

681

1. Nicholson WL, Munakata N, Horneck G, Melosh HJ, Setlow P. 2000. Resistance of Bacillus 682 endospores to extreme terrestrial and extraterrestrial environments. Microbiol Mol Biol Rev 683 64:548-72. 684

2. Klobutcher LA, Ragkousi K, Setlow P. 2006. The Bacillus subtilis spore coat provides “eat 685 resistance” during phagocytic predation by the protozoan Tetrahymena thermophila. Proceedings 686 of the National Academy of Sciences of the United States of America 103:165-170. 687

3. Driks A. 2009. The Bacillus anthracis spore. Mol Aspects Med 30:368-73. 688 4. Regis E. 1999. The biology of doom : the history of America's secret germ warfare project, 1st 689

ed. Henry Holt, New York. 690 5. Leitenberg M, Zilinskas RA. 2012. The Soviet Biological Weapons Program: A History. Harvard 691

University Press, Cambridge, MA. 692 6. Keim P, Smith KL, Keys C, Takahashi H, Kurata T, Kaufmann A. 2001. Molecular investigation 693

of the Aum Shinrikyo anthrax release in Kameido, Japan. J Clin Microbiol 39:4566-7. 694 7. Anonymous. 2010. Amerithrax Investigative Summary. Department of Justice, Government 695

USF, Washington, DC. 696 8. Rasko DA, Worsham PL, Abshire TG, Stanley ST, Bannan JD, Wilson MR, Langham RJ, Decker 697

RS, Jiang L, Read TD, Phillippy AM, Salzberg SL, Pop M, Van Ert MN, Kenefic LJ, Keim PS, 698

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

34

Fraser-Liggett CM, Ravel J. 2011. Bacillus anthracis comparative genome analysis in support of 699 the Amerithrax investigation. Proc Natl Acad Sci U S A 108:5027-32. 700

9. Driks A. 2002. Maximum shields: the assembly and function of the bacterial spore coat. Trends 701 Microbiol 10:251-4. 702

10. Bozue JA, Welkos S, Cote CK. 2015. The Bacillus anthracis Exosporium: What’s the Big 703 “Hairy” Deal? Microbiology Spectrum 3. 704

11. Stewart GC. 2015. The Exosporium Layer of Bacterial Spores: a Connection to the Environment 705 and the Infected Host. Microbiology and Molecular Biology Reviews 79:437-457. 706

12. Picard FJ, Gagnon M, Bernier MR, Parham NJ, Bastien M, Boissinot M, Peytavi R, Bergeron 707 MG. 2009. Internal control for nucleic acid testing based on the use of purified Bacillus 708 atrophaeus subsp. globigii spores. J Clin Microbiol 47:751-7. 709

13. Russell AD. 1982. The destruction of bacterial spores. Academic Press. 710 14. Horne T, Turner GC, Willis AT. 1959. Inactivation of spores of Bacillus anthracis by gamma-711

radiation. Nature 183:475-6. 712 15. Manchee RJ, Watson S. 1991. Inactivation of Vegetative Bacteria and Spores of Bacillus 713

anthracis by Gamma-Irradiation: CBDE Porton Down Technical Note No. 1090. Defence 714 Science and Technology Laboratory (Dstl), Porton Down. 715

16. Spotts Whitney EA, Beatty ME, Taylor TH, Jr., Weyant R, Sobel J, Arduino MJ, Ashford DA. 716 2003. Inactivation of Bacillus anthracis spores. Emerg Infect Dis 9:623-7. 717

17. Dang JL, Heroux K, Kearney J, Arasteh A, Gostomski M, Emanuel PA. 2001. Bacillus spore 718 inactivation methods affect detection assays. Appl Environ Microbiol 67:3665-70. 719

18. Dauphin LA, Newton BR, Rasmussen MV, Meyer RF, Bowen MD. 2008. Gamma Irradiation 720 Can Be Used To Inactivate Bacillus anthracis Spores without Compromising the Sensitivity of 721 Diagnostic Assays. Applied and Environmental Microbiology 74:4427-4433. 722

19. Melly E, Cowan AE, Setlow P. 2002. Studies on the mechanism of killing of Bacillus subtilis 723 spores by hydrogen peroxide. Journal of Applied Microbiology 93:316-325. 724

20. Young SB, Setlow P. 2003. Mechanisms of killing of Bacillus subtilis spores by hypochlorite and 725 chlorine dioxide. Journal of Applied Microbiology 95:54-67. 726

21. Aparecida da Silva Aquino K. 2012. Sterilization by Gamma Irradiation, p 171-206. In Adrovic F 727 (ed), Gamma Radiation doi:10.5772.2054. InTech, Rijeka, Croatia. 728

22. Trampuz A, Piper KE, Steckelberg JM, Patel R. 2006. Effect of gamma irradiation on viability 729 and DNA of Staphylococcus epidermidis and Escherichia coli. J Med Microbiol 55:1271-5. 730

23. Tauxe RV. 2001. Food safety and irradiation: protecting the public from foodborne infections. 731 Emerg Infect Dis 7:516-21. 732

24. Association for the Advancement of Medical Instrumentation. 2011. Sterilization of health care 733 products — Requirements and guidance for selecting a sterility assurance level (SAL) for 734 products labeled “sterile”. AAMI. Arlington, VA. 735

25. Association for the Advancement of Medical Instrumentation. 2006. Sterilization of health care 736 products—Radiation—Part 2: Establishing the sterilization dose. AAMI. Arlington, VA. 737

26. Bowen JE, Manchee RJ, Watson S, Turnbull PC. 1996. Inactivation of Bacillus anthracis 738 vegetative cells and spores by gamma irradiation. Salisbury Med Bull Suppl 87(supp):70-72. 739

27. Parisi AN, Antoine AD. 1975. Characterization of Bacillus pumilus E601 spores after single 740 sublethal gamma irradiation treatments. Appl Microbiol 29:34-9. 741

28. Neely W, Blevins W, Littrell D, Federle S. 1997. Inactivation of Biological Agent Simulants by 742 Gamma Radiation from Cobalt-60. Air Force Material Command, Eglin Air Force Base, FL. 743

29. Broomall SM, Ait Ichou M, Krepps MD, Johnsky LA, Karavis MA, Hubbard KS, Insalaco JM, 744 Betters JL, Redmond BW, Rivers BA, Liem AT, Hill JM, Fochler ET, Roth PA, Rosenzweig CN, 745 Skowronski EW, Gibbons HS. 2016. Whole-Genome Sequencing in Microbial Forensic Analysis 746 of Gamma-Irradiated Microbial Materials. Appl Environ Microbiol 82:596-607. 747

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

35

30. Majidi V. 2015. Review Committee Report: Inadvertent Shipment of Live Bacillus anthracis 748 Spores by DoD. Office of the Secretary of Defense, OASD(NCB), Defense USDo, Washington, 749 DC. 750

31. Akers J, Agalloco J. 1997. Sterility and Sterility Assurance. PDA Journal of Pharmaceutical 751 Science and Technology 51:72-77. 752

32. Herr PR. 2008. United States Postal Service: Information on the Irradiation of Federal Mail in the 753 Washington, D.C. Area. Government Accountability Office, Office GA, Washington, DC. 754

33. Niebuhr SE, Dickson JS. 2003. Destruction of Bacillus anthracis strain Sterne 34F2 spores in 755 postal envelopes by exposure to electron beam irradiation. Letters in Applied Microbiology 756 37:17-20. 757

34. Camp DW, Montgomery NK. 2008. How good labs can get wrong results - keys to accurate and 758 reproducible quantitation of Bacillus anthracis spore sampling or extraction efficiency, abstr 759 Third National Conference on Environmental Sampling and Detection for Bio-Threat Agents, Las 760 Vegas, NV, December 2008. Las Vegas, NV. 761

35. Doyle RJ, Nedjat-Haiem F, Singh JS. 1984. Hydrophobic characteristics of Bacillus spores. 762 Current Microbiology 10:329-332. 763

36. Koshikawa T, Yamazaki M, Yoshimi M, Ogawa S, Yamada A, Watabe K, Torii M. 1989. 764 Surface Hydiophobicity of Spores of Bacillus spp. Journal of General Microbiology 135:2717-765 2722. 766

37. Husmark U, Ronner U. 1990. Forces involved in adhesion of Bacillus cereus spores to solid 767 surfaces under different environmental conditions. J Appl Bacteriol 69:557-62. 768

38. Ronner U, Husmark U, Henriksson A. 1990. Adhesion of Bacillus spores in relation to 769 hydrophobicity. J Appl Bacteriol 69:550-6. 770

39. Faille C, Jullien C, Fontaine F, Bellon-Fontaine MN, Slomianny C, Benezech T. 2002. Adhesion 771 of Bacillus spores and Escherichia coli cells to inert surfaces: role of surface hydrophobicity. Can 772 J Microbiol 48:728-38. 773

40. Charlton S, Moir AJ, Baillie L, Moir A. 1999. Characterization of the exosporium of Bacillus 774 cereus. J Appl Microbiol 87:241-5. 775

41. Buhr TL, Young AA, Minter ZA, Wells CM, McPherson DC, Hooban CL, Johnson CA, Prokop 776 EJ, Crigler JR. 2012. Test method development to evaluate hot, humid air decontamination of 777 materials contaminated with Bacillus anthracis Sterne and B. thuringiensis Al Hakam spores. J 778 Appl Microbiol 113:1037-51. 779

42. Buhr TL, Young AA, Bensman M, Minter ZA, Kennihan NL, Johnson CA, Bohmke MD, 780 Borgers-Klonkowski E, Osborn EB, Avila SD, Theys AM, Jackson PJ. 2016. Hot, humid air 781 decontamination of a C-130 aircraft contaminated with spores of two acrystalliferous Bacillus 782 thuringiensis strains, surrogates for Bacillus anthracis. J Appl Microbiol 120:1074-84. 783

43. Buhr TL, Young AA, Barnette HK, Minter ZA, Kennihan NL, Johnson CA, Bohmke MD, 784 DePaola M, Cora-Lao M, Page MA. 2015. Test methods and response surface models for hot, 785 humid air decontamination of materials contaminated with dirty spores of Bacillus anthracis 786 Sterne and Bacillus thuringiensis Al Hakam. J Appl Microbiol doi:10.1111/jam.12928. 787

44. Buhr TL, Wells CM, Young AA, Minter ZA, Johnson CA, Payne AN, McPherson DC. 2013. 788 Decontamination of materials contaminated with Bacillus anthracis and Bacillus thuringiensis Al 789 Hakam spores using PES-Solid, a solid source of peracetic acid. J Appl Microbiol 115:398-408. 790

45. Titball RW, Manchee RJ. 1987. Factors affecting the germination of spores of Bacillus anthracis. 791 J Appl Bacteriol 62:269-73. 792

46. Prokop EJ, Crigler JR, Wells CM, Young AA, Buhr TL. 2014. Response surface modeling for 793 hot, humid air decontamination of materials contaminated with Bacillus anthracis Sterne and 794 Bacillus thuringiensis Al Hakam spores. AMB Express 4:21. 795

47. Buhr TL, Young AA, Minter ZA, Wells CM, Shegogue DA. 2011. Decontamination of a hard 796 surface contaminated with Bacillus anthracis ΔSterne and B. anthracis Ames spores using 797

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

36

electrochemically generated liquid-phase chlorine dioxide (eClO2). J Appl Microbiol 111:1057-798 64. 799

48. United States Centers for Disease Control and Prevention. August 14, 2017. Revised FSAP 800 Policy Statement: Inactivated Bacillus anthracis and Bacillus cereus Biovar anthracis. 801 https://www.selectagents.gov/policystatement_bacillus.html. Accessed December 12. 802

49. Wang ST, Setlow B, Conlon EM, Lyon JL, Imamura D, Sato T, Setlow P, Losick R, 803 Eichenberger P. 2006. The Forespore Line of Gene Expression in Bacillus subtilis. Journal of 804 Molecular Biology 358:16-37. 805

50. Moeller R, Raguse M, Reitz G, Okayasu R, Li Z, Klein S, Setlow P, Nicholson WL. 2014. 806 Resistance of Bacillus subtilis Spore DNA to Lethal Ionizing Radiation Damage Relies Primarily 807 on Spore Core Components and DNA Repair, with Minor Effects of Oxygen Radical 808 Detoxification. Applied and Environmental Microbiology 80:104-109. 809

51. Kohler LJ, Quirk AV, Welkos SL, Cote CK. 2017. Incorporating germination-induction into 810 decontamination strategies for bacterial spores. J Appl Microbiol doi:10.1111/jam.13600. 811

52. Driks A. 1999. Bacillus subtilis spore coat. Microbiol Mol Biol Rev 63:1-20. 812 53. Osborne JC, Miller JH, Kempner ES. 2000. Molecular mass and volume in radiation target 813

theory. Biophysical Journal 78:1698-1702. 814 54. Levinson HS, Hyatt MT. 1964. Effect of sporulation medium on heat resistance, chemical 815

composition, and germination of Bacillus megaterium spores. Journal of Bacteriology 87:876-816 886. 817

55. Moeller R, Wassmann M, Reitz G, Setlow P. 2011. Effect of radioprotective agents in sporulation 818 medium on Bacillus subtilis spore resistance to hydrogen peroxide, wet heat and germicidal and 819 environmentally relevant UV radiation. Journal of Applied Microbiology 110:1485-1494. 820

56. Buckley P, Rivers B, Katoski S, Kim MH, Kragl FJ, Broomall S, Krepps M, Skowronski EW, 821 Rosenzweig CN, Paikoff S, Emanuel P, Gibbons HS. 2012. Genetic barcodes for improved 822 environmental tracking of an anthrax simulant. Appl Environ Microbiol 78:8272-80. 823

57. Wattam AR, Abraham D, Dalay O, Disz TL, Driscoll T, Gabbard JL, Gillespie JJ, Gough R, Hix 824 D, Kenyon R, Machi D, Mao C, Nordberg EK, Olson R, Overbeek R, Pusch GD, Shukla M, 825 Schulman J, Stevens RL, Sullivan DE, Vonstein V, Warren A, Will R, Wilson MJ, Yoo HS, 826 Zhang C, Zhang Y, Sobral BW. 2014. PATRIC, the bacterial bioinformatics database and 827 analysis resource. Nucleic Acids Res 42:D581-91. 828

58. Passalacqua KD, Varadarajan A, Ondov BD, Okou DT, Zwick ME, Bergman NH. 2009. 829 Structure and complexity of a bacterial transcriptome. J Bacteriol 191:3203-11. 830

59. Passalacqua KD, Varadarajan A, Weist C, Ondov BD, Byrd B, Read TD, Bergman NH. 2012. 831 Strand-specific RNA-seq reveals ordered patterns of sense and antisense transcription in Bacillus 832 anthracis. PLoS One 7:e43350. 833

60. Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR. 1989. Engineering hybrid genes without the 834 use of restriction enzymes: gene splicing by overlap extension. Gene 77:61-8. 835

61. Plaut RD, Stibitz S. 2015. Improvements to a Markerless Allelic Exchange System for Bacillus 836 anthracis. PLoS One 10:e0142758. 837

62. Buhr TL, McPherson DC, Gutting BW. 2008. Analysis of broth-cultured Bacillus atrophaeus and 838 Bacillus cereus spores. J Appl Microbiol 105:1604-13. 839

63. McCartt AD, Gates SD, Jeffries JB, Hanson RK, Joubert LM, Buhr TL. 2011. Response of 840 Bacillus thuringiensis Al Hakam Endospores to Gas Dynamic Heating in aShock Tube. 841 Zeitschrift für Physikalische Chemie 225:1367. 842

64. Stewart GS, Johnstone K, Hagelberg E, Ellar DJ. 1981. Commitment of bacterial spores to 843 germinate. A measure of the trigger reaction. Biochemical Journal 198:101-106. 844

65. Atrih A, Foster SJ. 2001. Analysis of the role of bacterial endospore cortex structure in resistance 845 properties and demonstration of its conservation amongst species. J Appl Microbiol 91:364-72. 846

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

37

66. Kanodia S, Agarwal S, Singh P, Agarwal S, Singh P, Bhatnagar R. 2009. Biochemical 847 characterization of alanine racemase--a spore protein produced by Bacillus anthracis. BMB Rep 848 42:47-52. 849

67. Anthony KG, Strych U, Yeung KR, Shoen CS, Perez O, Krause KL, Cynamon MH, Aristoff PA, 850 Koski RA. 2011. New classes of alanine racemase inhibitors identified by high-throughput 851 screening show antimicrobial activity against Mycobacterium tuberculosis. PLoS One 6:e20374. 852

68. Bodgi L, Canet A, Pujo-Menjouet L, Lesne A, Victor JM, Foray N. 2016. Mathematical models 853 of radiation action on living cells: From the target theory to the modern approaches. A historical 854 and critical review. J Theor Biol 394:93-101. 855

856

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on May 25, 2020 by guest

http://aem.asm

.org/D

ownloaded from