1

Suppression of the Interferon and NF-κB Responses by Severe Fever with 1

Thrombocytopenia Syndrome Virus 2

3

Bingqian Qu1,6, Xian Qi2,6, Xiaodong Wu1, Mifang Liang3, Chuan Li3, Carol J. Cardona4, 4

Wayne Xu5, Fenyang Tang2, Zhifeng Li2, Bing Wu2, Kira Powell4, Marta Wegner4, Dexin 5

Li3, and Zheng Xing1,4 * 6

7

1 The Key Laboratory of Pharmaceutical Biotechnology and Medical School, Nanjing 8

University, Nanjing, China. 9

2 Jiangsu Provincial Center for Disease Prevention and Control, Nanjing, China 10

3 National Institute for Viral Disease Control and Prevention, Chinese Center for 11

Disease Control and Prevention, Beijing, China. 12

4 Veterinary and Biomedical Sciences, University of Minnesota, Twin Cities, 13

St. Paul, MN, USA. 14

5 Supercomputing Institute, University of Minnesota, Twin Cities, Minneapolis, MN, 15

USA. 16

6 These authors contributed equally to this work 17

18

*Corresponding author: Mailing address: 300D Veterinary Science Building, University 19

of Minnesota at Twin Cities, 1971 Commonwealth Avenue, Saint Paul, MN 55108. 20

E-mail: zxing@umn.edu. 21

Tel: (612) 626-5392 Fax: (612) 626-5203 22

Running title: SFTSV Suppresses Interferon and NF-κB Pathway 23

Keywords: Severe Fever with Thrombocytopenia Syndrome Virus, Nonstructural 24

Protein, Nucleoprotein, Interferon, NF-κB 25

Word count: Abstract: 248; text: 5289 (words); 34782 (characters) 26

27

Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Virol. doi:10.1128/JVI.00612-12 JVI Accepts, published online ahead of print on 23 May 2012

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

2

Abstract 28

Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious 29

disease characterized by high fever, thrombocytopenia, multi-organ dysfunction, and a 30

high fatality rate between 12 and 30%. It is caused by SFTS virus (SFTSV), a novel 31

Phlebovirus in family Bunyaviridae. Although the viral pathogenesis remains largely 32

unknown, hemopoietic cells appear to be targeted by the virus. In this study we report 33

that human monocytes were susceptible to SFTSV, which replicated efficiently as shown 34

by an immunofluorescence assay (IFA) and realtime RT-PCR. We examined host 35

responses in the infected cells and found that antiviral interferon (IFN) and IFN-inducible 36

proteins were induced upon infection. However, our data also indicated that 37

downregulation of key molecules such as MAVS or weakened activation of IRF and 38

NFκB responses may contribute to a restricted innate immunity against the infection. NSs, 39

the non-structural protein encoded by the S segment, suppressed the IFN-β and NFκB 40

promoter activities, although NFκB activation appears to facilitate SFTSV replication in 41

human monocytes. NSs was found to be associated with TBK1 and may inhibit the 42

activation of downstream IRF and NFκB signaling through this interaction. Interestingly, 43

we demonstrated that the nucleoprotein (N), also encoded by the S segment, exhibited a 44

suppressive effect on the activation of IFN-β and NFκB signaling as well. Infected 45

monocytes, mainly intact and free of apoptosis, may likely be implicated in persistent 46

viral infection, spreading the virus to the circulation and causing primary viremia. Our 47

findings provide the first evidence in dissecting the host responses in monocytes and 48

understanding viral pathogenesis in humans infected with a novel deadly Bunyavirus. 49

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

3

Introduction 50

Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious 51

disease with a high fatality rate of 12 to 30%, and was initially identified in several 52

provinces of central China in 2007 (59). The disease was characterized by sustained high 53

fever with thrombocytopenia, leukocytopenia, and gastrointestinal symptoms among 54

villagers in rural areas (57). The disease was originally suspected to be human 55

granulocytic anaplasmosis (59) but its causative agent, Anaplasma phagocytophilum, 56

failed to be isolated from clinical samples. Specific nucleotides against Anaplasma 57

phagocytophilum and other known pathogens were not detected in the SFTS patients. It 58

was not until recently that a novel Bunyavirus genome was identified in most patients’ 59

sera and the virus subsequently isolated. The causative agent was named severe fever 60

with thrombocytopenia syndrome virus (SFTSV) (28, 57). One recent study showed an 61

antibody prevalence rate of 3.6% among humans and 46% among animals, indicating that 62

the virus has spread widely in endemic areas (19). 63

In underdeveloped areas of the world viral febrile diseases are often caused by 64

viruses in the families Bunyaviridae, Arenaviridae, Filoviridae, Flaviviridae, and 65

Togaviridae (12). Phylogenetic analysis showed that SFTSV is closely related to viruses 66

of Bunyaviridae. Among the genera Orthobunyavirus, Phlebovirus, Hantavirus, 67

Nairovirus, and Tospovirus of Bunyaviridae, all SFTSV isolates are phylogenetically 68

closest to the genus Phlebovirus (28, 57). Within the phleboviruses, SFTSV is unique for 69

being equidistant from the Sandfly fever group [Rift Valley fever virus (RVFV), Punta 70

Toro virus] and the Uukuniemi group (52), suggesting that SFTSV is a novel virus falling 71

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

4

in a new, third group of this genus. Like RVFV, SFTSV can cause human infections 72

(although ticks, rather than mosquitoes, may be the vector) while Uukuniemi virus is 73

rarely pathogenic to humans (11). 74

Obvious loss of leukocytes is a critical clinical symptom of many hemorrhagic 75

virus infections (12). However, the target cells of SFTSV in peripheral blood have not 76

been determined. It is certain that the virus targets hemopoietic cells, but there have been 77

no studies on viral pathogenesis in SFTS patients, and virus-host interaction is largely 78

unknown. 79

SFTSV is a negative sense, single-stranded RNA virus, composed of three 80

segmented genomes. The segments of L, M, and S encode viral RNA polymerase, 81

glycoproteins (Gn and Gc), nucleoprotein (N), and nonstructural (NSs) proteins, 82

respectively. N and NSs are expressed by separate open reading frames in opposite 83

orientations on the S segment, which has 1744 nucleotides of ambisense RNA. NSs 84

proteins have been found with variable sizes and coding strategies in the genera 85

Bunyavirus, Phlebovirus, and Tospovirus of family Bunyaviridae (5, 6). In the genus 86

Phlebovirus, NSs of RVFV is located in fibrillar structures in the nuclei of infected cells 87

(53), but NSs of Uukuniemi virus is distributed throughout the cytoplasm (39). Studies 88

have shown that NSs of RVFV can target cellular TFIIH transcription factor (25), block 89

interferon production through various mechanisms (4, 41, 46), and contribute to viral 90

pathogenesis (7). However, NSs could control the activity of viral polymerase and 91

suppress viral replication as well (47). While no function is known for NSs in SFTSV, we 92

postulate that it may also play an important role in viral replication and the modulation of 93

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

5

host responses. 94

In this report we show that SFTSV can infect human monocytic THP-1 cells, in 95

which the virus replicated efficiently but no cell death occurred. We examined host 96

responses in the infected cells and found that interferon and NFκB signaling were 97

activated, but our data also demonstrate that viral NSs and N proteins inhibited interferon 98

signaling. While our study indicates that viral NSs and N proteins suppress the NFκB 99

pathway, we found that NFκB signaling facilitates SFTSV replication in human 100

monocytic cells. 101

102

Materials and Methods 103

104

Cells, Viruses and Reagents 105

THP-1 cells were maintained in RPMI-1640 medium (Invitrogen, GIBCO, 106

Carlsbad, CA) supplemented with 10 % fetal bovine serum (Sigma-Aldrich, St. Louis, 107

MO), 1% antibiotic-antimycotic solution (GIBCO), 1 mM sodium pyruvate (Amresco, 108

Solon, OH), 0.1 mM non-essential amino acids (GIBCO), and 55 μM 109

2-mercaptoethanol (Amresco). Human embryonic kidney 293T cells and African 110

green monkey kidney Vero cells were grown in Dulbecco’s modified Eagle’s medium 111

(DMEM, GIBCO) with 8% serum and antibiotics. Cell cultures were incubated at 112

37oC with 5% CO2. SFTSV strain JS-2010-014 (19), isolated from peripheral blood 113

samples of a patient in Jiangsu, China, was propagated in Vero cells in a BSL-3 114

laboratory, Jiangsu Provincial Centers for Disease Control, and used in this study. The 115

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

6

sequences of the viral L, M, S segments have been deposited at GenBank, NCBI; their 116

accession numbers are JQ317169, JQ317170, and JQ317171, respectively. An H9N2 117

avian influenza virus, A/ph/CA/2373/98 (H9N2) (51), was propagated in 10-day-old 118

chicken embryos and later titrated in MDCK cells as described previously (50). All 119

viral aliquots were stored at -80℃. Antibodies for caspase-3, caspase-6, caspase-7, 120

NF-κB, TBK1, MAVS, MyD88, phosphor-p65, phospho-NFκB2, and anti-IκB-α 121

antibodies were purchased from Cell Signaling Technology (Danvers, MA). Anti-pro- 122

caspase-3, MDA5, and anti-β-actin antibodies were obtained from Santa Cruz 123

Biotechnology (Santa Cruz Biotechnology, CA). Anti-Flag M2 antibody was obtained 124

from Sigma-Aldrich. NF-κB and IκB kinase (IKK) inhibitors, 6-Amino-4- 125

(4-phenoxyphenylethylamino)quinazoline (Cat. 481406) and Wedelolactone (Cat. 126

401474), respectively, were supplied by EMD Chemicals (Gibbstown, NJ). 127

128

Quantitative Real-time PCR 129

1 μg total RNA extracted from SFTSV- or mock-infected cells with an RNeasy kit 130

(Qiagen, Hilden, Germany) was used for reverse transcription using a Primescript reagent 131

kit (TAKARA, Shiga, Japan). Quantitative real-time PCR was performed with SYBR 132

Premix Ex Taq II (TAKARA) following the manufacturer’s instructions. Relative gene 133

expressions were standardized by a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) 134

control. Fold change was calculated according to the formula: 2(ΔCt of gene - ΔCt of GAPDH) (50). 135

For SFTSV S gene, the standard curve was performed with a plasmid containing 136

full-length nucleotides of S gene following a protocol described previously (29). 137

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

7

138

NSs and N cDNA cloning and expression 139

Full length of the S segment cDNA of the SFTSV virus was synthesized by PCR 140

from the reverse transcription product as described above with specific primers. NSs and 141

N were amplified by PCR procedures and then subcloned into a plasmid pRK5 with 142

either a flag or HA tag for mammalian expression under a CMV promoter. HEK293 cells 143

were transfected with pRK5-NSs or pRK5-N with Lipofactamine 2000 reagents 144

(Invitrogen) for expression of NSs and N proteins. 145

146

Immunoblot Analysis and immunoprecipitation 147

Mock- or SFTSV-infected THP-1 cells were treated with pre-cooled 1% NP-40 148

lysis buffer containing 2 mM phenylmethylsulfonyl fluoride (PMSF), 2 mM NaF, 1 mM 149

Na3VO4, 1 μg/ml leupeptin and 1 μg/ml aprotinin (Sigma-Aldrich) for 20 min on ice. 150

After low speed centrifugation (2500 × rpm, 5 min at 4℃), cell lysates were measured 151

with a BCA assay (Pierce, Rockford, IL) before being subjected to SDS-PAGE and 152

transferred to Immuno-blot PVDF membrane (Millipore, Billerica, MA), followed by 153

incubation with primary antibodies overnight. After four washes, membranes were 154

incubated with alkaline phosphatase (AP)- or horseradish peroxidase (HRP)-conjugated 155

secondary antibodies for another 90 min incubation. After washes, BCIP/NBT or ECL 156

reagents (Invitrogen) were used for signal development. β-actin levels were detected as 157

an input control. 158

Cell lysates, prepared as described above, were pre-treated with isotype mouse 159

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

8

IgG and then protein A/G agarose beads. The pre-treated supernatants were incubated 160

with the anti-Flag antibody at 4oC overnight and incubated with protein A/G agarose 161

beads at 4oC for 90 min. After four washes with NP-40 lysis buffer, the 162

immunoprecipitates were denatured and subject to SDS-PAGE and western blot analyses. 163

164

Dual-luciferase Report Assay 165

HEK 293T cells were seeded in 24-well plates at a density of 2.5×105 cells per 166

well. The next day, cells were transfected with pRK5 control plasmid or the plasmids 167

expressing NSs or N along with pGL3-IFNβ-Luc or pGL3-Igκ-Luc, and pRL8-SV40 168

using Lipofectamine 2000. The total amount of DNA was kept constant by adding empty 169

control plasmid. At 24 hrs after transfection, the cells were stimulated by 50 μg/ml poly 170

(I:C) or infected with the avian influenza virus H9N2 for 6 hrs, and cell lysates were used 171

to determine Firefly and Renilla luciferase activities (Promega, Madison, WI) according 172

to the manufacturer’s instructions. 173

174

Microarray and pathway analysis 175

Total RNAs prepared from samples at each time point after infection were pooled 176

in equivalent amounts and subjected to microarray analyses. For all microarray 177

experiments, cyanine 3-CTP-labeled cRNA probes were generated from 1 μg total RNA 178

following Agilent’s One-Color Microarray-based Gene Expression Analysis (Quick Amp 179

Labeling). Human 4x44K slides (Agilent) were used for hybridization, followed by 180

scanning with Agilent scanner (G2565BA). Each microarray experiment was performed 181

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

9

with technical duplicates for infected or uninfected control samples. Changes in the level 182

of mRNA of any gene were marked significant only when the following two criteria were 183

met: (i) the alteration in expression was statistically significant (P value for paired 184

Student's t-test of ≤0.05); and (ii) the change was at least 50% (equivalent to a 1.5-fold 185

change where the value for no change is 0) above or below the baseline expression level. 186

The baseline was calculated as the expression level of the 0 hr (uninfected control) for a 187

particular gene. Gene transcription data, which have been sent to GenBank for deposition, 188

were further analyzed with Genedata Expressionist (www.genedata.com) for differential 189

expression and heatmap construction. Differential gene expression data were uploaded 190

into Ingenuity systems (Ingenuity, Redwood City, CA) for pathway and functional 191

analyses. 192

193

Indirect immunofluorescence assay and virus titration 194

THP-1 cells, mock-infected or infected with SFTSV (JS-2010-014), were fixed at 195

various time points with 4% paraformaldehyde for 30 min. The cells were permeablized 196

with 0.1% Triton X-100 on ice for 10 min, followed by three washes with PBS. The cells 197

were then incubated with an anti-SFTSV serum collected from a patient (19), who was 198

confirmed clinically and serologically, at 1:100 dilution at 4oC overnight or 37oC for 30 199

min. After washes with PBS, cells were incubated with FITC-conjugated goat anti-human 200

IgG (H+L) (Beyotime, Hangzhou, China) at 1:200 dilution at 37oC for 1 hr and stained 201

with 1 μg/ml DAPI at room temperature for 5 min. Cells were washed and re-suspended 202

by PBS, smeared on a glass slide, and observed under an Olympus confocal microscope. 203

Cell media were collected at various times points from THP-1 cells infected with the 204

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

10

virus for infectious virus titration (TCID50). 10-fold serial dilutions were performed with 205

DMEM to dilute the cultural media, which were used to inoculate Vero cells in 12-well 206

plates. The cells were transferred to glass cover slides 18 or 18 hrs p.i., air-dried, fixed 207

and permeablized with 4% paraformaldehyde and 0.1% Triton X-100, followed by 208

staining with anti-SFTSV serum and FITC-conjugated secondary antibody as described 209

above. Infectious virus titers (TCID50/ml) were calculated based on the Reed and Muench 210

method. 211

212

Statistical Analysis 213

A two-tailed Student’s t-test was used to evaluate the data by SPSS software (IBM 214

SPSS, Armonk, NY). An χ2 analysis was used to calculate significant differences of the 215

data, with the 0.05 level of probability considered as a significant deviation. 216

217

Results 218

219

SFTSV replicates in human monocytes without inducing apoptosis 220

SFTSV appears to target human hemopoietic cells, but its exact target cells are 221

unclear. In order to determine whether SFTSV infects and replicates in human monocytes, 222

SFTSV isolated from a patient’s peripheral blood of febrile phase and propagated in Vero 223

cells was used to infect human THP-1 cells. No obvious cytopathic effect (CPE) was 224

observed at 18 and 38 hrs post-infection (p.i.). However, monocytes appeared to respond 225

to the infection as shown in Figure 1A, where THP-1 cells adhered to the culture dish and 226

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

11

extended their pseudopodia after 18 hrs, in contrast to the cells in the mock control. 227

To examine viral antigen expression in infected cells, we performed IFA and 228

stained the infected THP-1 cells, which were fixed at different times p.i., with a diluted 229

human anti-SFTSV serum. Infected monocytes were stained positively at 18 or 28 hrs p.i. 230

as shown in Figure 1B. Through the course of infection we quantified the percentage of 231

the THP-1 cells that were positive in IFA, and found that within the initial 8 hrs p.i. only 232

10% of the cell were positive. The numbers of the positive cells rose to 30% and 50% at 233

24 and 48 hrs, respectively, when the cells were infected with 0.1 multiplicity of infection 234

(m.o.i.) (Figure 1C). The culture media of the infected THP-1 cells were also used to 235

inoculate Vero cells, which were examined later by IFA. Characteristic viral antigen 236

staining was exhibited in infected Vero cells (Figure 1D), and the infection of Vero cells 237

was used thereafter for infectious virus titration (TCID50). 238

To measure viral replication in THP-1 cells, culture media of the cells infected 239

with SFTSV at 1 or 0.1 m.o.i., respectively, were taken at 8, 18, and 28 hrs p.i. for 240

infectious virus titration in Vero cells, then examined by IFA. The results indicated that 241

viral titers in the media of infected THP-1 cells reached up to 105 TCID50/ml at 28 hrs p.i. 242

when infected with either 1 or 0.1 m.o.i. (Figure 2A). To further confirm a successful 243

infection and viral replication, we extracted total RNA from the cells at various time 244

points p.i. and measured viral S gene copies by real-time RT-PCR. As early as 8 hrs p.i., 245

we detected S gene copies of 5.1×103 in 1 μl cDNA, and the copy numbers increased to 246

6.2×104 and 1.9×105 at 18 and 28 hrs p.i., respectively (Figure 2B), indicating that the 247

virus replicated in monocytes. The oligonucleotide primers specific for viral S gene as 248

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

12

well as cellular genes used in this study are listed in Table 1. 249

Intact morphology of infected cells during the course of infection suggests that no 250

cell death or apoptosis was induced. To confirm that no apoptosis was initiated, we 251

analyzed lysates of SFTSV-infected cells at 3, 6, 9, 12, 24, and 36 hrs p.i. for 252

pro-caspase-3 and cleaved caspase-3 protein levels. The results showed that the level of 253

pro-caspase-3 was not decreased and the cleaved form of caspase-3 was not detected, 254

indicating that no apoptosis was induced by SFTSV infection in monocytes (Figure 2C), 255

unlike the control cells treated with etoposide (10 μM), in which cleaved caspase-3 was 256

detected at various time points post treatment (Figure 2D). 257

258

SFTSV induces attenuated innate immune responses 259

To examine how host anti-viral responses are induced during infection, we 260

measured mRNA transcripts of interferons (IFN), IFN-inducible myxovirus resistance 1 261

(MX1), and 2’,5’-oligoadenylate synthetase 1 (OAS1) in THP-1 cells infected with the 262

virus at ~1 m.o.i. Mild induction of IFN-β mRNA transcripts was detected up to 8- and 263

22-fold at 8 and 28 hrs p.i. (Figure 3A). We observed a moderate increase of antiviral 264

MX1 and OAS1, which rose up to 40- and 30-fold, respectively. These data demonstrate 265

that antiviral host responses were mounted but the levels were moderate in 266

SFTSV-infected monocytes, suggesting that the responses may be somehow restrained. 267

We also measured the transcripts of MDA-5, the member of RIG-I-like receptors (RLR) 268

involved in IFN responses and innate immunity, and found that its level increased starting 269

8 hrs p.i., while MyD88 remained unchanged in monocytes (Figure 3B and 3C). 270

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

13

To broaden our understanding of how monocytes react in antiviral responses to 271

SFTSV, we analyzed the regulation of interferon inducible proteins with Agilent 272

expression microarrays. As shown in Figure 4A, 4B, and Table 2, the induction of 273

antiviral MX1 and OAS1 in addition to MDA-1 (IFIH1), and another RLR member, 274

RIG-I (DDX58), was confirmed. More IFN-inducible proteins were detected upregulated, 275

including IFI35, IFI44, IFI44L, IFI6, IFIT1, IFIT3, IFIT5, IFITM1, IRF1, IRF9, ISG15, 276

MX2, and OAS2. Some of these have recently been confirmed to be antiviral (38). Some 277

inducible proteins have important roles in positive feedback of IFN responses, such as 278

STAT1 and STAT2, while others such as SOCS1 may provide a negative feedback signal 279

(44)(31). Pim1, a serine/threonine kinase, may be another IFN-inducible protein 280

upregulated during SFTSV infection. Additionally, a few IFN-inducible proteins seemed 281

to be involved in initiating or regulating adaptive immunity, including CD274 (10), TAP1 282

(2), and proteasome subunit beta type-8 (PSMB8). Adding to the complexity of the role 283

of IFN-inducible proteins, adenosine deaminase acting on RNA (ADAR) was moderately 284

upregulated, and it has recently been shown to be an enhancer for viral replication (38). 285

Nevertheless, induction of SERPING1 (8, 24), a complement C1 esterase inhibitor, may 286

have an effect on viral pathogenesis since its main function is the inhibition of the 287

complement system. 288

The levels of IFN-β (IFNB) transcripts were also induced, albeit only marginally 289

(2.28-fold) at 8 hrs p.i. (Table 3), and rose to 12.36- and 31.96-fold at later stages of 290

infection, which is in accordance with our realtime RT-PCR results (Figure 3A). 291

292

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

14

Regulation of IRF and NFkB signaling in SFTSV-infected monocytes 293

To explore the mechanism by which interferon signaling pathways were 294

upregulated, we further analyzed the data obtained from the Agilent microarray analysis. 295

Induction of IFN is regulated by IRF3/7 and NFκB signaling pathways. As shown in 296

Figure 4 and Table 3, among those with significant fold changes during the infection are 297

transcription factors (TF) involved in IFN induction and NFκB signaling, including 298

NF-κB1 (3.24 to 3.84), NF-κB2 (5.68 to 6.52), IRF7 (5.10 to 9.20), Jun (4.82 to 5.57), 299

and JunB (2.54 to 3.51), but IRF3 (0.82 to 1.00) and RELA (RelA, 0.81 to 1.08) were 300

unchanged. Activating kinase IKBKB (IKKβ, 0.68 to 1.00) remained unchanged while 301

IKBKE (IKKε, 3.57 to 4.22) was upregulated up to 4- fold, binding to TANK-binding 302

kinase 1 (TBK1, 1.27 to 1.39), to form a complex (34) important in the activation of both 303

IFN (IRF3/7) and non-canonical NFκB signaling. On the other hand, the inhibitors of 304

NFκB signaling, IκBα (NFKBIA, 7.10 to 7.18) and IκBβ (NFKBIB, 1.86 to 2.72), both 305

I-kappa-B inhibitor proteins, were upregulated, as were the levels of NFKBIE (2.18 to 306

2.35) and NFKBIZ (7.42 to 8.64), which inhibit NFkB signaling (54). Although RIG-I 307

(DDX58, 7.71 to 23.71) and MDA-5 (IFIH1, 6.80 to 11.77) were both upregulated, 308

MAVS (IPS-1, 0.84 to 0.46), a key player on mitochondria membrane transmitting RIG-I 309

and MDA-5 signaling, was downregulated. While multiple players were either up- or 310

downregulated, IFN signaling was activated and IFN-β was induced, leading to the 311

induction of many IFN-inducible proteins. Likewise, NFκB signaling was evidently 312

activated in increased transcription of the target genes such as TNFSF10 (TRAIL), IL-6, 313

and IFN, as well as RIG-1 and MDA-5, albeit the increased transcription of a number of 314

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

15

inhibitory factors to NFκB signaling was also demonstrated. 315

In addition, we observed that the levels of MAVS, RIPK1, TRAF3, TRAF6, and 316

Rel A, which play important roles in RIG-like receptor and toll-like receptor pathways, 317

were unchanged or even downregulated in SFTSV-infected monocytes (Figure 4B and 318

Table 3), suggesting that increased IFN and NFκB signaling could be negatively affected 319

in SFTSV infection, especially when the inhibitors from the host cells, such as NFKBIA, 320

NFKBIAE and NFKBIZ, or the virus, were upregulated or produced. 321

322

Pathway analysis in SFTSV-infected human monocytes 323

We next used the Ingenuity Pathway Analysis (IPA) platform to analyze the 324

networking and biological functions of those genes which were associated with the NFκB 325

signaling pathway. As shown in Figure 5, NFκB was activated in both canonical and 326

non-canonical ways, and upregulated TLR, TNFα, growth factors, and BAFF activated 327

these pathways through similarly upregulated MyD88, Ras, CD40, and TRAF2/3/5/6, 328

respectively. Also upregulated were NFκB1 and NFκB2, which are processed to become 329

p50 or p52 and translocated into the nucleus after binding to RelA (p65) and RelB. 330

However, a number of proteins were downregulated, including those in the 331

phosphotidylinositol 3 kinase (PI3K) pathway. These include PI3K and Akt, along with 332

upregulated A20, a strong suppressor of TRAF6, and IκB, the suppressor of NFκB. These 333

upregulated inhibitors may suggest that NFκB signaling was in fact attenuated or 334

suppressed to a certain degree as a negative feedback mechanism during the infection of 335

monocytes. 336

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

16

As for interferon signaling (Figure 6), at the earlier stage of infection, MAVS 337

(IPS-1) was activated by RIG-I and MDA-5, which were further induced. Another 338

member of RLR family, LGP2, was also upregulated, along with FADD, both of which 339

activated MAVS. Induced downstream kinases and regulators included IKKγ, CYPB, 340

TANK, and IRF7, and were critical to IRF3/7 pathway activation, leading to the 341

induction of IFN and inflammatory cytokines (Figure 6). However, downregulation of 342

MAVS from 18 hrs p.i., which was also negatively regulated by upregulated 343

IFN-inducible ISG15 as a negative feedback, may restrain further induction of IFN at 344

later stages of infection. 345

346

NSs and N protein suppress IFN-β promoter activation 347

To assess whether viral proteins are involved in the modulation of host responses, 348

we cloned cDNAs of viral non-structural protein (NSs) and nucleoprotein (N), both 349

encoded by the S segment. The cDNAs were subcloned into an expression vector, pRK5, 350

respectively, and NSs (38 kd) and N (31 kd) proteins were expressed in HEK293 cells 351

(Figure 7A). We examined whether these viral proteins have any effect on host responses. 352

First, we investigated whether NSs affects the IFN-β promoter activation. IFN-β 353

promoter activity was determined by a dual-luciferase reporter assay. HEK293T cells 354

were co-transfected with the reporter plasmids, along with pRK5-Flag-NSs or a control 355

plasmid, respectively. At 24 hrs post-transfection, cells were stimulated with 50 μg/ml 356

synthetic poly (I:C) dsRNA or the avian influenza virus H9N2 at 0.5 m.o.i. Cell lysates 357

were prepared at 6 hrs after stimulation and analyzed for luciferase activities. Our results 358

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

17

demonstrated that while either poly (I:C) or influenza virus infection enhanced relative 359

luciferase units (RLU) and activation fold of IFN-β promoter activity up to 40- to 60-fold, 360

NSs protein significantly reduced IFN-β promoter activity down to 20% of the original 361

level. We also tested viral nucleoprotein (N). To our surprise, when the cells were 362

transfected with pRK5-Flag-N, N protein suppressed IFN-β promoter activities, induced 363

by either poly (I:C) or the influenza virus infection, down to 20% level as well (Figure 364

7B and 7C). 365

366

NF-κB signaling is suppressed by NSs and N proteins 367

We next examined whether NSs and N proteins could also suppress NFκB 368

activation. A reporter assay was performed to measure Igκ light chain promoter activity 369

with a plasmid, pLuc-Igκ, which is composed of the responsive elements to activated 370

NF-κB signaling. NSs protein suppressed Igκ promoter activity down to 25% of the basal 371

level in response to poly (I:C) stimulation and down to 16% of the basal level in response 372

to the influenza virus infection in transfected HEK293T cells. Similarly, transfected N 373

protein reduced NF-κB activity down to 60% of the basal level in response to poly (I:C) 374

and down to 35% of the basal level in response to the influenza virus infection (Figure 8A 375

and 8B). These data indicate that viral NSs and N proteins may suppress NFκB activation 376

and its target gene expressions in SFTSV infected monocytes. We also measured 377

expression of a few NFκB target genes including FasL and found no induction, which 378

may be attributed to suppressed NFkB signaling through viral proteins during the 379

infection (Figure 8C). 380

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

18

381

Attenuated NF-κB responses in SFTSV-infected human monocytes 382

To further understand the mechanism by which NSs may suppress IRF and NFkB 383

responses, we began by searching cellular proteins critical in innate immunity, IRF, and 384

NFkB signaling pathways, which may interact with NSs. We transfected HEK293 cells 385

with pRK5-Flag-NSs, and then used the cell lysates for coimmunoprecipitation (Co-IP) 386

with anti-Flag antibodies and western blot analyses with antibodies specific for a number 387

of cellular proteins. Among the proteins that were positive in Co-IP, TANK-binding 388

kinase 1 (TBK1), which is important in activating IRF and NFkB signaling pathways, 389

was found to be associated with NSs (Figure 9A). 390

As discussed earlier, SFTSV infection markedly increased the expression levels of 391

both NF-κB1 and NFκB2 (Table 3), albeit suppressive effects by NSs and N were found 392

also in this study. NFκB activation was evident as demonstrated in cell lysates prepared 393

from various time points p.i. with western blot analyses. Increased phosphorylation of 394

NFκB p65 (RelA) and NFκB2 were both observed (Figure 9B), even though the 395

expression level of p65 (RelA) remained unchanged (Table 3). However, these 396

activations appeared to be transient since the levels of both phosphorylated NFκB p65 397

and NFκB2 decreased at a later stage of infection. The transient activation of NFκB was 398

mirrored by the degradation of IκBα, which was also transiently reduced in the middle of 399

the infection, a sign of elevated NFκB activation. However, the levels of IκB bounced 400

back at a later stage of infection (Figure 9B). This indicates that the activation of NFκB 401

signaling may indeed be transient and could be somewhat attenuated later in the infection. 402

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

19

Increased expression of the inhibitors such as IκBα, including NFKBIA, NFKBIB, 403

NFKBIE, and NFKBIZ, and reduced levels of MAVS, may contribute to decreased 404

activation of NFκB. A significant increase of TNFα-induced protein 3 (TNFAIP3) (33), 405

20.74- to 23.18- fold at 8 and 28 hrs p.i., respectively, as shown in Table 2, could be a 406

contributing factor as well, since this is an important protein capable of terminating 407

TNF-induced NFκB responses by binding to TRAF2/6 (16, 40) and IKKγ (60). NFκB 408

responses will be further decreased by viral NSs and N protein when the virus replicates 409

efficiently in the cell. 410

411

NFκB signaling facilitates SFTSV replication 412

THP-1 cells, pre-treated with inhibitors of NF-κB (100nM) and IKKαβ (10 μM) 413

for 1 hr prior to infection, were infected with SFTSV. While no obvious toxicity was 414

observed in the cells treated with either NF-κB or IKK inhibitor, the S gene copies were 415

significantly reduced in the cells treated with specific inhibitor of NF-κB (Figure 9C). 416

Infectious virus titration also confirmed that viral titers in NFκB inhibitor-treated THP-1 417

cultures were significantly lower than those in non-treated cells (Figure 9D), suggesting 418

that NF-κB is critical to virus replication. 419

420

Discussion 421

As a newly emerging infectious disease, SFTS poses a serious public health 422

concern because it causes high mortality and its transmission routes are not entirely clear. 423

Most phleboviruses and arboviruses are transmitted by mosquitoes, ticks, and 424

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

20

phlebotomine sandflies (37). SFTSV has been isolated in ticks, and vector-borne 425

transmission appears to be responsible for most cases. But recent studies also indicate 426

that SFTS may be transmitted from human-to-human, and body fluids from patients 427

contain high titers of infectious viruses (3). The most common clinical symptoms in 428

patients are fever (100%), thrombocytopenia (95%), and leukocytopenia (86%)(57). 429

However, details about the viral pathogenesis are largely unknown. Our data demonstrate 430

that human monocytes are susceptible to SFTSV, which replicates efficiently during the 431

first few days of infection. Since the infected monocytes remain intact, these cells may 432

also support persistent viral infection. SFTSV is capable of replicating in many cell types, 433

but usually no cell death is observed (58), which is similar to many other bunyaviruses 434

such as Hantaan virus. Apoptosis may be sufficiently suppressed in the infected cells, but 435

the mechanisms are unknown. It is important to note that SFTSV replicates in monocytes, 436

which may be implicated in viral pathogenesis, especially when the cells remain intact 437

during the initial days of infection. Resident or trafficking monocytes can transport the 438

virus through lymphatic drainage to regional lymph nodes and then spread into the 439

circulation and cause primary viremia. We are exploring whether other types of 440

hemopoietic cells are also susceptible to SFSTV. 441

Production of type I IFNs is one of the defense mechanisms of the host innate 442

immune system against virus infection (21, 42). IFN signaling is initiated by toll-like 443

(TLR) and RIG-like (RLR) receptors, and IFN mRNA induction is controlled by 444

transcription factors, including NF-κB, IRF3, IRF7, and c-Jun (AP-1) (21, 43, 56). 445

Clinically, there were almost no detectable levels of IFN observed in patients’ blood 446

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

21

serum (28), indicating that IFN production may be suppressed, especially at the later 447

stage of the infection, although IFN induction could be transient and its level may be 448

detectable earlier. In this study we explored how this suppression may occur in infected 449

monocytes, and found that some mechanism may explain disregulation of IFN induction 450

in patients. For example, during the infection in monocytes, IFN and relevant 451

transcription factors were moderately upregulated at transcription level due to the 452

activation of IRF and NFκB responses. However, several upstream molecules, including 453

MAVS, TRAF6, TRAF3, were unchanged or downregulated. These molecules are critical 454

in TLR/RLR signaling and/or important in the activation of IRF3/7 or NFκB pathways, 455

essential for IFN induction. While NFκB1 and NFκB2 were both upregulated, the 456

inhibitors of NFKB, such as NFKBIA (IκBα), NFKB IB, and NFKBIZ, were also 457

upregulated, which suppressed the activation of NFκB directly. Our data also 458

demonstrated that the activation of p65 (RelA) and NFκB2 appeared to be transient, 459

which matched the increased level of IκBα during the late stage of infection (Figure 9B). 460

Activation of NFκB could also be attenuated upstream by TNFAIP3 (Table 3) and ISG15 461

(Table 2; Figure 6), which were all upregulated and acted in a negative feedback manner. 462

Our data further demonstrated that the non-structural protein, NSs of SFTSV, 463

might be implicated in the suppression of the IFN induction as shown in a reporter assay. 464

IFN-β promoter activity induced by either an avian influenza virus infection or poly I:C 465

was efficiently suppressed by ectopically expressed NSs in vitro. Many viruses evolve to 466

encode specific components that counteract IFN induction to evade host anti-viral 467

responses. Well-known IFN antagonists are the NS1 protein of influenza A virus, the 468

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

22

NS3-4A protein of hepatitis C virus, the V protein of paramyxoviruses, the P protein of 469

rabies virus, the M protein of vesicular stomatitis virus, the G1 protein of, the VP35 470

protein of Ebola virus, and the proteases of picornaviruses (48). Two NSs protein of 471

bunyaviruses, including Bunyamwera of orthobunyaviruses and RVFV of phleboviruses, 472

are also shown to be effective suppressors of IFN induction (4, 20, 45). On the other hand, 473

due to significant sequence differences, NSs of different bunyaviruses appear to function 474

with different mechanisms. Our finding showed that NSs of SFTSV interacted with 475

TBK1, a homolog of IKKε, critical in the activation of IRF and NFκB pathways. Studies 476

are underway to characterize how this interaction, unique among NSs proteins of 477

bunyaviruses, may affect the function of TBK1 and its subsequent activation of the 478

downstream pathways. 479

Suppression of host protein synthesis has been considered the main mechanism 480

for NSs to inhibit IFN induction (27). However, since no inhibitory effect on the 481

activation of PKR (41), IRF2, NFκB, and AP1 (4) was found, NSs was considered to 482

inhibit transcriptional mechanism at the terminal end, which would show no specificity. 483

But NSs of RVFV can bind to SAP30 in the nucleus to form an inhibitory complex, 484

which is bound to, and specifically inhibits, the promoter region of IFN-β (26). Recently 485

it has been shown that NSs of RVFV can suppress IFN production by targeting the 486

upstream component of the signaling pathway, in this case, PKR, which is specific (14, 487

17, 18). NSs of another Phlebovirus, Sandfly Fever Sicillian Virus, and the 488

Orthobunyavirus La Cross Virus, do not have this function. 489

Surprisingly, we found that N protein of SFTSV also exhibited a suppressive 490

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

23

capacity on IFN-β promoter activity. Like other helical RNA viruses, nucleoprotein (N) 491

encapsidates the segmented or non-segmented RNA genomes (36). Unexpected 492

antagonism of N proteins to host IFN induction in viral infections is an intriguing 493

phenomenon and a recent focus of intensive study; it has been found that N proteins of 494

SARS-CoV and mouse hepatitis coronavirus antagonized IFN responses (30, 55). N 495

protein of Lassa virus, a member of Arenaviridae, also exhibits strong suppression of host 496

cytokine responses including IFNs (35). Mechanisms of the IFN suppression are variable 497

and in many cases unknown. But it is interesting that the suppression of wide host 498

cytokine responses by N protein of Lassa virus is dependent on its intrinsic ribonuclease 499

activity, which cleaves viral RNA and blunts the activation of RIG-I signaling (35). Here, 500

we expand our view and propose that the N protein of a Bunyavirus also has potential to 501

inhibit IFN responses, although the mechanism is currently unclear. 502

An obvious dilemma presented by our research is that an apparent IFN induction 503

occurred in THP-1 cells after infection and IFN-inducible genes were produced, even 504

though NSs and nucleoproteins were shown to be suppressive. A reasonable explanation 505

would be that the suppression of IFN and NFκB responses by NSs and nucleoprotein is 506

complete in the infected human monocytes. However, the presence of a large portion of 507

the THP-1 cells that remained negative in viral antigens detected by IFA (Figure 1C) 508

indicates that these cells were uninfected, or infected at a very early stage with the 509

expression of NSs or N protein at very low levels. Thus, this portion of the cells was in 510

fact stimulated in response to signaling from the infected cells, and contributed to 511

upregulated IFN and NFκB responses. Since we did not have specific antibodies to viral 512

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

24

N and NSs proteins at this stage and were unable to detect expression levels of these viral 513

proteins during infection, it was difficult for us to measure how efficiently NSs or 514

nucleoprotein suppressed IFN or NFkB responses in infected cells. We believe that this 515

issue could be appropriately addressed when mutant viruses are generated and used to 516

study this phenomenon. 517

NF-κB signaling is critical to host proinflammatory, apoptotic, and antiviral 518

responses in viral infection. We observed that both NF-κB1 and NFκB2 were upregulated, 519

in addition to IKKε (Table 3), an NFκB-activating kinase in a non-canonical pathway. 520

Increased phosphorylation of p65 (RelA) and NFκB2 at the early stage of infection 521

indicates the activation of NF-κB signaling (Figure 9B). Despite transcriptional 522

upregualtion of IKK including IKKγ and IKKε, we failed to detect the activation of 523

IKKα/β (data not shown), suggesting that NFκB signaling may be activated through 524

other mechanisms, such as activating TBK1/TRIF through TLR signaling. Our data also 525

indicate that the activation of NFκB may be transient, as discussed above. Obviously, 526

regulation of NFκB signaling and its target genes is complicated in SFTSV-infected 527

monocytes. At a molecular level, we also observed that NSs of SFTSV was suppressive 528

to the NFκB target activation as shown in a luciferase assay, in which the NFκB promoter 529

activity, induced by either the avian influenza virus infection or poly I:C stimulation, was 530

inhibited (35). Interestingly, we also found that the N protein of SFTSV possesses the 531

inhibitory effect on NFκB promoter activity as well. NFκB signaling appears to be an 532

attractive target for many viruses (9, 15). Suppression of the NFκB pathway in SFTSV 533

infection may contribute to its restrictive host antiviral responses, including IFN 534

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

25

induction and unchanged pro-apoptotic FasL expression, which may extend host cell 535

survival and benefit the virus in replicating. 536

It is also interesting to note that NFκB signaling promotes the viral replication as 537

shown in SFTSV-infected monocytes in our study. Although we have no data yet to 538

explain the mechanism, NFκB is required for efficient replication of other viruses (such 539

as influenza A viruses), probably through its involvement in vRNA synthesis, but not the 540

corresponding cRNA or mRNA synthesis (23). Restrained NFκB signaling in infected 541

monocytes may reduce SFTSV viral load, likely contributing to persistent viral infection 542

at lower levels both in vitro and in infected tissues. We speculate that infected cells will 543

eventually be targeted by specific CD8+ T cells, and that free viruses will be cleared by 544

neutralizing antibodies if the patient survives. More study is needed to ascertain the 545

molecular events involved in viral pathogenesis, which will provide in-depth 546

understanding of the disease and ideas for therapeutic and preventive strategies for this 547

fatal emerging disease. 548

549

550

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

26

Acknowledgements 551

552

This work was supported by the National Natural Science Foundation of China 553

(NSFC 30971450 grant) and the State Key Laboratory of Pharmaceutical Biotechnology 554

of Nanjing University (KFGW-200902 grant) to Z.X, and the Jiangsu Province Key 555

Medical Talent Foundation (RC2011084) and the “333” Projects of Jiangsu Province to 556

XQ. Z.X. was supported by a Grant-in-Aid from University of Minnesota at Twin Cities. 557

We thank Sandy Shanks for her expertise in editing the manuscript. 558

559

560

561

562 on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

27

References 563

564

1. Bachmann, M., and T. Moroy. 2005. The serine/threonine kinase Pim-1. Int J 565

Biochem Cell Biol 37:726-30. 566

2. Bahram, S., D. Arnold, M. Bresnahan, J. L. Strominger, and T. Spies. 1991. 567

Two putative subunits of a peptide pump encoded in the human major 568

histocompatibility complex class II region. Proc Natl Acad Sci U S A 88:10094-8. 569

3. Bao, C. J., X. L. Guo, X. Qi, J. L. Hu, M. H. Zhou, J. K. Varma, L. B. Cui, H. 570

T. Yang, Y. J. Jiao, J. D. Klena, L. X. Li, W. Y. Tao, X. Li, Y. Chen, Z. Zhu, K. 571

Xu, A. H. Shen, T. Wu, H. Y. Peng, Z. F. Li, J. Shan, Z. Y. Shi, and H. Wang. 572

A Family Cluster of Infections by a Newly Recognized Bunyavirus in Eastern 573

China, 2007: Further Evidence of Person-to-Person Transmission. Clin Infect Dis 574

53:1208-14. 575

4. Billecocq, A., M. Spiegel, P. Vialat, A. Kohl, F. Weber, M. Bouloy, and O. 576

Haller. 2004. NSs protein of Rift Valley fever virus blocks interferon production 577

by inhibiting host gene transcription. J Virol 78:9798-806. 578

5. Bishop, D. H. 1986. Ambisense RNA genomes of arenaviruses and phleboviruses. 579

Adv Virus Res 31:1-51. 580

6. Bishop, D. H. 1986. Ambisense RNA viruses: positive and negative polarities 581

combined in RNA virus genomes. Microbiol Sci 3:183-7. 582

7. Bridgen, A., F. Weber, J. K. Fazakerley, and R. M. Elliott. 2001. Bunyamwera 583

bunyavirus nonstructural protein NSs is a nonessential gene product that 584

contributes to viral pathogenesis. Proc Natl Acad Sci U S A 98:664-9. 585

8. Cicardi, M., L. Zingale, A. Zanichelli, E. Pappalardo, and B. Cicardi. 2005. 586

C1 inhibitor: molecular and clinical aspects. Springer Semin Immunopathol 587

27:286-98. 588

9. Cotter, C. R., W. K. Kim, M. L. Nguyen, J. S. Yount, C. B. Lopez, J. A. Blaho, 589

and T. M. Moran. 2011. The virion host shut-off (vhs) protein of HSV-1 blocks 590

the replication-independent activation of NF-{kappa}B in dendritic cells in the 591

absence of type I interferon signaling. J Virol. 592

10. Dong, H., G. Zhu, K. Tamada, and L. Chen. 1999. B7-H1, a third member of 593

the B7 family, co-stimulates T-cell proliferation and interleukin-10 secretion. Nat 594

Med 5:1365-9. 595

11. Flick, R., F. Elgh, and R. F. Pettersson. 2002. Mutational analysis of the 596

Uukuniemi virus (Bunyaviridae family) promoter reveals two elements of 597

functional importance. J Virol 76:10849-60. 598

12. Geisbert, T. W., and P. B. Jahrling. 2004. Exotic emerging viral diseases: 599

progress and challenges. Nat Med 10:S110-21. 600

13. Glynne, R., S. H. Powis, S. Beck, A. Kelly, L. A. Kerr, and J. Trowsdale. 1991. 601

A proteasome-related gene between the two ABC transporter loci in the class II 602

region of the human MHC. Nature 353:357-60. 603

14. Habjan, M., A. Pichlmair, R. M. Elliott, A. K. Overby, T. Glatter, M. Gstaiger, 604

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

28

G. Superti-Furga, H. Unger, and F. Weber. 2009. NSs protein of rift valley 605

fever virus induces the specific degradation of the double-stranded 606

RNA-dependent protein kinase. J Virol 83:4365-75. 607

15. Hang do, T. T., J. Y. Song, M. Y. Kim, J. W. Park, and Y. K. Shin. 2011. 608

Involvement of NF-kappaB in changes of IFN-gamma-induced CIITA/MHC-II 609

and iNOS expression by influenza virus in macrophages. Mol Immunol 610

48:1253-62. 611

16. Heyninck, K., and R. Beyaert. 1999. The cytokine-inducible zinc finger protein 612

A20 inhibits IL-1-induced NF-kappaB activation at the level of TRAF6. FEBS 613

Lett 442:147-50. 614

17. Ikegami, T., K. Narayanan, S. Won, W. Kamitani, C. J. Peters, and S. 615

Makino. 2009. Dual functions of Rift Valley fever virus NSs protein: inhibition 616

of host mRNA transcription and post-transcriptional downregulation of protein 617

kinase PKR. Ann N Y Acad Sci 1171 Suppl 1:E75-85. 618

18. Ikegami, T., K. Narayanan, S. Won, W. Kamitani, C. J. Peters, and S. 619

Makino. 2009. Rift Valley fever virus NSs protein promotes post-transcriptional 620

downregulation of protein kinase PKR and inhibits eIF2alpha phosphorylation. 621

PLoS Pathog 5:e1000287. 622

19. Jiao, Y., X. Zeng, X. Guo, X. Qi, X. Zhang, Z. Shi, M. Zhou, C. Bao, W. 623

Zhang, Y. Xu, and H. Wang. 2011. Preparation and evaluation of recombinant 624

severe fever with thrombocytopenia syndrome virus (SFTSV) nucleocapsid 625

protein for detection of total antibodies in human and animal sera by double 626

antigen sandwich ELISA. J Clin Microbiol. 627

20. Kalveram, B., O. Lihoradova, and T. Ikegami. 2011. NSs protein of rift valley 628

fever virus promotes posttranslational downregulation of the TFIIH subunit p62. 629

J Virol 85:6234-43. 630

21. Kawai, T., and S. Akira. 2006. Innate immune recognition of viral infection. Nat 631

Immunol 7:131-7. 632

22. Kelly, A., S. H. Powis, R. Glynne, E. Radley, S. Beck, and J. Trowsdale. 1991. 633

Second proteasome-related gene in the human MHC class II region. Nature 634

353:667-8. 635

23. Kumar, N., Z. T. Xin, Y. Liang, and H. Ly. 2008. NF-kappaB signaling 636

differentially regulates influenza virus RNA synthesis. J Virol 82:9880-9. 637

24. Lappin, D., and K. Whaley. 1989. Regulation of C1-inhibitor synthesis by 638

interferons and other agents. Behring Inst Mitt:180-92. 639

25. Le May, N., S. Dubaele, L. Proietti De Santis, A. Billecocq, M. Bouloy, and J. 640

M. Egly. 2004. TFIIH transcription factor, a target for the Rift Valley 641

hemorrhagic fever virus. Cell 116:541-50. 642

26. Le May, N., Z. Mansuroglu, P. Leger, T. Josse, G. Blot, A. Billecocq, R. Flick, 643

Y. Jacob, E. Bonnefoy, and M. Bouloy. 2008. A SAP30 complex inhibits 644

IFN-beta expression in Rift Valley fever virus infected cells. PLoS Pathog 4:e13. 645

27. Leonard, V. H., A. Kohl, T. J. Hart, and R. M. Elliott. 2006. Interaction of 646

Bunyamwera Orthobunyavirus NSs protein with mediator protein MED8: a 647

mechanism for inhibiting the interferon response. J Virol 80:9667-75. 648

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

29

28. Li, D. X. 2011. [Fever with thrombocytopenia associated with a novel bunyavirus 649

in China]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 25:81-4. 650

29. Li, J., C. J. Cardona, Z. Xing, and P. R. Woolcock. 2008. Genetic and 651

phenotypic characterization of a low-pathogenicity avian influenza H11N9 virus. 652

Arch Virol 153:1899-908. 653

30. Lu, X., J. Pan, J. Tao, and D. Guo. 2011. SARS-CoV nucleocapsid protein 654

antagonizes IFN-beta response by targeting initial step of IFN-beta induction 655

pathway, and its C-terminal region is critical for the antagonism. Virus Genes 656

42:37-45. 657

31. Minamoto, S., K. Ikegame, K. Ueno, M. Narazaki, T. Naka, H. Yamamoto, T. 658

Matsumoto, H. Saito, S. Hosoe, and T. Kishimoto. 1997. Cloning and 659

functional analysis of new members of STAT induced STAT inhibitor (SSI) 660

family: SSI-2 and SSI-3. Biochem Biophys Res Commun 237:79-83. 661

32. Nakitare, G. W., and R. M. Elliott. 1993. Expression of the Bunyamwera virus 662

M genome segment and intracellular localization of NSm. Virology 195:511-20. 663

33. Opipari, A. W., Jr., M. S. Boguski, and V. M. Dixit. 1990. The A20 cDNA 664

induced by tumor necrosis factor alpha encodes a novel type of zinc finger 665

protein. J Biol Chem 265:14705-8. 666

34. Pomerantz, J. L., and D. Baltimore. 1999. NF-kappaB activation by a signaling 667

complex containing TRAF2, TANK and TBK1, a novel IKK-related kinase. 668

Embo J 18:6694-704. 669

35. Qi, X., S. Lan, W. Wang, L. M. Schelde, H. Dong, G. D. Wallat, H. Ly, Y. 670

Liang, and C. Dong. 2010. Cap binding and immune evasion revealed by Lassa 671

nucleoprotein structure. Nature 468:779-83. 672

36. Raymond, D. D., M. E. Piper, S. R. Gerrard, and J. L. Smith. 2010. Structure 673

of the Rift Valley fever virus nucleocapsid protein reveals another architecture for 674

RNA encapsidation. Proc Natl Acad Sci U S A 107:11769-74. 675

37. Schmaljohn, C. H., J.W. 2001. Bunyaviridae: The Viruses and Their Replication, 676

4th edition ed. 677

38. Schoggins, J. W., S. J. Wilson, M. Panis, M. Y. Murphy, C. T. Jones, P. 678

Bieniasz, and C. M. Rice. 2011. A diverse range of gene products are effectors 679

of the type I interferon antiviral response. Nature 472:481-5. 680

39. Simons, J. F., R. Persson, and R. F. Pettersson. 1992. Association of the 681

nonstructural protein NSs of Uukuniemi virus with the 40S ribosomal subunit. J 682

Virol 66:4233-41. 683

40. Song, H. Y., M. Rothe, and D. V. Goeddel. 1996. The tumor necrosis 684

factor-inducible zinc finger protein A20 interacts with TRAF1/TRAF2 and 685

inhibits NF-kappaB activation. Proc Natl Acad Sci U S A 93:6721-5. 686

41. Streitenfeld, H., A. Boyd, J. K. Fazakerley, A. Bridgen, R. M. Elliott, and F. 687

Weber. 2003. Activation of PKR by Bunyamwera virus is independent of the 688

viral interferon antagonist NSs. J Virol 77:5507-11. 689

42. Takeuchi, O., and S. Akira. 2009. Innate immunity to virus infection. Immunol 690

Rev 227:75-86. 691

43. Thompson, A. J., and S. A. Locarnini. 2007. Toll-like receptors, RIG-I-like 692

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

30

RNA helicases and the antiviral innate immune response. Immunol Cell Biol 693

85:435-45. 694

44. Ungureanu, D., P. Saharinen, I. Junttila, D. J. Hilton, and O. Silvennoinen. 695

2002. Regulation of Jak2 through the ubiquitin-proteasome pathway involves 696

phosphorylation of Jak2 on Y1007 and interaction with SOCS-1. Mol Cell Biol 697

22:3316-26. 698

45. van Knippenberg, I., C. Carlton-Smith, and R. M. Elliott. 2010. The 699

N-terminus of Bunyamwera orthobunyavirus NSs protein is essential for 700

interferon antagonism. J Gen Virol 91:2002-6. 701

46. Weber, F., A. Bridgen, J. K. Fazakerley, H. Streitenfeld, N. Kessler, R. E. 702

Randall, and R. M. Elliott. 2002. Bunyamwera bunyavirus nonstructural protein 703

NSs counteracts the induction of alpha/beta interferon. J Virol 76:7949-55. 704

47. Weber, F., E. F. Dunn, A. Bridgen, and R. M. Elliott. 2001. The Bunyamwera 705

virus nonstructural protein NSs inhibits viral RNA synthesis in a minireplicon 706

system. Virology 281:67-74. 707

48. Weber, F., and O. Haller. 2007. Viral suppression of the interferon system. 708

Biochimie 89:836-42. 709

49. Won, S., T. Ikegami, C. J. Peters, and S. Makino. 2007. NSm protein of Rift 710

Valley fever virus suppresses virus-induced apoptosis. J Virol 81:13335-45. 711

50. Xing, Z., C. J. Cardona, S. Adams, Z. Yang, J. Li, D. Perez, and P. R. 712

Woolcock. 2009. Differential regulation of antiviral and proinflammatory 713

cytokines and suppression of Fas-mediated apoptosis by NS1 of H9N2 avian 714

influenza virus in chicken macrophages. J Gen Virol 90:1109-18. 715

51. Xing, Z., C. J. Cardona, J. Li, N. Dao, T. Tran, and J. Andrada. 2008. 716

Modulation of the immune responses in chickens by low-pathogenicity avian 717

influenza virus H9N2. J Gen Virol 89:1288-99. 718

52. Xu, F., D. Liu, M. R. Nunes, D. A. R. AP, R. B. Tesh, and S. Y. Xiao. 2007. 719

Antigenic and genetic relationships among Rift Valley fever virus and other 720

selected members of the genus Phlebovirus (Bunyaviridae). Am J Trop Med Hyg 721

76:1194-200. 722

53. Yadani, F. Z., A. Kohl, C. Prehaud, A. Billecocq, and M. Bouloy. 1999. The 723

carboxy-terminal acidic domain of Rift Valley Fever virus NSs protein is 724

essential for the formation of filamentous structures but not for the nuclear 725

localization of the protein. J Virol 73:5018-25. 726

54. Yamazaki, S., T. Muta, and K. Takeshige. 2001. A novel IkappaB protein, 727

IkappaB-zeta, induced by proinflammatory stimuli, negatively regulates nuclear 728

factor-kappaB in the nuclei. J Biol Chem 276:27657-62. 729

55. Ye, Y., K. Hauns, J. O. Langland, B. L. Jacobs, and B. G. Hogue. 2007. Mouse 730

hepatitis coronavirus A59 nucleocapsid protein is a type I interferon antagonist. J 731

Virol 81:2554-63. 732

56. Yoneyama, M., and T. Fujita. 2009. RNA recognition and signal transduction by 733

RIG-I-like receptors. Immunol Rev 227:54-65. 734

57. Yu, X. J., M. F. Liang, S. Y. Zhang, Y. Liu, J. D. Li, Y. L. Sun, L. Zhang, Q. F. 735

Zhang, V. L. Popov, C. Li, J. Qu, Q. Li, Y. P. Zhang, R. Hai, W. Wu, Q. Wang, 736

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

31

F. X. Zhan, X. J. Wang, B. Kan, S. W. Wang, K. L. Wan, H. Q. Jing, J. X. Lu, 737

W. W. Yin, H. Zhou, X. H. Guan, J. F. Liu, Z. Q. Bi, G. H. Liu, J. Ren, H. 738

Wang, Z. Zhao, J. D. Song, J. R. He, T. Wan, J. S. Zhang, X. P. Fu, L. N. Sun, 739

X. P. Dong, Z. J. Feng, W. Z. Yang, T. Hong, Y. Zhang, D. H. Walker, Y. 740

Wang, and D. X. Li. 2011. Fever with thrombocytopenia associated with a novel 741

bunyavirus in China. N Engl J Med 364:1523-32. 742

58. Zhang, L., Y. Liu, D. Ni, Q. Li, Y. Yu, X. J. Yu, K. Wan, D. Li, G. Liang, X. 743

Jiang, H. Jing, J. Run, M. Luan, X. Fu, J. Zhang, W. Yang, Y. Wang, J. S. 744

Dumler, Z. Feng, J. Ren, and J. Xu. 2008. Nosocomial transmission of human 745

granulocytic anaplasmosis in China. Jama 300:2263-70. 746

59. Zhang, S. Q., A. Kovalenko, G. Cantarella, and D. Wallach. 2000. 747

Recruitment of the IKK signalosome to the p55 TNF receptor: RIP and A20 bind 748

to NEMO (IKKgamma) upon receptor stimulation. Immunity 12:301-11. 749

750

751

752

753

754

755

756

757

758

759

760

761

762

763

764

765

766

767

768

769

770

771

772

773

774

775

776

777

778

779

780

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

32

Figure Legends 781

782

783

Figure 1. Human THP-1 monocytes were susceptible to SFTSV infection. (A) THP-1 784

cells were mock-infected or infected with SFTSV. More adhered cells were observed at 785

18 and 38 hrs p.i. in infected cells (magnification 100×). Uninfected and infected cells 786

were washed with PBS three times at different time points. (B) IFA for SFTSV antigens 787

in infected THP-1 cells. The cells were mock-infected or infected with the virus and fixed 788

at 18 or 28 hrs p.i. After permeablization with Triton X-100, the cells were incubated 789

with a human anti-SFTSV serum at a dilution of 1:100, followed by a staining with 790

FITC-anti-human IgG. (C) Percentage of THP-1 cells during the course of infection was 791

positive with viral antigens at various time points p.i. (D) IFA for SFTSV antigens in 792

infected Vero cells. 793

794

Figure 2. Replication of SFTSV in human monocytes without causing apoptosis. (A) 795

Replicative curve of SFTSV in the culture media of infected THP-1 cells. Culture media 796

of infected THP-1 cells were taken at 8, 18, and 28 hrs p.i., serially diluted, and 797

inoculated in Vero cells. Infectious virus titers were determined after the cells were 798

examined with IFA and calculated based on the Reed and Muench method. (B) Efficient 799

replication of SFTSV in monocytes. Total RNA were extracted from either control or 800

infected THP-1 cells at 8, 18, and 28 hrs p.i., and reverse transcribed before cDNAs were 801

subjected to realtime-PCR and the S gene copies were quantified. (C) No apoptosis was 802

induced during the infection. Western blot analysis was performed to determine that no 803

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

33

cleavage/activation of caspase-3 occurred in SFTSV-infected cells. (D) Apoptotic control: 804

caspase 3 was cleaved and activated in Etoposide (10μM) -treated THP-1 cells. 805

806

Figure 3. Antiviral responses induced in SFTSV-infected human monocytes. Total RNA 807

were prepared from non-infected and infected cells at various time points p.i., and 808

real-time RT-PCR was performed to measure transcript levels of IFN-α, IFN-β, IFN-γ, 809

MX1, OAS1 (A), and MDA-5 (B) at 8, 18, and 28 hrs p.i. respectively. (C) Induction of 810

MDA-5 expression. Cell lysates were prepared and subjected to SDS-PAGE and western 811

blot analysis with antibodies against MDA-5, MyD88, and β-actin at the time points as 812

indicated. 813

814

Figure 4. Heatmaps showing expression profiles of genes in IFN and NF-κB signaling 815

pathways in SFTSV-infected monocytes. Total RNA from non-infected and infected cells 816

at 8, 18, and 28 hrs p.i. were prepared and cRNA was labeled with Cy3-CTP before they 817

were subjected to hybridization on A4x44 microarray slides (Agilent) and scanning. 818

GeneData Expressionist platform was used to calculate relative fold changes of genes that 819

are involved in IFN and NFκB responses (A and B). Log-ratios are depicted in red 820

(upregulated) or green (downregulated). 821

822

Figure 5. NF-κB signaling analysis in THP-1 cells infected with SFTSV. The IPA 823

platform was used to analyze components involved in the NFκB response and their 824

relationships and interactions. Fold changes of transcript expression levels of the genes in 825

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

34

NF-κB signaling at 18 hrs p.i. were imported from the Agilent microarray analysis 826

described above. Fold changes are shown in red (upregulation) and green 827

(downregulation). 828

829

Figure 6. Pathway analysis of the anti-viral IFN response in infected THP-1 cells. The 830

IPA platform was used to analyze components of the IFN response involved in both IRF 831

and NFκB signaling. Fold changes of transcript expression levels of the genes in IRF and 832

NF-κB signaling at 18 hrs p.i. were imported from the Agilent microarray analysis. Fold 833

changes are shown in red (upregulation) and green (downregulation). 834

835

Figure 7. NSs and N proteins inhibited IFN-β promoter activity. (A) HEK293T cells 836

were transfected with the plasmids expressing NSs, N, or both, and western blot analysis 837

was performed to examine the expression levels of NSs and N proteins. (B, C) IFN-β 838

promoter activity was suppressed by NSs and N proteins in a luciferase assay. Cells were 839

co-transfected with pRK5-NSs or pRK5-N plasmid, along with pGL3-IFNβ-Luc and 840

pRL8 for 24 h, followed by stimulation with 50 μg/ml poly (I: C) or infection with 0.5 841

M.O.I of an avian influenza virus for another 6 hrs. Cell lysates were subjected to lysis 842

and the lysates were measured for luciferase activities. Results are shown as RLU (B) and 843

activation fold (C). 844

845

Figure 8. NSs and N proteins suppressed NFκB promoter activity. HEK293T cells were 846

co-transfected with plasmids expressing NSs or N, along with pGL3-Igκ-Luc and pRL8, 847

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

35

followed by stimulation with 50 μg/ml poly (I: C) or 0.5 M.O.I of the avian influenza 848

virus for additional 6 hrs. Results of luciferase activities were analyzed as RLU (A) and 849

activation fold (B). (C) Transcript expression levels of FasL in infected cells were 850

determined by real-time RT-PCR. 851

852

Figure 9. NSs association with TBK1 and transient NF-κB activation. (A) 853

Co-immunoprecipitation of NSs and TBK1. Pre-treated cell lysates in pRK5-Flag-NSs- 854

transfected HEK293 were immunoprecipitated with the anti-Flag antibody. The 855

immunoprecipitates were denatured and subjected to SDS-APGE and western blot 856

analyses with anti-Flag and anti-TBK1 antibodies, respectively. (B) Transient 857

phosphorylation and activation of NF-κB p65 (RelA) and NF-κB2, and degradation of 858

IκB-α in infected THP-1 cells. Cell lysates at various time points p.i. were prepared from 859

non-infected or infected cells, and subsequently subjected to SDS-PAGE and western blot 860

analyses. (C) Inhibition of NFκB signaling suppressed SFTSV replication. THP-1 cells 861

were pre-treated with inhibitors of NF-κB (100 nM) or IKK (10 μM) for 1 hr, and 862

subsequently infected with SFTSV. At 24 hrs p.i., total RNA was prepared for reverse 863

transcription and cDNA were subjected to realtime PCR for quantifying S gene copies in 864

the infected cells. (D) Infectious virus titers in NFκB inhibitor-treated THP-1 cells were 865

lower than those in non-treated cells. Culture media from infected THP-1 cells, treated or 866

not treated with the inhibitor, were diluted and subsequently used to infect Vero cells in 867

12-well plates for infectious virus titration (TCID50, Student t test, * p<0.05). 868

869

870

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

36

Table 1. The sequences of the primers used for detecting genes by realtime PCR 871

872

Gene Primer 5’ Primer 3’

S (Jiangsu-014) ACATTTTCCCTGATGCCTTG GCTGAAGGAGACAGGTGGAG

IFN-α GGAGTTTGATGGCAACCAGT TCTCCTCCTGCATCACACAG

IFN-β TGCTCTGGCACAACAGGTAG CAGGAGAGCAATTTGGAGGA

IFN-γ ATCCCATGGGTTGTGTGTTT CAAACCGGCAGTAACTGGAT

MX1 ACCACAGAGGCTCTCAGCAT CTCAGCTGGTCCTGGATCTC

OAS1 CCAAGCTCAAGAGCCTCATC TGGGCTGTGTTGAAATGTGT

RIG-1 AGATTTTCCGCCTTGGCTAT ACTCACTTGGAGGAGCCAGA

MDA-5 CAGGGAGTGGAAAAACCAGA TTTCCAGGCTCAGATGCTTT

FasL GGCCTGTGTCTCCTTGTGAT TGCCAGCTCCTTCTGTAGGT

GAPDH ACAGTCAGCCGCATCTTCTT ACGACCAAATCCGTTGACTC

873

874

875

876

877

878

879

880

881

882

883

884

885

886

887

888

889

890

891

892

893

894

895

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

37

Table 2. Fold changes of IFN Inducible genes upon infection* 896 _____________________________________________________________ 897

Genes Accessiona Fold Changes 898

Number 8 18 28 hrs p.i. 899

________________________________________________________________ 900

ADAR1 NM_001111.4 2.33 2.63 2.86

CD2742 NM_014143.3 5.52 10.56 29.50

DDX58 NM_014314.3 7.71 13.41 23.71

IFIH1 NM_022168.2 6.80 10.03 14.77

IFI35 NM_005533.4 2.26 4.56 8.05

IFI44 NM_006417.4 19.71 39.64 52.97

IFI44L NM_006820.2 24.63 61.67 111.40

IFI6 NM_022872.2 8.48 22.81 45.84

IFIT1 NM_001548.3 23.45 44.02 81.82

IFIT3 NM_001549.4 14.86 36.20 73.39

IFIT5 NM_012420.2 11.17 17.64 24.40

IFITM1 NM_003641.3 5.23 11.81 19.28

IFNAR1 NM_000629.2 1.63 1.88 2.13

IFNGR1 NM_000416.2 2.32 2.58 2.75

IFNGR2 NM_005534.3 3.77 3.59 4.29

IRF1 NM_002198.2 1.87 2.21 3.72

IRF9 NM_006084.4 2.26 2.15 2.52

ISG15 NM_005101.3 10.14 14.12 27.40

JUN NM_002228.3 5.57 4.82 5.16

MX1 NM_002462.3 13.91 21.48 27.96

MX2 NM_002463.1 5.88 7.77 12.53

OAS1 NM_002534.2 9.17 14.42 22.58

OAS2 NM_002535.2 10.39 14.44 25.30

PIM13 NM_002648.3 4.33 4.46 8.80

PSMB82 NM_004159.4 1.12 1.71 2.12

PTPN2 NM_002828.3 1.57 2.27 2.55

SERPING1 NM_000062.2 1.47 11.64 37.47

SOCS13 NM_003745.1 1.88 3.01 7.36

STAT1 NM_007315.3 6.32 8.31 13.74

STAT2 NM_005419.3 2.11 2.47 3.77

TAP12 NM_000593.5 4.19 5.49 7.89

________________________________________________________________ 901

* Fold changes of IFN inducible genes induced at 8, 18, and 28 hrs p.i. in SFTSV 902

-infected human monocytesa. Fold changes >= 1.5 are shown in bold. 903

a Accession number, provided by NCBI database; p.i., post infection. 1. Enhance 904

viral replication; 2. Adaptive immunity; 3. Suppressor of interferon signaling. 905

906

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

38

Table 3. Fold changes of genes involved in the regulation of the IFN and NFκB signaling* 907

_____________________________________________________ 908

Genes Accession Fold Changes 909

Number 8 18 28 hrs p.i. 910

_____________________________________________________ 911

BATF2 NM_138456.3 7.73 15.19 25.49 912

DDX58 NM_014314.3 7.71 13.41 23.71 913

IFIH1 NM_022168.2 6.80 10.03 11.77 914

IFIT2 NM_001547.4 5.64 17.50 47.01 915

IFNAR1 NM_000629.2 1.63 1.88 2.13 916

IFNAR2 NM_207585.1 1.21 1.21 1.63 917

IFNB NM_002176.2 2.28 12.36 31.96 918

IKBKB NM_001556.2 1.00 -1.45 -1.47 919

IKBKE NM_014002.3 3.89 3.57 4.22 920

IL10 NM_000572.2 5.79 4.96 11.53 921

IL10RA NM_001558.3 4.88 6.92 12.78 922

IRF3 NM_001571.5 1.00 -1.14 -1.11 923

IRF7 NM_004031.2 5.10 6.50 9.20 924

ISG15 NM_005101.3 10.14 14.12 27.40 925

JUN NM_002228.3 5.57 4.82 5.16 926

JUNB NM_002229.2 3.51 2.54 3.43 927

JUND NM_005354.4 1.28 1.16 1.21 928

MAVS NM_020746.4 -1.19 -1.90 -2.17 929

NFKB1 NM_003998.3 3.84 3.24 3.44 930

NFKB2 NM_002502.3 6.52 5.68 6.46 931

NFKBIA NM_020529.2 7.11 7.10 7.68 932

NFKBIB NM_002503.4 2.72 2.71 1.86 933

NFKBIE NM_004556.2 2.35 2.18 2.25 934

NFKBIZ NM_031419.3 7.42 8.64 8.09 935

RELA NM_021975.3 1.08 1.21 -1.23 936

STAT1 NM_007315.3 6.32 8.31 13.74 937

STAT2 NM_005419.3 2.11 2.47 1.82 938

SOCS1 NM_003745.1 1.88 3.01 7.36 939

TANK NM_004180.2 2.02 2.05 2.50 940

TBK1 NM_013254.3 1.39 1.27 1.29 941

TNF NM_000594.2 20.86 17.71 21.60 942

TNFSF10 NM_003810.3 1.55 4.96 14.06 943

TNFAIP3 NM_006290.2 20.74 17.02 23.18 944

TRAF3 NM_145725.2 1.35 1.68 1.27 945

TRAF6 NM_145803.2 -1.05 -1.22 -1.23 946

_____________________________________________________ 947

* Fold changes of the genes that are involved in the regulation of IFN and NF-κB 948

signalinga. Fold changes >= 1.5 are shown in bold. 949 a Accession number, provided by NCBI database; p.i., post infection. 950

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

39

Figure 1. 951

952

953

954

955

956

957

958

959

960

961

962

963

964

965

966

967

968

969

970

971

972

973

974

975

976

977

978

979

980

981

982

983

984

985

986

987

988

989

990

991

992

993

994

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

40

Figure 2. 995

996

997

998

999

1000

1001

1002

1003

1004

1005

1006

1007

1008

1009

1010

1011

1012

1013

1014

1015

1016

1017

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

41

Figure 3. 1018

1019

1020

1021

1022

1023

1024

1025

1026

1027

1028

1029

1030

1031

1032

1033

1034

1035

1036

1037

1038

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

42

Figure 4. 1039

1040

1041

1042

1043

1044

1045

1046

1047

1048

1049

1050

1051

1052

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

43

Figure 5. 1053

1054

1055

1056

1057

1058

1059

1060

1061

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

44

Figure 6. 1062

1063

1064

1065

1066

1067

1068

1069

1070

1071

1072

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

45

Figure 7. 1073

1074

1075

1076

1077

1078

1079

1080

1081

1082

1083

1084

1085

1086

1087

1088

1089

1090

1091

1092

1093

1094

1095

1096

1097

1098

1099

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

46

Figure 8. 1100

1101

1102

1103 1104

1105

1106

1107

1108

1109

1110

1111

1112

1113

1114

1115

1116

1117

1118

1119

1120

1121

1122

1123

1124

1125

1126

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

47

Figure 9. 1127

1128

1129

1130

on Novem

ber 10, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from