Characterization of β-cell Specific Knockout of UCP2

By

Sobia Sultan

A thesis submitted in conformity with the requirements

for the degree of Masters of Science

Graduate Department of Physiology

University of Toronto

© Copyright by Sobia Sultan (2010)

ii  

Abstract Characterization of β-cell Specific Knockout of UCP2

Sobia Sultan

MSc. Thesis 2010

Department of Physiology

University of Toronto

The whole body UCP2 knockout (UCP2−/−) have enhanced insulin secretion and higher ATP

content. However, these changes could be due to indirect effects of extra-pancreatic deletion and

therefore, generating beta-cell specific knockout mice (UCP2BKO) is essential. A 90%

knockdown of UCP2 protein was observed in beta-cells of UCP2BKO mice. No significant

differences were observed in body weight accumulation, fasting blood glucose, plasma insulin or

glucagon. UCP2BKO had impaired oral glucose tolerance with no differences in insulin

secretion or sensitivity. Enhanced ROS accumulation was observed in the beta-cells of

UCP2BKO and upregulation of antioxidant enzyme genes. Morphometric analysis showed an

increased glucagon positive area in the pancreata of UCP2BKO mice. Results obtained from

UCP2BKO were contrary to the phenotype observed in UCP2−/− mice. Overall, the

characterization of UCP2BKO demonstrates that UCP2 in the beta-cell is involved in modulating

ROS production.

iii  

Acknowledgements:

I would like to extend my deepest gratitude to my supervisor, Dr. Michael B. Wheeler for giving

me the opportunity to work on this project and for his ongoing support throughout my graduate

studies. I would also like to thank Dr. Emma M. Allister for being my mentor and guiding me

through every large and small endeavor.

Furthermore, I would like to thank all the past and present members of the Wheeler lab for their

invaluable recommendations.

I am grateful for my supervisory committee members; Drs. Adria Giacca, Dominic Ng and Dr.

Herbert Y. Gaisano for their important discussions.

I would also like to thank the Banting and Best Diabetes Centre for funding my research over the

years of 2008-2009.

Lastly, I would like to thank my grandmother, parents, and the rest of my family members who

have continued to support me throughout the years. Your love and guidance has made me a

better person.

iv  

Table of Contents: Pg. No.

Abstract ii

Acknowledgements iii

Table of Contents iv

List of abbreviations viii

List of figures x

Chapter 1: Introduction

1.1 Diabetes Mellitus 1

1.1.1 The Epidemic 1

1.1.2 Type 2 Diabetes Mellitus: description of the pathophysiology 2

1.2 Glucose Homeostasis 4

1.3 Glucose-Stimulated Insulin Secretion 6

1.3.1 Glucose metabolism 6

1.3.2 Insulin secretion via ATP production 7

1.3.3 Insulin secretion: Amplification Pathway 9

1.4 Uncoupling Proteins 10

1.4.1 UCP1 10

1.4.2 UCP3 11

1.4.3 UCP2 11

1.4.4 Role of UCP2 in insulin secretion and glucose homeostasis 12

1.4.5 UCP2: Modulation of ROS & Cytoprotection 14

1.4.6 Alternate functions of UCP2 17

1.5 Cre-Lox Recombination system 19

1.5.1 Background 19

1.5.2 RIP-Cre model 20

1.6 General Hypothesis 22

v  

Table of Contents Con’t: Pg. No.

Chapter 2: Creation and In Vivo characterization of UCP2BKO 2.1 Hypothesis 23

2.2 Method and Materials 23

2.2.1 Reagents 23

2.2.2 Animal Breeding 23

2.2.3 Pancreatic islet isolation and culture 25

2.2.4 Islet cell dispersion 25

2.2.5 RNA extraction & Reverse Transcription of animal tissues 26

2.2.6 DNA extraction & Multiplex PCR 26

2.2.7 Real-time PCR 26

2.2.8 Immunostaining and immunofluorescence confocal microscopy 26

2.2.9 Weight & Blood glucose measurements 27

2.2.10 Measurement of fasting plasma glucagon 27

2.2.11 Measurement of glucose tolerance 28

2.2.12 Measurement of insulin sensitivity 28

2.2.13 Statistical Analysis 28

2.3 Results 29

2.3.1 Genotyping 29

2.3.2 Cre mRNA expression 21

2.3.3 Effective deletion of UCP2 mRNA & protein 30

2.3.4 Body Mass & Fasting Blood Glucose 32

2.3.5 Plasma Insulin and Plasma Glucagon 33

2.3.6 Assessing Glucose Tolerance: ipGTT & OGTT 35

2.3.7 ITT 38

Chapter 3: Characterization of UCP2βKO: In Vitro Analysis 3.1 Hypothesis 40

3.2 Method and Materials 40

vi  

Table of Contents Con’t: Pg. No.

3.2.1 Reagents 40

3.2.2 Animals 40

3.2.3 Analysis of Membrane Potential 41

3.2.4 Analysis of ATP levels in β cells 41

3.2.5 Measurement of glucose stimulated insulin secretion 41

3.2.6 Pancreatic islet morphology 42

3.2.7 Measurement of ROS 42

3.2.8 Evaluating the mRNA expression of Anti-oxidant enzymes in β-cells 42

3.2.9 Statistical Analysis 43

3.3 Results 43

3.3.1 Membrane Potential 43

3.3.2 ATP Levels 45

3.3.3 Glucose Stimulated Insulin Secretion 45

3.3.4 Islet Area 46

3.3.5 Beta Cell area 47

3.3.6 Alpha Cell area 48

3.3.7 ROS accumulation 49

3.3.8 Anti-oxidant enzyme expression in β cells 50

Chapter 4: Discussion & Conclusion 4.1 Summary of findings 52

4.1.1 In Vivo Findings 52

4.1.2 In Vitro Findings 52

4.2 General Discussion 53

4.2.1 UCP2BKO in comparison to previous global knockout models 53

4.2.2 UCP2BKO and Oxidative Stress 57

4.2.3 UCP2BKO and α-cell area 58

4.2.4 UCP2BKO and impaired glucose tolerance 60

vii  

Table of Contents Con’t: Pg. No.

4.3 Future Directions 62

4.3.1 UCP2 in the Hypothalamus 62

4.3.3 UCP2BKO on a High-Fat Diet 63

4.4 Conclusions 64

Reference List 66

viii  

List of Abbreviations

ADP – adenosine diphosphate

ANOVA – analysis of variance

ATP – adenosine triphosphate

BP - basepair

cDNA – complementary deoxyribonucleic acid

CNS – central nervous system

DM – Diabetes Mellitus

DCF – dicholorofluorescein

DNA – deoxyribose nucleic acid

EDTA – ethylenediaminetetraacetic acid

EGTA – ethylene glycol tetraacetic acid

ELISA – enzyme-linked immunosorbent assays

ETC – electron transport chain

FAD – flavin adenine dinucleotide

FFA – free fatty acids

FBS – fetal bovine serum

FITC – Fluorescein isothiocyanate

G-6-P – glucose-6-phosphate

GDP – guanosine diphosphate

GLUT – glucose transporter

GSIS – glucose-stimulated insulin secretion

mRNA – messenger ribosomal nucleic acid

NAD – nicotinamide adenine dinucleotide

NLS – nuclear localization signal

NO – nitric oxide

PI – propidium iodide

PBS – phosphate buffered soluton

PDX-1 – pancreatic-duodenal homeobox factor-1

PPAR-γ – peroxisome proliferator-activated receptor

RFU – relative fluorescence unit

ix  

RIA – radioimmunoassay

RIP – Rat Insulin Promoter

RNA - ribosomal nucleic acid

ROS – reactive oxygen species

RPMI – Roswell Park Memorial Institute

SREBP-1c – Sterol Regulatory Element Binding Protein-1c

STZ – streptozotocin

TCA cycle – tricarboxylic acid cycle

UCP – uncoupling protein

UCP2 – uncoupling protein-2

UCP2BKO – beta-cell specific knockout of UCP2

VDCC – voltage dependent calcium channel

WHO – World Health Organization

                   

x  

List of Figures & Tables 

Figures:

1. Control of Glucose Homeostasis in the Body

2. Insulin Secretion in the Beta-Cell

3. Structure of a generic uncoupling protein

4. UCP2 in the Mitochondria

5. UCP2 as a negative regulator of insulin secretion

6. Proposed role of UCP2 in cytoprotection

7. Cre-mediated DNA recombination

8. Schematic diagram of the RIP-Cre transgene

9. Recombination via Cre recombinase

10. Genotyping for LoxUCP2 and Cre

11. Cre expression in cDNA of multiple tissues

12. Gene expression for UCP2

13. UCP2 protein expression in islets

14. Weekly body weight measurements

15. Fasting blood glucose measurements

16. Fasting Plasma Insulin levels

17. Fasting Plasma Glucagon

18. Glucose Tolerance Test; ipGTT

19. Glucose Tolerance Test; OGTT

20. Glucose-stimulated insulin secretion

21. Intraperitoneal insulin tolerance tests

22. Mitochondrial membrane potential

23. Islet ATP content

24. In vitro GSIS

xi  

25. Islet Area

26. Pancreatic Beta-cell area

27. Pancreatic Alpha-cell area

28. ROS accumulation

29. Gene expression of anti-oxidant enzymes

30. Proposed explanation of the phenotype

Tables:

1. The functional role of antioxidant enzymes in the pancreatic beta cell

2. UCP2 and Islet Function

3. Primer sequences for genotyping and RT PCR

4. Primer sequences for RT-PCR of Anti-oxidant enzymes

5. Comparison of UCP2BKO to the UCP2 whole body knockout models

1  

Chapter 1: Introduction

1.1 Diabetes Mellitus

1.1.1 The Epidemic

With an estimated 180 Million people afflicted and the number most likely to double by

the year 2030, Diabetes Mellitus (DM) is an epidemic that will cause great socio-economic

burden on our world (http://who.int, accessed August 2009). A disorder that is classically

characterized by hyperglycemia (high blood-sugar), DM results when there are inadequate levels

of insulin secreted or when there is resistance to insulin’s blood glucose lowering effects

(http://who.int, accessed August 2009). Insulin is a hormone produced by the beta-cells in the

pancreas which is released into the blood to stimulate glucose uptake by peripheral tissues tissues

such as the skeletal muscle. The World Health Organization (WHO) recognizes three main

forms of DM; Type 1, Type 2, and Gestational (http://who.int, accessed August 2009). Type 1

diabetes, which represents about 10% of all diabetics, occurs through a T-cell-mediated

autoimmune attack on the insulin-producing beta-cells, which leads to a lack of insulin

production. Type 2 DM, which represents about 90% of all diabetic cases, is primarily

characterized by insulin resistance and low levels of insulin production due to beta-cell

dysfunction. Gestational diabetes is first recognized during pregnancies and the cause and

symptoms are similar to Type 2 DM (http://who.int, accessed August 2009).

In 2005, the WHO estimated 1.1 million deaths due to diabetes with projections

increasing by more than 50% in the next 10 years. The myriad of symptoms associated with the

affliction of diabetes include retinopathy, neuropathy, kidney failure, and heart disease. Due to

these vast health implications, it is imperative to understand the progression of the disease and

develop effective therapeutic strategies accordingly. Studies thus far have shown that diabetes is

a complex, multifactorial disease with both genetic and epigenetic factors contributing to its risk

of development. Type-1 DM has been shown to be caused by polymorphisms in certain genes

such as the insulin and HLA class II genes that decrease the β-cell mass by 70-80%, which leads

to little or no production of insulin (Cnop 2005). In contrast, Type-2 DM, usually develops

when chronic over-nutrition combined with a genetic predisposition causing peripheral tissues to

2  

be resistant to insulin production (Muoio 2008). This eventually leads to a partial loss of β-cell

mass (between 40-60%) as well as a decline in β-cell function (Butler 2003).

The treatment strategies used for patients with Type-2 DM include medication that

improves the body’s response to insulin sensitivity in peripheral tissues. Metformin, the primary

pharamocological drug for Type-2 DM, activates 5’AMP-activated protein kinase (AMPK) to

increase glycolysis and fatty acid oxidation (Muoio 2008). Thiazolidinediones such as

rosiglitazone activate peroxisome proliferator-activated receptor-γ2, which stimulates the AMPK

pathway, induces adipogenesis and reallocates lipids from liver and muscle into adipose tissue

(Muoio 2008). This results in an increase in adipose tissue and insulin sensitivity of the

peripheral tissues (Muoio 2008). Sulfonylureas increase insulin secretion, however, have been

found to lose effectiveness over time (Cohen 2007).

1.1.2 Type-2 DM: description of the pathophysiology

As previously mentioned, Type-2 DM is characterized by insulin resistance in the

peripheral tissues combined with beta-cell dysfunction. Initially, insulin resistance, caused by

factors such as genetic predisposition and lifestyle influences result in a compensation by the

beta-cells to increase insulin secretion as well as an increase in cell proliferation and hypertrophy

(Asghar et al 2006). Eventually, the beta cells are unable to keep up with the high demand of

insulin, which leads to their dysfunction and apoptosis (Rhodes 2005). In recent times, the

number of people with Type-2 DM has dramatically increased due to secondary factors such as

obesity, hypertension and lack of physical activity (http://who.int, accessed August 2009).

Through genome-wide associated studies, 11 genomic regions have been recognized to alter the

risk of Type-2 DM in the general population (Frayling 2007). One of these associated variations

includes a common variant in the fat mass and obesity associated gene (FTO). A continual rise

in obesity has been noted as a serious risk factor for the development of Type 2-DM (Formiguera

2004).

It is commonly thought that obesity, which is characterized by hyperlipidemia and

hyperglycemia (known as glucolipotoxicity together), causes defective insulin secretion and

contributes to the development of Type-2 DM (Poitout 2002). Elevated levels of glucose result

3  

in decreased insulin synthesis and eventually lead to beta-cell dysfunction and death by damage

to cellular components (Poitout 2002). Increased accumulation of glucose and lipid metabolic

products results in impaired insulin secretion and a decrease in insulin gene expression. Studies

have suggested that activation of the epsilon isomer of pyruvate kinase C (PKCε) by lipids

results in the impairment of insulin secretion through the decrease in the amplification pathway

of secretion (Cantley et al. 2009). Islets from PKCε knockout mice were protected from the

harmful effects of fatty acids and did not show impaired insulin secretion when exposed to fatty

acids (Cantley et al. 2009). Glucolipotoxicity has also been shown to directly affect insulin

exocytotic machinery and suspending the release of insulin at the fusion pore (Olofsson et al.

2007). Lipids have also been shown to downregulate insulin gene expression by decreasing the

binding of transcriptions factors such as pancreas-duodenum homeobox-1 (PDX-1) and MafA to

the insulin promoter (Kelpe et al. 2003; Hagman et al. 2005). Moreover, chronic exposure of

fatty acids such as palmitate or oleate to islets leads to deficiencies in insulin secretion (Kelpe et

al. 2003). De novo synthesis of ceramide, a metabolic product of palmitate, has been

demonstrated to play a role in beta-cell apoptosis and result in a downregulation of insulin gene

expression through similar mechanisms as mentioned above (Shimabukuro 1999; Hagman et al.

2005).

β-cell dysfunction in Type-2 DM has also been shown to occur through oxidative stress

(Rhodes 2005). Oxidative stress is characterized by the continual rise of reactive oxygen species

(ROS) combined with the decline of antioxidant defenses in the cell. ROS consists of highly

reactive oxygen-containing molecules such as hydroxyl radical, hydrogen peroxide and

superoxide. ROS production occurs primarily at the mitochondrial membrane, specifically at the

electron transport chain (Chen et al. 2003). When glucose and fatty acids are metabolized, there

is an increase in the mitochondrial membrane potential due to protons being pumped into the

inter-membrane space by complexes in the electron transport chain (ETC). During this process,

electrons escaping from the ETC react with free oxygen to form superoxides and other species

(Chen et al. 2003). Thus, the chronic increase in glucose and lipid metabolism, such as the case

in obesity, leads to an increase in the production of ROS (Korshunov et al. 1997). The continual

increase of ROS results in oxidative damage such as DNA fragmentation and protein damage,

which leads to necrosis and apoptosis (Rhodes 2005). Li et al. (2009) have shown that oxidative

4  

stress results in decreased activity of subunits of the ETC and downregulation of genes

responsible for mitochondrial biogenesis leading to impaired glucose-stimulated insulin secretion

(GSIS) and ATP production. Accumulation of ROS due to chronic increases in glucose and lipid

metabolism has also been shown to activate the JNK/p38 pathway, an ER stress pathway leading

to the apoptosis of the cell (Rhodes 2005). The activation of proapoptotic factors such as the

release of cytochorme c, and the activation of the caspase family induces choromatin

condensation and membrane decomposition resulting in apoptosis (Maestre et al. 2003). In

addition, islets are not equipped with a stringent antioxidant defense system, which exacerbates

the problem by making the beta-cells highly susceptible to damage via oxidative stress. Overall,

these studies highlight the strong association between type-2 diabetes and glucolipotoxicity,

which results in beta-cell dysfunction and apoptosis through mechanisms such as defective

insulin secretion and oxidative stress.

1.2 Glucose Homeostasis

Maintenance of normal glucose levels in the body is crucial to survival. There are a

variety of mechanisms that the body utilizes to detect and maintain glucose homeostasis. Firstly,

the islets of Langerhans, the endocrine portion of the pancreas, is primarily responsible for

maintaining normoglycemia (Figure 1). The islets are composed of alpha (15-20% of total islet

cells), beta (65-80%), delta (3-10%), pancreatic polypeptide (3-5%) and epsilon (< 1%) cells

(Brissova et al. 2005). The hormones; glucagon and insulin, produced by alpha- and beta-cells,

respectively are the primary hormones sustaining normal glucose levels. With opposing roles,

glucagon is released during low levels of blood glucose and increases blood glucose levels by

acting on the liver and stimulating glycogenolysis and gluconeogenesis (Burcelin 2008).

Stimulation of insulin occurs during high levels of glucose, where insulin acts on peripheral

tissues such as adipocytes and skeletal muscle to increase glucose uptake from the blood.

 

Figure 1modulateincrease productiocells by phypothalglucose p

A

maintain

glucose h

Gelling e

acids and

hypothal

Konner e

neurons r

glucose p

: Control ofed by the alpblood glucoon. Increasepromoting glamus controproduction.

Aside from th

ing glucose

homeostasis

et al. 2006; I

d glucose (Le

amus suppre

et al. 2007).

resulted in th

production, d

f Glucose hpha- and betase levels by

es in blood glucose uptak

ols glucose h

he pancreas,

and energy h

by 1) sensin

noue et al. 2

evin et al. 20

esses hepatic

Moreover, t

he inability o

demonstratin

omeostasis a-cells in thesecreting gl

glucose levelke in periphehomeostasis t

the central n

homeostasis

ng hormones

2006; Obici e

004; Parton

c glucose pro

the antagoni

of neurons to

ng the fact th

5 

in the bodye pancreas anucagon, whi

ls stimulatederal tissues sthrough the

nervous syst

s (Figure 1).

s such as insu

et al. 2002) a

et al. 2007).

oduction via

ism of down

o react to inc

hat neurons i

y. Blood glund the hypotich stimulate

d the secretiouch as the skstimulation

tem (CNS) p

The CNS h

ulin and lept

and 2) detec

Infusion of

a NPY/AgRP

stream insul

creasing insu

in the hypoth

cose levels athalamus. Thes hepatic glon of insulin keletal muscor suppressi

plays a critic

has the ability

tin (Coppari

ting nutrient

f insulin dire

P neurons (O

lin signaling

ulin levels an

halamus hav

are primarilyhe alpha-celucose from the be

cle. The ion of hepati

al role in

y to regulate

et al. 2005;

ts such as fat

ectly into the

Obici et al. 20

g molecules i

nd restrain

ve an intact

y lls

ta-

ic

e

tty

e

002;

in

6  

insulin signaling pathway (Obici et al. 2002). Leptin, produced by the adipocytes is classically

involved in improving glucose homeostasis by signaling satiety to the hypothalamus and

reducing adiposity and feeding (Campfield et al. 1995; Halaas et al. 1995; Pelleymounter et al.

1995). However, leptin signaling in the arcuate nucleus of the hypothalamus has recently been

shown to decrease hepatic glucose production through the JAK/STAT3 pathway and improve

glucose homeostasis (Buettner et al. 2006). Studies have shown that an increase in glucose

concentration specifically in the CNS leads to the suppression of both hepatic gluconeogenesis

and glycogenolysis resulting in a decrease in blood glucose and insulin levels (Lam et al. 2005).

Parton et al. (2007) have shown that mice expressing a mutant KATP channel (a channel

important in glucose metabolism and insulin signaling) in Pro-opiomelanocortin (POMC)

neurons had systemic impaired glucose homeostasis. Moreover, fatty acid sensing by the

hypothalamus has been shown to regulate glucose homeostasis. Infusion of oleic acid into the

third cerebral ventricle of the hypothalamus resulted in decreased plasma insulin and glucose

levels demonstrating that long-chain fatty acids had the ability to trigger neural pathways to

regulate energy homeostasis (Obici et al. 2002).

1.3 Glucose-Stimulated Insulin Secretion

1.3.1 Glucose metabolism

In the pancreatic beta-cell, glucose enters via the GLUT2 transporter and is directly

metabolized via glycolysis. First, glucose is phosphorylated by the enzyme glucokinase, which

generates glucose-6-phosphate (Figure 2). The final product of glycolysis are 2 molecules of

pyruvate from 1 molecule of glucose. In the process of metabolizing glucose, the energy

molecules ATP and nicotinamide adenine dinucleotide (NADH) are also produced. In order to

prepare it for further oxidation in the mitochondria, pyruvate is converted to acetyl CoA by the

enzyme pyruvate dehydrogenase (Scheffler 2001).

7  

1.3.2 Insulin secretion via ATP production

The oxidation of acetyl CoA occurs within the tricarboxylic acid (TCA) cycle, which

takes place in the inner mitochondrial membrane (Figure 2). The TCA cycle begins with Acetyl

CoA combining with oxaloacetate to make citrate, and through a series of oxidation steps leads

to the transfer of energy to substrates such as NADH and flavin adenine dinucleotide (FADH2)

(Scheffler 2001). These substrates are used in the electron transport chain which occurs on the

inner mitochondrial membrane (Figure 2). NADH and FADH2 act as electron donors and pass

electrons through a series of redox complexes, where the energy is harvested to move protons

across the membrane into the intermembrane space (Scheffler 2001). The final acceptor of the

electrons is a molecule of oxygen, which combines with hydrogen to make water (H2O). As a

result, a proton gradient is created across the mitochondrial membrane. The protons then re-

enter the matrix, down their electrochemical gradient, through ATP-synthase, where the energy

is used to convert ADP to ATP (Figure 2).

Increased accumulation of ATP causes the closure of potassium ATP (KATP) channels,

located on the plasma membrane, decreasing the outward K+ ion flow from the beta-cell and

depolarizing the cell. Due to the changes in membrane potential, voltage-dependent calcium

channels open to allow extracellular Ca2+ into the cell (Figure 2). Ca2+ accumulation in the

cytoplasm has been shown to be required for the docking, priming and exocytosis of insulin

vesicles (Bratanova-Tochkova et al. 2002). Thus, the inward flow of Ca2+ leads ultimately to the

secretion of insulin from the β-cells (Scheffler 2001). Insulin secretion can be differentiated in

two phases: first and second. The first phase is characterized by the rapid exocytosis of insulin

and occurs in the first few minutes after glucose stimulation. The first phase is defined by the

release of insulin vesicles that are docked at the plasma membrane. The second phase is

characterized by the release of stored granules as well as the synthesis of new insulin.

8  

Glucose (1) Insulin Glut2 Ca2+ G-6-P (glycolysis) (2) (exocytosis) (9) VDCC Pyruvate H+ H+ Complexes I-IV H+ H+ H+ H+ H+ H+ H+ ATP Synthase KATP Acetyl CoA (4) ETC H+ (5)ATP ATP ( ATP:ADP) TCA (3) Mitochondria Figure 2: Insulin secretion in the beta cell. Glucose enters the pancreatic beta-cell via the GLUT2 transporter protein (1). Glucose is metabolized through the glycolysis pathway to pyruvate in the cytoplasm (2). Pyruvate enters the mitochondria and is utilized as a substrate in the tricarboxylic acid (TCA) cycle, which produces reducing equivalents; NADH and FADH2 (3). The energy from these reducing equivalents is used in the electron transport chain (ETC) to translocate protons from the mitochondrial matrix to the intermembrane space (4). A proton gradient is formed across the inner mitochondrial membrane, which leads to the formation of a proton motive force that allows the protons to enter the matrix via the ATP-synthase, where the released energy is captured and drives the conversion of ADP to ATP (5). The rise in ATP (specifically the ATP:ADP ratio) causes the closure of the KATP channels located on the plasma membrane (6), which depolarizes the membrane (7). This leads to the activation and opening of voltage-dependent calcium channels (VDCC), which allows the entry of extracellular calcium into the cell (8). The increase in calcium concentration in the cytoplasm eventually allows the exocytosis of insulin from the beta-cell (9). (10) Amplification Phase: increases in intracellular calcium accumulation independent of KATP channel closure results in the stimulation of insulin secretion by strengthening the relationship between Ca2+ and exocytosis.

Intermembrane Space Matrix 

[Ca2+]  (8) [K+ ] (6) 

Depolarization (7) 

(10) Amplification Phase 

9  

1.3.3 Insulin secretion: Amplification Pathway Insulin secretion can be sustained through the amplification phase, which acts

independent of KATP channel-stimulated closure. The amplification of insulin secretion is

complementary to the triggering (KATP channel dependent) pathway in order to augment the

amount of insulin secretion (Henquin et al. 2003). Glucose can directly stimulate secretion by

strengthening the interaction between intracellular Ca2+ and exocytotic machinery (Henquin et al.

2003). Studies have shown that if KATP channels cannot be closed, an artificial increase in

intracellular calcium can still result in the stimulation of beta-cell insulin secretion (Gembal et al.

1992; Gembal et al. 1993). Paracrine influence by hormones and neurotransmitters such as

glucagon-like peptide 1 (GLP-1) and acetylcholine have also been shown to amplify insulin

secretion (Henquin et al. 2003). Acetylcholine (ACh), which is released by the parasympathetic

nervous system that synapses at the beta-cells results in the increase in intracellular calcium.

Studies have shown that acetylcholine induces the release of endoplasmic storage of calcium into

the cytosol (Gilon et al. 2001). Diacylglycerol, a metabolic product of Ach, has also been shown

to activate protein kinase C, which results in exocytotic machinery being more sensitive to

stimulation by Ca2+ (Jones et al. 1998). Similarly, GLP-1 has also been shown to induce

intracellular stores of calcium as well as stimulate the closure of KATP channels. GLP-1 can

activate protein kinase A, which results in the production of cAMP resulting in the strengthening

of Ca2+ and exocytosis interaction (Fujimoto et al. 2002).

1.4 Uncoupling Proteins

Uncoupling proteins (UCPs) belong to a family of membrane carrier proteins that provide

a proton leak mechanism across the mitochondrial membrane. Uncouplers dissipate the potential

energy stored in the proton gradient through heat and bypass ATP synthase, decreasing the

efficiency of ATP production (Saleh et al. 2002). Structurally, UCPs are transmembrane

proteins composed of six alpha-helix transmembrane regions, which are joined by 3 loops

located on the mitochondrial matrix side (Walker 1993). The alpha-helices form a channel

through the membrane, which is controlled by the loops that act as gates (Figure 3; Walker

1993). The functional channel has been shown to be a homodimer (Echtay 2007).

 

Figure 3transmemthat protocreated b

T

al. 2002)

primary f

and UCP

localized

UCP2 an

muscle, c

metaboli

fold less

2001). U

will be d

carrier pr

the centra

al. 2002)

1U

dissipatio

through A

from AT

BAT is to

Nedergaa

3: Structure mbrane alphaons pass throby a homodim

There are five

. UCP1 is th

function of U

P3 have high

d to a specific

nd will be dis

cardiac musc

sm (Nabben

than UCP1,

UCP1-3 have

iscussed in d

rotein-1 or U

al nervous sy

.

.4.1 UCP1UCP1, almos

on of the pro

ATP synthas

P phosphory

o provide a m

ard 2004). M

of a generia-helices joinough with thmer with the

e different m

he best chara

UCP1 has be

h homology t

c tissue (Sal

scussed in de

cle, and brow

n & Hoeks 20

thus elimina

e high homo

detail below

UCP5 have lo

ystem and ar

1 st exclusively

oton motive

se, UCP1 red

ylation (Cann

mechanism i

Moreover, U

c uncouplinned by 3 hyd

he loops actine N- and C- t

mammalian h

acterized UC

een accepted

to UCP1 but

leh et al. 200

etail below (

wn adipose t

008). The ex

ating their ro

logy to each

. The last tw

ow homolog

re also sugg

y expressed

force as heat

duces ATP g

non & Nede

in non-shive

UCP1 has als

10 

ng protein. drophilic loong as gates. terminals fac

homologues

CP and is fou

d to be therm

t their functio

02). A myria

(Figure 4). U

tissue and is

xpression of

ole in non-sh

h other and a

wo proteins;

gy with UCP

ested to be i

in brown ad

t. By lower

generation by

ergaard 2004

ering and col

o been show

Structure is ops. The alp

A functionicing the cyto

of UCPs kn

und in brown

mal regulation

ons still rem

ad of function

UCP3 is exp

suggested to

f UCP2 and U

hivering ther

are well-char

UCP4 and t

Ps1-3. These

nvolved in e

dipose tissue

ring the amo

y uncoupling

4). The phys

ld-induced th

wn to be expr

composed opha-helices fing uncoupliosolic side o

own; UCP1-

n adipose tis

n (Saleh et a

main unclear

ns have been

pressed main

o be involve

UCP3 is fou

rmogenesis (

racterized pr

the brain mit

e proteins ar

energy metab

(BAT), is in

ount of proto

g the electro

siological rol

hermogenes

ressed in lon

of six form the chaning channel if the protein

- UCP5 (Sal

ssue. The

al. 2002). U

and neither

n associated

nly in the ske

ed in energy

und to be 100

(Pecqueur et

roteins, whic

tochondrial

e expressed

bolism (Sale

nvolved in th

ons passing

on transport c

le of UCP1 i

is (Cannon &

ngitudinal

nnel is

n.

leh et

CP2

is

with

eletal

00-

t al.

ch

in

eh et

he

chain

in

&

11  

smooth muscle of the digestive and reproductive tracts where it participates in thermogenesis as

well as relaxation of the muscle (Nibbelink et al. 2001). The proton conductance of UCP1 is

under stringent control where it has been shown to be activated by fatty acids and inhibited by

purine nucleotides such as ATP, and GTP (Echtay 2007).

1.4.2 UCP3 Uncoupling protein-3 is exclusively expressed in the skeletal muscle and heart (Echtay

2005). It is commonly thought that UCP3 plays a role in fatty acid metabolism. UCP3 has been

suggested to provide a mechanism of transport for fatty acids across the mitochondrial

membrane into the cytosol thereby preventing fatty acid toxicity and mitochondrial damage

(Echtay et al. 2005). Transportation of fatty acid anions into the cytosol results in the

reactivation by acyl-CoA synthetase thereby facilitating continual fatty acid oxidation (Bezaire et

al. 2007). Moreover, it has also been suggested that UCP3 protects the skeletal muscles from

ROS damage, where increased oxidative stress was observed in the muscle of UCP3 knockout

mice (Bezaire et al. 2001). Supporting these roles, clinical studies with patients having a

mutation in the UCP3 gene have been suggested to result in decreased rates of fatty acid

oxidation and are associated with type 2 diabetes (Argyropoulous et al. 1998). In addition, the

overexpression of UCP3 in muscle cells has been shown to be associated with decreased

production of ROS as well as facilitating fatty acid oxidation (MacLellan et al. 2005)

1.4.3 UCP2 UCP2 has been recently spotlighted because of its controversial role in metabolism and

insulin secretion. In fact, the UCP2 gene has been shown to be located on chromosome 11 in

humans, close to the gene associated with obesity (Saleh et al. 2002). Although there is high

homology between the UCP1 and UCP2, they are not proposed to share a similar functional role.

High expression of UCP2 mRNA has been found in several tissues including spleen, thymus,

heart, lungs, white and brown adipose tissue (Echtay 2005). However, the mRNA expression

does not necessarily correlate with increased UCP2 protein translation. Although higher mRNA

expression is observed, extremely low levels of UCP2 protein are found in the heart, skeletal

muscle and brown adipose tissue (Echtay 2005). On the other hand, high protein expression is

observed in the pancreas, spleen and macrophages (Pecqueur et al. 2001). In general, UCP2

12  

activity and expression has been shown to be up-regulated in a high glucose or fatty acid

environment. Upregulation of UCP2 mRNA has been shown by substrates such as sterol-

regulatory-element-binding protein-1c (SREBP-1c), and peroxisome-proliferator-activated-γ,

which are, in turn, stimulated by fatty acids and glucose (Echtay et al. 2001; Ito et al. 2004;

Takahashi et al. 2005). On the other hand, down-regulation of UCP2 transcription has been

shown to occur using nucleotides such as ADP as well as sirtuan-1 (Echtay et al. 2001; Bordone

et al. 2006). Suppression of UCP2 activity has been demonstrated using GDP as well as a

compound named genipin from the extract of Gardenia jasminoides Ellis fruits (Echtay et al.

2002; Zhang et al. 2006). The addition of genipin to pancreatic beta-cells has been shown to

increase mitochondrial membrane potential and increase ATP generation in a UCP2-dependent

manner (Zhang et al. 2006).

H+ H+ H+ H+ H+ Complexes I-IV H+ H+ H+ H+ H+ UCP2 H+ H+ ATP Synthase H+ H+ H+ H+ ADP ATP Figure 4: UCP2 in the Mitochondria. UCP2 is located on the inner mitochondrial membrane of the mitochondria. Uncoupling proteins are known to dissociate the electron transport chain from ATP synthase. Thus, instead of capturing the energy from the proton gradient to make ATP, uncouplers allow protons to bypass ATP synthase and dissipate energy in the form of heat.

1.4.4 Role of UCP2 in Insulin Secretion and Glucose Homeostasis UCP2 in pancreatic islets decreases metabolic efficiency by dissociating substrate

oxidation in the mitochondrion from ATP synthesis (Saleh 2002). Thus, the inhibition of UCP2

activity should lead to more efficient coupling and increased insulin secretion (Figure 5).

Classically, it has been well-accepted that UCP2 acts as a negative regulator of insulin secretion

(Saleh et al. 2001). Chan, et al. (1999) have demonstrated that adenoviral overexpression of the

full-length human UCP2 in normal rat islets leads to an inhibition of insulin secretion. On the

other hand, transient inhibition of UCP2 activity in pancreatic mouse islets using genipin leads to

an increase in insulin secretion (Zhang et al. 2006). Elaborate studies conducted using the global

13  

UCP2 knockout mice (UCP2 -/-) have shown that this model has higher islet ATP levels,

improved glucose tolerance and increased glucose stimulated insulin secretion compared to

wildtype controls (Zhang et al. 2001; Joseph et al. 2002). Thus, suggesting that deletion of

UCP2 may be metabolically protective. Also, UCP2-/- mice were placed on a high-fat diet

(HFD) to assess its role during the development of diet-induced type 2 diabetes. Interestingly,

UCP2-/- on the HFD had enhanced glucose sensitivity, increased beta-cell mass and insulin

content compared to WT mice after HFD (Joseph et al. 2002). Moreover, a myriad of clinical

studies looking at the -866G/A polymorphism in humans located in the UCP2 promoter increases

UCP2 expression and is associated with deficient insulin secretion and type-2 diabetes (Sesti et

al. 2003; D’Adamo et al. 2004; Gable et al. 2006).

However, recent studies have questioned the role of UCP2 as a negative regulator of

insulin secretion. Beta cell-specific overexpression of the human UCP2 gene in clonal cell lines

lead to the conclusion that UCP2 overexpression results in no changes to glucose-stimulated

insulin secretion, cytosolic ATP or mitochondrial membrane potential (Produit-Zengaffinen et al.

2007). Furthermore, Pi et al. (2009) have recently backcrossed the whole body UCP2 knockout

mice onto three different congenic strains, and concluded that the chronic absence of UCP2 lead

to persistent ROS accumulation and oxidative stress, which was accompanied by decreased

glucose-stimulated insulin secretion (Pi et al. 2009). On the contrary, Lee et al. (2009) found

that UCP2-/- mice also had increased ROS accumulation, however, this chronic elevation of

ROS was suggested to contribute to enhanced beta-cell function and attenuation of glucagon

secretion, resulting in a decreased STZ-stimulated hyperglycemia.

Moreover, pre-opiomelanocortin (POMC) neurons have been recently demonstrated to

play a prominent role in glucose sensing (Parton et al. 2007). Disruption of the KATP channel in

POMC neurons has been shown to impair the whole-body response to a systemic glucose load

(Parton et al. 2007). This mechanism was shown to involve UCP2, which was demonstrated to

negatively regulate glucose sensing and homeostasis in POMC neurons (Parton et al. 2007).

Considering the fact that UCP2 is expressed in the arcuate nucleus of the hypothalamus, it is

possible that the phenotype demonstrated in UCP2-/- could be explained by the deletion of UCP2

in the CNS (Saleh et al. 2001).

 

Figure 5or expressynthase,the closusecretion

1T

spotlight

antioxida

catalase a

antioxida

accumula

damage,

of ROS f

membran

superoxid

5: UCP2 as assion has bee, which lead

ure of KATP cn.

.4.5 UCP2The associatio

ed in severa

ant enzymes

are upregula

ants results i

ation of ROS

which result

formation, w

ne potential,

des and othe

a negative ren shown to

ds to higher Achannels, ope

2: Modulaton between

l studies. Th

(Pi et al. 20

ated, howeve

n impairmen

S is associate

t in necrosis

which occurs

electrons es

er species (C

regulator of result in inc

ATP productening of Ca2

tion of ROSUCP2 and R

he productio

009). Antiox

er, the combi

nts of cell fu

ed with oxid

and apoptos

at the electr

scaping from

Chen et al. 20

14 

insulin secrcreased couption. An inc2+ channels a

S & CytopROS, as deno

on of ROS re

xidant enzym

ination of ox

unction (Pi et

dative damag

sis. The mit

ron transport

m the ETC re

003). An inc

retion. The pling betweencrease in the and ultimatel

rotectionoted earlier,

esults in a co

mes such as s

xidative stres

t al. 1999; T

ge such as D

tochondria a

t chain (Figu

eact with free

crease in the

inhibition on the ETC aATP to ADPly leads to h

has been rec

ompensatory

superoxide d

ss and upreg

Table 1). A c

DNA lesions

are the predo

ure 6). Durin

e oxygen to

proton grad

of UCP2 actiand ATP P ratio resuligher insulin

cently

y response fro

dismutase, an

gulation of

chronic

and protein

ominant locat

ng increases

form

dient is direc

vity

lts in n

om

nd

tion

s in

ctly

15  

proportional to an increased production of ROS (Korshunov et al. 1997). Thus, a possible

physiological role of UCPs is that through uncoupling activity, these proteins lower the

mitochondrial membrane potential thereby decreasing ROS formation.

Table 1: The functional role of antioxidant enzymes in the pancreatic beta cell Enzyme Function & Location

Superoxide dismutase (SOD)

- Production of H2O2 and O2 from superoxides - Location: SOD1: cytoplasmic , SOD2: mitochondrial, SOD3:

extracellular

Glutathione Peroxidase (GPX)

- Reduction of H2O2 to H2O (water) - Location: GPX1: cytoplasmic/mitochondrial, GPX2:

extracellular , GPX3: extracellular, GPX4: preference for lipid hydroperoxides

Heme-oxygenase 1 (HO-1)

- Oxidation of Heme to generate biliverdin (potent scavengers of peroxyl radicals) and CO (carbon monoxide)

- Location: cytoplasmic

Catalase (CAT) - Also involved in thee decomposition of H2O2 to water (H2O) - Location: peroxisomes

Evidence has demonstrated that UCP2-controlled dissipation of the proton gradient

resulted in significantly lower ROS formation (Duval et al. 2002). In addition, ROS products

such as superoxides have been demonstrated to activate UCP2, where it is suggested that by

increasing uncoupling, further ROS production can be alleviated (Li et al. 2009). The

overexperssion of the UCP2 gene in pancreatic beta-cells has been associated with a decrease in

cytokine-induced production of ROS (Produit-Zengaffinen 2007). The presence of UCP2 has

also been associated with a cytoprotective role in extrapancreatic tissues. In skeletal muscle and

adipose tissue, UCP2 can protect against oxidative stress by regulating free fatty acid metabolism

and reduce ROS (Samec et al. 1998). In neurons, overexpression of UCP2 resulted in improved

resistance to apoptosis and neuronal dysfunction after ischemia (Mattiasson et al. 2003).

 

Figure 6is used toproton leresults in

It

in enhanc

enzymes

sensitive

Bindokas

necessary

isolated i

glucose-i

et al. 200

insulin se

provides

6: Proposed o move protoeak mechanisn reduced mi

t is importan

ced insulin s

compared to

to ROS sign

s et al. (2003

y to propaga

islets and a p

induced prod

07). Interest

ecretion (Pi e

a mechanism

role of UCPons into the ism, UCP2 mitochondrial

nt to note tha

secretion. C

o other tissu

naling (Bind

3) observed l

ate ROS sign

pancreatic be

duction of H

ingly, the ad

et al. 2007).

m to enhanc

P2 in cytoprintermembra

may serve a cROS produc

at in low leve

onsidering th

ues, this may

dokas et al. 2

low levels o

naling involv

eta-cell line

H2O2 lead to e

ddition of H2

Thus, these

e insulin sec

16 

rotection. Tane space to cytoprotectivction.

els, ROS ma

he fact that i

y render the i

2003; Pi et al

f SOD in be

ved in stimul

demonstrate

enhanced in

2O2 scavenge

e studies esta

cretion.

The energy frgenerate the

ve role by de

ay serve as a

islets expres

idea that the

l. 2007). Su

eta-cells, whi

lating insulin

ed that exoge

sulin secreti

ers such as c

ablish the fa

from the oxide PMF. By pecreasing the

signaling m

ss low levels

beta-cells ar

upporting thi

ich was prop

n secretion.

enous additio

ion (Armann

catalase were

ct that ROS,

dation of gluproviding a e PMF, whic

molecule to re

of anti-oxid

re highly

s notion,

posed to be

Studies in

on as well as

n et al. 2007;

e found to in

, at low leve

ucose

ch

esult

dant

s

; Pi

nhibit

ls,

17  

1.4.6 Alternate functions of UCP2 As these studies suggest, the precise physiological role(s) of UCP2 is still highly debated.

In fact, UCP2 has also been shown to be highly expressed in alpha-cells (higher expression than

beta-cells) and involved in maintaining alpha-cell function (Diao et al. 2008). Inhibiting UCP2

activity in alpha-cells was associated with higher mitochondrial membrane potential, increased

ATP synthesis, decreased glucagon secretion and alpha-cells were found to be more susceptible

to apoptosis (Diao et al. 2008). UCP2 has also been suggested to be involved in immune

function, where it controls macrophage activation by modulating the production of ROS (a

signaling molecule in the macrophage) and increasing nitric oxide production in macrophages

(Emre et al. 2007). Macrophages from UCP2 -/- mice were found to produce more ROS and the

mice were more resistant to infection than wildtype mice (Arsenijevic 2000). A study that

generated a combined knockout of the LDL receptor and UCP2 resulted in mice having

increased oxidative stress and higher susceptibility to atherosclerosis (Blanc et al. 2003). Thus,

considering the wide range of tissues that UCP2 is expressed in, it may have multiple roles

depending on the tissue being studied.

The role of UCP2 is extremely controversial and due to its wide range of tissue

expression, it is difficult to deduce it specific physiological role in the pancreatic beta-cell.

Table 2 summarizes the myriad of studies conducted thus far that relate UCP2 to both a role of a

positive as well as a negative regulator of islet function. The aim of this project is to elucidate

the role of UCP2 by creating a beta-cell specific knockout of UCP2. Thus, to specifically

understand the role of UCP2 in islet function, we generated a beta-cell specific knockout model

of UCP2 (UCP2BKO) using the cre-lox recombination system, which will be further discussed

below.

18  

Table 2: UCP2 and Islet function. A literature review of studies conducted so far relating the modulation of UCP2 expression with islet function. Most studies demonstrate that increased UCP2 activity or expression negatively regulates islet function – through reductions in mitochondrial membrane potential, ATP content and GSIS. However, recently it has been brought into contention that UCP2 activity may have an opposite and protective role in islets – through regulating mitochondrial ROS production.

  Method  Main Results 

NE

GA

TIV

E re

g. o

f isl

et fu

nctio

n Generation of UCP2-/-mice &

measuring metabolic parameters

Zhang et al. (2001); Joseph et al. (2002); Lee et al. (2009)

• UCP2-/- have improved glucose tolerance, ↑GSIS, ↑ATP content

• UCP2-/- on a HFD have superior beta-cell secretory capacity suggested to be in relation to ↑beta-cell mass

Adenoviral overexpression of UCP2 in rat islets

Chan et al. (2001)

• overexpression of UCP2 results in ↓glucose-stimulated mitochondrial membrane potential, ↓

ATP content, ↓GSIS Addition of compound

Genipin to isolated mouse islets

Zhang et al. (2006)

• Genipin associated with increased mitochondrial membrane potential, ↑ATP content, and ↑GSIS in a

UCP2-dependent manner Variation of -866G/A

polymorphism in clinical studies

Sesti et al. (2003); D’Adamo et al. (2004); Gable et al. (2006)

• -866G/A polymorphism in subjects associated with increased UCP2 transcriptional activity

• Associated with deficient insulin secretion and type-2 diabetes

Glucose sensing measured in POMC neurons of

hypothalamus in obese UCP2-/- mice

Parton et al. (2007)

• Neurons from UCP2-/- mice on HFD had superior glucose sensing and mice maintained glucose

homeostasis

POSI

TIV

E

Overexpression of human UCP2 gene in beta-cells of transgenic mice and INS-1

cell line Li et al. (2001); Produit-Zengaffinen (2007)

• no changes in GSIS, ATP/ADP ratio • ↓cytokine-induced production of ROS

Multiple low dose STZ-induced diabetes on UCP2-/-

mice Emre et al. (2007)

• relatively accelerated autoimmune diabetes in STZ-treated UCP2-/- mice, with ↑ macrophage infiltration

• STZ-treated UCP2-/- had ↑ inflammation in islets

Generation of UCP2-/- mice – backcrossed onto pure strains

Pi et al. (2009)

• Islets of UCP2-/- mice had ↑ levels of antioxidant enzymes

• Higher nitrotyrosine (biomarker for peroxinitrite) staining in islets

• Oxidative stress accompanied by ↓GSIS

19  

1.5 Cre-Lox Recombination system

1.5.1 Background

The cre-lox recombination system allows the recombination of two DNA sites

(loxP sites) by the enzyme cre recombinase and has revolutionized mouse genomic studies

(Nagy 2000). The advancements in mouse transgenics have allowed the addition of any selected

DNA fragment into ES (embryonic stem) cells, which can then be injected into blastocysts and

allowed to grow normally into mice. With the Cre-Lox recombination system, any genome

flanked by the two loxP sites can be excised, inverted or recombined between two DNA strands

in a tissue-specific manner (Nagy 2000). Thus, the study of knocking down a protein in any

specific tissue without the possibility of embryonic lethality is possible. Combining all of these

systems gives the tools to generate mice with any modification in their DNA.

The Cre recombinase is a 38 kD protein that comes from the virus P1 bacteriophage. Cre

recombinase recognizes two sets of 34 bp sequences called loxP sites and catalyzes

recombination between the sites. The 34 bp sequence consists of a core or spacer sequence that

is 8 bp long as well as two 13 bp palindromic sequences at either end (Hamilton & Abremiski

1984). The orientation of the loxP sites determines the outcome of the recombination. Cis loxP

sites (Figure 7, sites that are a direct repeat or in tandem) result in an excision or inversion of the

sequence. Trans sites (sites that are on different chromosomes) lead to an insertion of one DNA

segment into another or the exchange of DNA between two chromosomes (Nagy 2000). The

specific molecular mechanism of the recombination consists of the enzyme cre recombinase

binding to each of the palindromic halves of the loxP sites, bringing the sites together

(Voziyanov et al. 1999). After the formation of a tetramer, recombination occurs in between the

spacer area (Voziyanov et al. 1999).

 

Figure 7interest (palindromCre recom(Exon 2)

1

T

recombin

temporal

inducible

mice wer

with the R

(Nguyen

(RIP) seq

sequence

1998).

7: Cre-mediaExon 2) is flmic sequencmbinase bin resulting in

.5.2 RIP-Cre

The beauty of

nase and the

l regulation o

e promoters,

re used to ge

RIP-Cre has

2006). In o

quence was i

e of cre with

ated DNA rflanked by twes and one 8ds to the 13

n a covalently

e Model

f this mecha

precise inte

of cre recom

respectively

enerate beta-

s been shown

order to gene

isolated usin

a nuclear lo

recombinatiwo LoxP site8 bp spacer rbp sequencey closed circ

anism relies u

gration of lo

mbinase is po

y (Ray 1998

-cell specific

n to be extre

erate these m

ng restriction

ocalization si

20 

ion. The DNes. The LoxPregion wherees on both sicular molecu

upon the spe

oxP sites into

ossible throug

). In this stu

c knockouts (

emely power

mice, 668 nuc

n endonuclea

ignal (NLS)

NA segment P site is come the actual bites and exciule.

ecific transge

o the gene of

gh tissue-spe

udy, rat insul

(Figure 8).

rful and can b

cleotides of t

ase digestion

and a polya

transcribingmposed of twbreakage andises out the D

enic express

f interest. T

ecific promo

lin promoter

The range o

be as efficie

the Rat Insu

n and ligated

adenylation s

g the exon ofwo 13 bp

d ligation ocDNA segmen

sion of cre

he spatial or

oters or ligan

r-cre (RIP-C

f DNA excis

ent as 90%

ulin Promoter

d to the codin

signal (Ray

f

ccurs. nt

r

nd-

Cre)

sion

r

ng

 

Figure 8the ligatiwith a nu

T

expressed

in transcr

factors w

translatio

R

intoleran

backgrou

suggested

leads to a

secretion

makes it

deletion o

that if the

using RIP

control e

establishm

8: Schemeticon of 668 nu

uclear localiz

The RIP-Cre

d cre recomb

ribing insuli

will bind to th

on of any dow

Recent studi

nt and have im

und mice (Le

d to be cause

an islet hype

n (Pomplun e

difficult to a

of the protei

e knockout m

P-Cre mice a

liminates the

ment of a ph

c diagram oucleotide of zation signal

transgene w

binase in the

n or the beta

he Rat Insuli

wnstream pr

ies have dem

mpairments

ee et al. 2006

ed by a signi

erplasia in ol

et al. 2007).

ascertain wh

in or because

model or the

are valid (Le

e possibility

henotype dir

of the RIP-Cthe rat insull.

was then micr

e nucleus of

a-cells (Ray

in Promoter

roteins on th

monstrated th

in insulin se

6). Furtherm

ificant hypop

lder mice as

Thus, the pr

hether the ph

e of the RIP-

e test mice ar

ee et al. 2006

y of seeing an

ectly due to

21 

Cre transgenin promoter

roinjected in

any cell that

1998). Thu

on the trans

he gene (Ray

hat mice with

ecretion whe

more, the glu

plasia of bet

a compensa

resence of a

henotype obs

-Cre transge

re compared

6; Pomplun

ny confound

the deletion

ne. The transequence to

nto a one-cel

t contains tra

s, the insulin

gene and all

y 1998).

h the RIP-Cr

en compared

ucose intoler

ta-cells in th

atory respons

phenotype i

served in a k

ene. Howeve

d to Cre posit

et al. 2007).

ding effects a

n of the prote

nsgene was co the coding

ll embryo to

anscription f

n-transcribin

low the trans

re transgene

d to a wildtyp

rance seen in

e mice, whic

se to impaire

in the RIP-C

knockout mou

er, there is o

tive controls

Using RIP-

and allows fo

ein.

constructed bdquence of c

create mice

factors invol

ng transcripti

scription and

e are glucose

pe, C57BL/6

n the mice w

ch eventually

ed insulin

Cre model alo

use is due to

verall conse

s, then studie

-Cre mice as

for the accura

by cre

that

ved

ion

d

e

6

was

y

one

o the

ensus

es

s a

ate

22  

1.6 General Hypothesis

The objective of this project was to elucidate the specific physiological role of UCP2 in

the pancreatic beta-cell. Considering UCP2’s broad tissue expression, its function may also vary

depending on the tissue being studied and the UCP2-/- model may have been too simple to

establish a confirmed role of UCP2 in a specific tissue. So far, studies in whole body knockout

models resulted in further debate of UCP2’s function and there has been no consensus on

function. The role of UCP2 in the beta-cell in terms of insulin secretion has been well described,

however, recent studies have also suggested UCP2 having a cytoprotective function against

oxidative stress. Thus, UCP2’s function in the beta-cell is still questionable and it is imperative

to study its role without any compensatory effects. Therefore, it is essential to create a beta-cell

specific UCP2 knock out (UCP2BKO) model to determine the independent effect of deleting

UCP2 in the beta-cell. We hypothesize that UCP2 negatively regulates beta-cell function and

the deletion of UCP2 specifically in the beta-cells will result in higher efficiency of oxidative

phosphorylation leading to increased ATP production and enhanced insulin secretion.

The specific Aims of this project were to:

1) Generate a beta-cell specific knockout model of UCP2 (UCP2BKO)

2) Confirm efficient deletion of UCP2 in the Beta-cells

3) Characterize the in vivo metabolic parameters of UCP2BKO

4) Characterize in vitro beta-cell function of the UCP2BKO

 

 

 

 

 

 

 

23  

Chapter 2: Creation and In Vivo characterization of β-Cell Specific Knockout of UCP2 (UCP2BKO)

2.1 Hypothesis

In this study, beta-cell specific knockout of UCP2 (UCP2BKO) will be generated using the

Cre-Lox recombination system and various in vivo metabolic parameters will be measured. We

hypothesize that cre-lox recombination using the RIP-Cre model will result in effective deletion

of UCP2; specifically from the beta-cells.

Overwhelming evidence in the past has demonstrated that UCP2 provides a proton leak

mechanism to dissipate the proton motive force, which leads to less efficient production of ATP

resulting in a decrease in insulin secretion (Chan et al. 1999; Zhang et al. 2001; Joseph et al.

2002; Zhang et al. 2006). Thus, it is proposed that deleting UCP2 will result in more efficient

coupling between substrate oxidation and ATP synthase leading to increased ATP generation and

enhanced insulin secretion. Thus, we hypothesize that UCP2 is a negative regulator of insulin

secretion and the in vivo phenotype of the UCP2BKO model will reflect this accordingly; with

no differences in body weight, improved glucose tolerance and increased glucose-stimulated

insulin secretion.

2.2 Method and Materials 2.2.1 Reagents

RedTaq polymerase (Sigma D4309) was used for Multiplex PCR. All primers were

ordered from invitrogen (Canada) and sequences are listed in Table 3 & 4. Islets were isolated

using Collagense type-V (Sigma, Canada). The monoclonal Cre antibody was obtained from

Covance (USA) and the polyclonal UCP2 antibody was purchased from Everest Biotech (UK).

Guinea pig anti-swine insulin (Dako), fluorescein (FITC)- and cyanine (Cy5)-labeled secondary

antibodies (Jackson ImmunoResearch, USA) were also used.

2.2.2 Animal Breeding

The loxP sites were integrated between the start codon sequence of the UCP2 gene; one

upstream of exon 3 and one downstream of exon 4. Exon 1 and 2 of the UCP2 gene are

untranslated exons (Pecqueur et al 1999). Although 3 ATG sites have been found in exon 2,

 

these site

UCP2 (P

which co

introduce

vector wa

these cell

mouse bl

were gen

Figure 9representATG) andeletion o

T

mice: mi

specific g

specific k

(RIP)-Cr

have a co

are loxUC

have exo

(Figure 9

es have been

Pecqueur et a

ontained a se

ed downstrea

as then intro

ls to remove

lastocysts an

nerated.

9: Recombinted as boxes

nd exon 4. Cof exon 3 an

The strategy t

ce that expre

gene in ques

knockouts of

re mice to cre

opy of cre (c

CP2 homozy

ons 3 and 4 o

9).

n shown not t

al 1999). A t

election casse

am of exon 4

oduced to ES

e the selectio

nd mice cont

nation via C. LoxP sites

Cre will recognd 4 from the

to generate b

ess cre recom

stion flanked

f UCP2, hom

eate F1 gene

cre+). These

ygotes with

of the UCP2

to influence

targeting vec

ette (NEO-T

4 with a thir

S cells and a

on cassette.

taining the U

Cre recombis were integrgnize the Loe gene, resul

beta-cell spe

mbinase in a

d by loxP site

mozygote Lo

eration mice

F1 generatio

a copy of Cr

gene deleted

24 

the initiation

ctor using th

TK) flanked b

d LoxP site

plasmid con

The targeted

UCP2 gene w

nase. The wrated aroundoxP sites andlting in no U

ecific knocko

a tissue-speci

es. For exam

oxUCP2 (UC

which are h

on mice wer

re (UCP2fl/flc

d and therefo

n site in exo

he mouse UC

by loxP sites

upstream of

ntaining Cre

d cells were

with two loxP

wildtype alled exon 3 (thed cause recom

UCP2 mRNA

outs requires

ific manner

mple, in orde

CP2fl/fl) are b

heterozygous

re further bre

cre+). The U

ore generate

on 3 for the tr

CP2 gene wa

s. This vect

f exon 3. Th

cDNA was

then microin

P sites aroun

ele of UCP2 e location of mbination, r

A being trans

s two types o

and mice tha

er to generat

bred to Rat I

s for loxUCP

ed to generat

UCP2fl/flcre+

the UCP2B

ranslation of

as constructe

tor was

he targeting

transfected i

njected into

nd exon 3 an

with exons the start codesulting in thscribed.

of transgenic

at have the

te the beta-ce

nsulin prom

P2 (UCP2fl/+

te F2 mice th

mice should

BKO mice

f

ed,

into

nd 4

don - he

c

ell

moter +) and

hat

d

25  

The UCP2lox homozygote mice that also express Cre in beta-cells should have exons 3

and 4 of the UCP2 gene deleted, which excises the start codon, and therefore generates

UCP2BKO mice. In vivo and ex vivo analysis will be conducted on these mice and compared to

the controls; RIP-Cre. Using RIP-Cre mice as controls should account for any effects of this

transgene alone. The oral glucose tolerance test was also conducted in floxed controls (mice that

were homozygote for loxUCP2 with no cre) to confirm that differences observed in glucose

tolerance between the UCP2BKO and RIP-Cre mice were due to the deletion of UCP2 in beta-

cells. Studies have shown that RIP-Cre mice are glucose intolerant, and thus it was imperative to

compare the OGTT values against another control to ascertain that results obtained were not

solely due to the presence of the RIP-Cre transgene. All animal experiments were approved by

the Animal Care Committee at the University of Toronto and animals were handled according to

the guidelines of the Canadian Council of Animal Care.

2.2.3 Pancreatic islet isolation and culture Mice were anesthetized by intraperitoneal injection of approximately 250 mg/kg of

tribromoethanol. The pancreas was perfused with collagenase type-V (0.8 mg/ml) in RPMI-

1640 (supplemented with 11.1 mM glucose) with 2% bovine serum albumin and 1% penicillin

and streptomycin. The collagenase solution was perfused into the pancreas via the common bile

duct. The perfused pancreas was then extracted from surrounding tissues and digested for 15

min at 37 °C. RPMI-1640 media stored at 4 °C was added to arrest the digestion process and

islets were then manually picked using a dissection microscope. In order to allow complete

recovery, islets were cultured overnight in a 37 °C, 5% CO2 incubator.

2.2.4 Islet cell dispersion Isolated islets were washed in phosphate buffered saline (PBS) with 2mM EGTA.

Dispersion of islets was carried out with 0.125% dispase II (Roche Diagnostics) for 5 min at

37°C with gentle mixing with a pipette. The addition of RPMI-1640 media with 10% fetal

bovine serum arrested the further dispersion of islets. Islet cells were then resuspended with

fresh media and plated on a glass coverslip, which was coated with poly-L-lysine solution

(Sigma). The coverslips were placed in a 37 °C, 5% CO2 incubator and the cells allowed to

attach before further experiments.

26  

2.2.5 RNA extraction & Reverse Transcription of animal tissues Mice were anesthetized using the protocol previously mentioned and tissues (spleen,

hypothalamus, small intestine, brain, kidney, etc) were isolated, washed in PBS and flash-frozen

using dry ice and stored in – 80 °C until further use. Prior to extraction, tissues were

homogenized either manually (vigorously mixing with a pipette) or using an electronic polytron.

RNA was extracted using the TRIzol (Invitrogen) reagent and following the manufacturers’

protocol. Reverse transcription to make cDNA was completed using Invitrogen’s Superscript II

kit and also following the manufacturers’ protocol.

2.2.6 DNA Extraction & Multiplex PCR Genotyping of the mice was completed using tail DNA and standard multiplex PCR. Tail

clips were digested overnight using a DNA lysis buffer on a waterbath (100 mM of Tris, 5 mM

of EDTA, 0.2% SDS, 200 mM NaCl ) at 37 °C. Subsequently, tail samples were vigorously

mixed with a 50% chloroform and 50% phenol solution for 1 hour and then spun at 13 000 rpm

for 10 min. The supernatant, which contained the DNA, was removed into a new tube to which

isopropanol was added. After another spin at 13 000 rpm for 10 min, the DNA was found as a

pellet on the tube and a final wash with 70% ethanol was conducted. Tubes were then air dryed

for approximately 2 hrs and 50 ul of water was added to redissolve the DNA. PCR was

conducted to determine the presence of the cre transgene as well as the zygosity for loxUCP2

using RedTaq DNA polymerase (Sigma-Aldrich, Canada) and an annealing temperature of 59 °C

and 62 °C, respectively. Sequences for cre and loxUCP2 genotyping are listed below in Table 3.

PCR products were run on 1.2% agarose gel (with 0.1% ethidium bromide) to identify the

amplification of a 380 bp for loxUCP2, 270 bp band for a wt UCP2 gene, and the presence of a

250 bp band representing cre recombinase.

2.2.7 Real-time PCR Quantification of mRNA expression was performed using a SYBR green detection

system (SYBR Green PCR Master Mix, Applied Biosystems). The real-time PCR conditions

were 2 min at 50°C, 10 min at 95°C, and then 40 cycles for 15 s at 95°C and 1 min at 53°C. Melt

27  

curve analysis showed that the primer set amplified one product. Expression was normalized to

β-actin (a housekeeping gene) levels. Sequences for RT-PCR are listed below in Table 3.

Table 3: Primer sequences for Genotyping and RT PCR.

Primers Fwd Rev Cre

(genotyping) GGCAGTAAAAACTATCCAGCAA GTAAAGACCCCTAACGAATATTG

LoxUCP2 (genotyping)

ACCAGGGCTGTCTCCAAGCAGG AGAGCTGTTCGAACACCAGGCCA

UCP2 (qRT PCR)

CAGCCAGCGCCCAGTACC CAATGCGGACGGAGGCAAAGC

β-Actin (qRT PCR)

CTGAATGGCCCAGGTCTGA CCCTGGCTGCCTCAACAC

2.2.8 Immunostaining and immunofluorescence confocal microscopy Dispersed islets were fixed with 4% paraformaldehyde for 15 min and then permeabilized

with 0.2% Triton X-100 in PBS for 10 min. After, cells were placed in blocking solution (5%

BSA, 0.1% Triton X-100 dissolved in PBS) at 4 °C overnight. Cells were then incubated with

primary antibodies (1:100, 1:500 and 1:200 dilutions for anti-UCP2, anti-cre, anti-insulin,

respectively) overnight at 4 °C. After washing with PBS, dispersed islets were incubated with

secondary antibodies (fluorescein-conjugated affinity-purified or cyanine-5 labeled). A drop of

ProLong Gold antifade reagent (Invitrogen) was placed before mounting with a coverslip.

Confocal laser scanning microscopy analysis using a Zeiss LSM 510 microscope (Zeiss,

Germany) was used to detect fluorescent staining.

2.2.9 Weight & Blood glucose measurements Weight and fasting blood glucose concentration of mice was measured on a weekly basis

between 3 and 13 weeks of age of the mice. After a 6-hour fast, blood was obtained from the tail

vein and glucose was measured with a LifeScan Elite glucose meter (Toronto, ON, Canada).

2.2.10 Fasting Glucagon Measurements After a overnight (14-hour) fast, blood samples were collected in EDTA covered tubes

and centrifuged (at 10 000 rpm for 10 min) to obtain plasma from the supernatant. Plasma

28  

glucagon was measured using a Linco Research Radioimmunoassay (RIA) kit and following the

manufacturers’ protocol.

2.2.11 Measurement of glucose tolerance Glucose tolerance was measured using two different methods of glucose infusion: either

an intraperitoneal injection or an oral gavage of glucose. Intraperitoneal glucose tolerance tests

(ipGTT) were carried out at 12 weeks of age in both males and females. Following a 6-hour fast,

an exogenous load of glucose (2 g/Kg of body weight) was injected intra-peritoneally and blood

glucose levels were measured at 0, 2, 5, 15, 30, 60, 120 minutes after injection.

Oral glucose tolerance tests (OGTT) were also carried out at 12 weeks of age in both

males and females. Following a 12 to 16-hour overnight fast, an exogenous load of glucose

(2g/Kg) was given with an oral gavage and blood glucose levels were measured at 0, 10, 20, 30,

60, 120 minutes. Blood samples were collected at 0, 10, 20 and 60 minutes to measure plasma

insulin concentration in 5uL samples using an ALPCO Ultrasensitive ELISA kit (ALPCO

diagnostics, NH, USA) and following the manufacturers protocol.

2.2.12 Measurement of insulin sensitivity Insulin sensitivity was measured by an intraperitoneal insulin tolerance test (ipITT) on 13

weeks-old male and female mice. Following a 4-hour fast, an exogenous load of insulin (0.75

IU/Kg of body weight) was injected intra-peritoneally and blood glucose levels were measured at

0, 15, 30, 60, 120 minutes after injection.

2.2.13 Statistical Analysis Statistical significance was assessed by using either the Student’s t test (GraphPad Prism 4)

or a one- or two-way ANOVA for repeated measures followed by a Bonferroni post-test

comparisons using GraphPad Prism 4. A p-value of less than 0.05 was considered significant.

All data is expressed as the mean ± SE.

 

2.3 Res 2.3.1 G

In

extraction

that the a

wildtype

was used

the cre tr

mice.

Figure 1mouse tathe presewas also to ensure 2.3.2 C

C

cell-spec

islets, bra

been prev

hypothal

in these t

mouse w

sults

Genotypingn order to es

n followed b

amplification

mouse, and

d as a negativ

ransgene was

1: Genotyp

ail samples uence of the cr

conducted oe the absence

Cre mRNA Cre expressio

cific deletion

ain, and hyp

viously show

amus (Choi

tissues. As a

were also extr

g tablish the z

by standard m

n of a band o

d both bands

ve control to

s also ascert

ing for Loxusing primersre transgeneon DNA frome of false pos

expressionon was detec

n of UCP2 (F

othalamus o

wn to be exp

et. al. 2008)

a control, tis

racted to sho

zygosity for l

multiplex PC

of 380 bp wa

represented

o confirm wh

ained using

xUCP2 and Cs that amplif. The bandsm a mouse wsitives.

n cted by multi

Figure 12). F

of the UCP2B

pressed in ins

), thus, the pr

sues from a

ow that there

29 

loxUCP2 an

CR was cond

as a homozy

a heterozyg

hether there a

PCR, where

Cre. PCR wfied bands tos amplified wwithout the c

iplex PCR in

Figure 12 sh

BKO model

sulin-transcr

resence of cr

cre-negative

e were no fal

nd the presen

ducted (Figu

gous mouse

gous mouse.

are any false

e a 250 bp ba

was conducteo look for thewere run on cre transgene

n islets as we

hows that the

. The 668 bp

ribing neuron

re recombin

e (a homozy

lse-positives

nce of cre in

ure 11). Figu

for loxUCP

A PCR sam

e positives.

and represen

ed on DNA e zygosity foa 1.2% agaroe as well as a

ell as other t

e cre band w

p RIP-Cre tr

ns in the bra

nase needed t

ygote loxUCP

s. In order to

mice, DNA

ure 11 illustr

P2, 270 bp fo

mple with wa

The presenc

nted cre-posi

obtained froor LoxUCP2ose gel. PCRa sample of w

tissues to con

as found in t

ransgene has

ain and

to be confirm

P2; floxed)

o test the

rates

or a

ater

ce of

tive

om 2 and R water

nfirm

the

s

med

30  

integrity of the tissue DNA, the expression of beta-actin was determined to confirm the presence

of DNA.

Figure 12: Cre expression in cDNA of multiple tissues. Tissues extracted from the control Floxed (panel A) and UCP2BKO (panel B) mice underwent RNA extraction and reverse transcription to make cDNA. PCR on these cDNA samples was conducted to look for cre expression. A band for cre (250 bp) was observed in the islets, brain and hypothalamus of UCP2BKO mice. The positive and negative controls used were cre-positive and cre-negative tail clip DNA, respectively. Beta-Actin was detected as a positive control for DNA integrity.

2.3.3 Effective deletion of UCP2 mRNA & protein RT-PCR results showed that UCP2 mRNA expression was significantly decreased by

approximately 75% in whole islets (p < 0.05), with no change in hypothalamic UCP2 mRNA

expression (Figure 13 B). However, the relative deletion of UCP2 in the beta cells might be

masked by the high expression of UCP2 in the alpha-cells (Diao et. al. 2005). There was no

change in the expression of UCP2 in the hypothalamus and the level of expression relative to

Beta-actin was very similar in the two tissues.

A

B

 

Figure 1(A) and tnormaliz 

D

islets for

was illus

insulin to

protein w

Figure 14

illustrate

A

3: Gene expthe Hypothalzed to beta-ac

Deletion of th

insulin (cell

trated in yel

o confirm tha

was detected

4). Disperse

d to be local

pression forlamus (B) ofctin levels.

he UCP2 pro

ls stained in

low. Disper

at there was

in less than

ed islets from

lized in the n

r UCP2. mRf 12-week ol* p < 0.05, n

otein in the b

green) and U

rsed islets fro

no UCP2 de

10% of insu

m UCP2BKO

nucleus (bott

31 

RNA expressld UCP2BKn = 5-7, Stud

beta-cell was

UCP2 (cells

om RIP-Cre

eletion detec

ulin-positive

O were also c

tom panel, F

B

sion was quaKO and RIP-C

dent’s t-test.

s confirmed

stained in re

e controls we

cted (top pan

cells from U

co-stained fo

Figure 14).

antified for UCre mice. A

by co-stainin

ed); where c

ere stained fo

nel, Figure 1

UCP2BKO m

or insulin an

UCP2 in IsleAll data was

ng dispersed

co-localizatio

or UCP2 and

4). UCP2

mice (top pa

nd cre; which

 ets

d

on

d

anel,

h was

 

                  

Figure 1mice werimages stCre Reco

2.3.4 BC

deleting U

body wei

glucose i

that the U

accumula

UCP2 in

UCP2BK

& B).

                    

4: UCP2 prre immunosttained for Crombinase. M

Body Mass Considering t

UCP2 in the

ight (Enerba

in peripheral

UCP2BKO m

ation due to

beta-cells re

KO and RIP-

rotein expretained for UCre (red) and

Merged imag

& Fastingthe role of U

e beta-cells h

ack et al. 199

l tissues such

model has en

improved st

esulted in no

-Cre controls

ession in isleCP2 (red) anInsulin (gre

ges are show

g Blood GluUCP1 in therm

has a similar

97). Moreov

h as muscle

nhanced insu

torage of glu

o differences

s up to 13 w

32 

ets. Dispersnd insulin (gen) in the bo

wn by yellow

ucose mogenesis, i

function in

ver, insulin s

and adipose

ulin secretion

ucose in perip

s in weekly b

eeks of age i

ed islets of Rgreen) in the ottom panel .

it was imper

thermogene

secretion stim

(Burcelin 2

n resulting in

pheral tissue

body weight

in both male

RIP-Cre andtop panel. Ushow nuclea

rative to dete

sis, leading

mulates the s

008). It cou

n a higher bo

es. In this st

accumulatio

es and femal

 

d UCP2BKOUCP2BKO ar localisatio

ermine wheth

to affects on

storage of

uld be possib

ody weight

tudy, deletin

on between

les (Figure 1

O

on of

her

n

ble

g

5 A

 

Figure 1weeks of

P

glucose l

were con

(Figure 1

and contr

Figure 1collectedmales (A 2.3.5 P

C

Pi et al. 2

mice usin

levels be

A

A

5: Weekly bf age, n = 8 –

revious stud

levels compa

nducted after

16). Howeve

rol mice for

6: Fasting bd from the taiA) and female

Plasma InsuConsidering U

2009), fastin

ng an ELISA

tween UCP2

body weight– 10, Studen

dies have sho

ared to contr

r a 6-hour fa

er, equivalen

both sexes (

blood glucosil vein of mies (B) mice b

ulin & PlaUCP2’s pote

ng plasma ins

A kit (Alpco,

2BKO (0.52

t measuremnt’s t-test.

own that who

rols (Zhang e

st on male a

nt blood gluc

(Figure 16 A

se measuremice and glucobetween 3 a

asma Glucaential role as

sulin levels w

, USA). No

± 0.08 ng/m

33 

ments (g) in m

ole body kno

et. al. 2001).

nd female m

cose values w

A & B).  

ments. Aftose was meand 13 weeks

agon s a regulator

were measur

significant d

mL) and RIP

B

B

males (A) an

ockouts of U

. Fasting blo

mice between

were observ

er a 6-hour fasured usings of age, n =

of insulin se

red in 12-we

differences w

-Cre control

nd females (B

UCP2 have lo

ood glucose

n 3 and 13 w

ed between

fast, blood sa an Elite glu 8-10, Stude

ecretion (Jos

eek old male

were observe

ls (0.47 ± 0.

B) from 3-13

ower blood

measuremen

weeks of age

the UCP2BK

amples wereucometer in ent’s t-test.

seph et al. 20

e and female

ed in insulin

.04 ng/mL) f

3

nts

KO

e

002;

n

for

 

males (Fi

ng/mL in

Figure 1an overnicovered tRIA kit,

D

regulate g

levels we

were obs

versus RI

different

pg/mL, F

A

igure 17A).

n UCP2BKO

7: Fasting Pight fast. Bltubes. Aftern = 8 – 10, S

Diao et al. (20

glucagon sec

ere measured

served in ma

IP-Cre: 76.9

between fem

Figure 18B).

Similarly, e

O versus 0.49

Plasma Insulood samplesr centrifugatiStudent’s t-te

008) have sh

cretion in th

d in 10-week

ales between

94 ± 8.48 pg/

male UCP2B

equivalent in

9 ± 0.02 ng/m

ulin levels ats were collecion, plasma est.

hown that UC

e global kno

k old mice af

the two grou

/mL). As w

BKO (103.60

34 

nsulin levels

mL in RIP-C

t 12 weeks octed from thwas collecte

CP2 is highl

ockout (UCP

fter an overn

ups (Figure

ell, plasma g

0 ± 11.71 pg

B

were observ

Cre controls)

of age in malhe tail vein oed and gluca

ly expressed

P2-/-). Thus,

night fast (14

18A, UCP2B

glucagon lev

g/mL) and RI

ved in femal

).

les (A) and ff mice and ingon was me

d in the alpha

, fasting plas

4 hour fast).

BKO: 84.17

vels were not

IP-Cre mice

es (050 ± 0.0

females (B) nto EDTA asured using

a-cells and m

sma glucago

No differen

7 ± 12.45 pg/

t significantl

(115.23 ± 1

02

after

g an

may

on

nces

/mL

ly

10.49

 

Figure 1overnightubes. An = 8-10,

2.3.6 AM

2001; Jos

week old

Interestin

and fema

analyzed

the entire

min) sho

min, Figu

mmol/L*

mmol/L*

A

8: Fasting Pht fast. BloodAfter centrifu

, Student’s t-

Assessing GMice with UC

seph et al. 20

d male and fe

ngly, no diffe

ale UCP2BK

d by calculati

e span of the

wed a simila

ure 19B). Si

*120 min) w

*120 min, Fi

Plasma Glud samples w

ugation, plasm-test.

Glucose tolCP2 globally

002). Thus,

emale UCP2

ferences were

KO and RIP-

ing the incre

e test. Howe

ar response t

imilarly, AU

were not statis

igure 19D).

cagon in 10were collected

ma was colle

lerance: ipy knocked ou

an ipGTT w

2BKO mice c

e observed a

Cre controls

emental AUC

ever, male U

to glucose as

UC results in

stically diffe

35 

-week old md from the taected and glu

pGTT & OGut have impr

was conducte

compared to

after an injec

s (Figure 19A

C, which ass

UCP2BKO m

s the RIP-Cr

n female UCP

erent from th

B

males (A) andail vein of mucagon was

GTT roved glucos

ed to assess

o RIP-Cre aft

ction of 2g/K

A & C). The

sesses the ov

mice (1021.14

re mice (119

P2BKO mic

he RIP-Cre c

d females (Bmice and into

measured u

se tolerance

glucose tole

fter a 6-hour

Kg of glucos

e ipGTT resu

verall glucos

4 ± 194.07 m

98.95 ± 168.5

ce (1781.58 ±

controls (158

B) after an o EDTA coatsing an RIA

(Zhang et al

rance in 12-

fast.

e between m

ults were fur

e clearance o

mmol/L*120

52 mmol/L*

± 116.10

86.74 ± 253.

ted A kit,

l.

male

rther

over

0

120

76

 

 

Figure 1week oldto glucosin femalemeasure Student’s

M

was perfo

through t

stimulate

because o

insulin se

2g/Kg of

showed s

± 71.19 m

± 59.05 m

A

C

9: Glucose d Males (A) ase (A) as asses (C & D). glucose wers t-test.

Moreover, to

ormed using

the gut resul

e insulin secr

of the ‘incre

ecretion. Af

f glucose. Im

significantly

mmol/L*120

mmol/L*120

Tolerance Tand Femalesessed by areA 2g/Kg of

re collected f

confirm resu

g an oral gav

ting in the re

retion (Creut

tin’ effect an

fter an overn

mpaired gluc

y higher incre

0 min versus

0 min, Figure

Test; ipGTTs (C). ipGTTea under the f glucose wasfrom the tail

ults obtained

vage infusion

elease of inc

tzfeldt et al.

nd may be im

night fast, 12

cose toleranc

emental AUC

s RIP-Cre: 49

e 20 A & B)

36 

T. AssessingT in male micurve (B). Ss injected aftl vein, n = 10

d from the ip

n. Oral supp

cretin hormo

1985). Thu

mportant in d

2-week old m

ce was obser

C values com

94.46 ± 53.3

). Interesting

B

D

g glucose tolice resulted Similarly, nofter a 6-hour 0-15, ipGTT

pGTT, a seco

plement allow

nes such as

us, an augme

deciphering

male and fem

rved in the U

mpared to co

34 mmol/L*

gly, a more e

lerance within no differeo differencesfast and blo

T: two-way A

ond test of g

ws the gluco

GLP-1 and G

ented insulin

any subtle d

male mice we

UCP2BKO m

ontrols (UCP

120 min and

exaggerated

h an ipGTT iences in resps were obser

ood samples ANOVA, iAU

glucose toler

ose to pass

GIP that furt

n secretion oc

differences in

ere gavaged

male mice as

P2BKO: 834

d Floxed: 492

difference w

n 12-

ponse rved to

UC:

rance

ther

ccurs

n

with

they

4.12

2.04

was

 

observed

glucose a

analysis f

mmol/L*

(504.866

 

Figure 2Males shmore exa* p < 0.0ANOVA,

In

and fema

after oral

tolerance

A

C

d between the

at 10, 20, 30

for the fema

*120 min) th

6 ± 125.88 m

20: Glucose how a slightlyaggerated dif05, ** p < 0.0

bonferroni p

n vivo glucos

ale mice. Ins

l gavage usin

e observed in

e UCP2BKO

, and 60 min

ales resulted

han RIP-Cre

mmol/L*120

tolerance tey significantfference betw01, *** p < post-test.

se-stimulate

sulin was me

ng an ELISA

n males did n

O and RIP-C

nutes after ga

in a signific

(511.79 ± 3

min, Figure

est; OGTT.t impaired glween the tes0.001, n = 1

d insulin sec

easured in b

A kit (ALPC

not translate

37 

Cre female m

avage (Figur

cantly higher

1.52 mmol/L

20D).

Oral glucoslucose tolerat mice and c

10-15. OGT

cretion was a

lood sample

O, USA). In

into differen

B

D

mice with sig

re 20C). As

r value in UC

L*120 min)

se tolerance ance (A & Bcontrols (C &TT: two-way

also assessed

es collected a

nterestingly,

nces in insul

nificant diff

well, the inc

CP2BKO (88

and Floxed

tests in 12-wB) with fema& D). ANOVA, iA

d during the

at 0, 10, 20,

, the impaire

lin secretion

ferences in b

cremental A

86.67 ± 72.5

controls

week old micles showing

AUC: one-wa

OGTT in m

and 60 minu

ed glucose

n and equival

lood

AUC

50

ce. a

ay

male

utes

lent

 

values w

Cre: 32.8

Similarly

1.28 ng/m

ng/mL*6

Figure 2(C & D).RIP-Cre * p < 0.0ANOVA, 2.3.7 IT

T

sensitivit

insulin in

intoleran

periphera

A

C

ere observed

80 ± 2.56 ng/

y, no differen

mL*60 min)

60 min, Figu

21: Glucose- No differencontrols for

05, ** p < 0.0bonferroni p

TT To further un

ty was assess

n tissues such

nce cannot be

al tissues ma

d for AUC a

/mL*60 min

nces in term

and control

ure 21 C & D

-stimulated nces were obeither sex, n

01, *** p < post-test.

nderstand the

sed by an ipI

h as the live

e explained b

ay further cla

analysis (UC

n, Floxed: 31

s of GSIS w

s (RIP-Cre:

D).

insulin secrbserved in ten = 4 - 7. 0.001, n = 1

e impaired gl

ITT. An ipI

r, muscle an

by impairme

arify the into

38 

P2BKO: 40.

1.51 ± 1.81 n

were observed

32.62 ± 1.08

retion after aerms of insul

10-15. OGT

lucose tolera

ITT gives a m

nd adipose (F

ents in insuli

olerance obs

B

D

.48 ± 1.22 ng

ng/mL*60 m

d between fe

8 ng/mL*60

an OGTT in lin secretion

TT: two-way

ance observe

measure of p

Ferrannini 19

in secretion,

erved. A 0.7

g/mL*60 mi

min Figure 2

emale UCP2

min, Floxed

Males (A &n between UC

ANOVA, AU

ed during the

peripheral re

998). Thus,

insulin resis

75 IU/Kg of

in versus RIP

21 A &B).

2BKO (32.11

d: 33.32 ± 1.

& B) and femCP2BKO an

UC: one-way

e OGTT, ins

esistance to

if glucose

stance in

f insulin was

P-

1 ±

.76

males nd

y

sulin

s

 

injected i

significan

mmol/L

Similarly

female m

respectiv

Figure 2Female (injected iglucose a* p < 0.0

A

C

intraperitone

nt difference

*120 min ve

y, no differen

mice (574.74

vely, Figure 2

22: IntraperB) UCP2BKintraperitoneat 0, 15, 30, 05, ** p < 0.0

eally in 13-w

es were obse

ersus 518.02

nces were ob

± 31.15 mm

22 C & D).

ritoneal insuKO and RIP-eally and blo60 and 120 m01, *** p <

week old mal

erved betwee

± 36.95 mm

bserved in in

mol/L *120 m

ulin toleranc-Cre mice. Aood samplesminutes afte0.001, n = 8

39 

le and femal

en UCP2BK

mol/L *120 m

nsulin sensiti

min versus 5

ce tests condAfter a 4 hous were collecer injection.8 - 10. ITT:

B

D

le mice after

KO and RIP-C

min respectiv

ivity betwee

15.89 ± 38.6

ducted in 13ur fast, a 0.7cted from the

two-way AN

r a 4 hour fas

Cre males (5

vely Figure

en UCP2BKO

67 mmol/L *

-week old M5 IU/Kg of ie tail vein to

NOVA, AUC

st. No

540.68 ± 15.

22A & B).

O and RIP-C

*120 min

Male (A) andinsulin was o measure

: Student’s t

87

Cre

d

t-test.

40  

Chapter 3: Characterization of UCP2BKO: In Vitro Analysis 3.1 Hypothesis

In order to fully understand the physiological role of UCP2 in the beta-cell, further analysis

of isolated UCP2BKO islets was required. As previously mentioned, reduced expression of

UCP2 in the beta-cell has been associated with both a negative regulation of insulin secretion as

well as an increased accumulation of ROS and oxidative stress (Chan et al. 1999; Zhang et al.

2001; Mattiasson et al. 2003; Pi et al. 2009). To address both sides, further functional studies to

assess islet function were conducted.

In Vitro islet studies to examine glucose-stimulated insulin secretion, islet ATP content,

mitochondrial membrane potential, and oxidative stress were performed. We hypothesized that

UCP2 will be a negative regulator of islet function and deletion of UCP2 will result in increased

efficiency of oxidative phosphorylation leading to superior islet function. We predict that

UCP2BKO will have enhanced glucose-induced mitochondrial membrane potential, increased

beta-cell secretory capacity, higher islet ATP content, and no differences in ROS accumulation.

3.2 Method and Materials

3.2.1 Reagents Rh123 for membrane potential studies, Carboxy-dichlorofluorescein (DCF) for ROS

measurements and a Luciferase ATP kit were all obtained from Sigma-Aldrich (USA). Insulin

RIA kits were ordered from Linco Research (USA). Quantitave RT-PCR primers for anti-

oxidant enzymes were ordered from Invitrogen (Canada).

3.2.2 Animals All experiments were conducted on 12- to 13-week old, adult UCP2BKO and RIP-Cre

control mice. All animals were handled according to the guidelines provided by the Canadian

Council on Animal Care.

41  

3.2.3 Analysis of Membrane Potential Glucose-induced changes in membrane potential were quantified in dispersed islet cells

using a mitochondrial-specific Rhodamine dye. Dispersed islets adhered to cover slips were

loaded with rhodamine 123 (25 ug/ml, 10 min) in Krebs-Ringer buffer (KRB) containing 0.1%

BSA, 120mM NaCl, 2 mM CaCl2, 1 mM MgCl2, 24 mM NaHCO3, and 10 mM Hepes (pH 7.3).

Glucose was then added (at a concentration of 20 mM). At the end of the experiment, 1 mM

NaN3 was added to inhibit the respiratory reaction and fully dissipate the potential. Membrane

potential was measured using an Olympus IX70 inverted epifluorescence microscope combined

to an Ultrapix camera and a computer with Merlin imaging software (LSR).

3.2.4 Analysis of ATP levels in β cells Isolated islets from 12-week old UCP2BKO and RIP-Cre control mice were hand-picked

into 1.5 ml microfuge tubes with approximately 30 islets per tube. ATP content in these samples

was measured using a luciferase ATP kit according to the manufacturer’s instructions (Sigma-

Aldrich, USA) and normalized to DNA content. In order to isolate ATP, islets were lysed using

a strong base (30 ul 0.1M NaOH + 1 mM EDTA). Lysates were then heated at 60 °C for 20 min

and samples were aliquoted in wells of a luminometer 96-well plate with 160 ul of assay buffer,

20 ul of lysate, and 40 ul of the luciferin/luciferase mixture. Luminescence was measured by a

spectrophotometer immediately after the last addition and signal intensity was calibrated with an

ATP standard from the kit. Each set of experiments was performed in triplicates.

3.2.5 Measurement of glucose stimulated insulin secretion Isolated islets were cultured overnight and pre-incubated with 2.8 mM KRB buffer for

one hour prior to secretion assessment. 10 islets were then picked into microfuge tubes and

incubated with either low (2.8 mM) or high (16.7 mM) glucose for one hour and aliquots of the

sample stored in – 20 °C for insulin measurements. The islets were lysed (using acid-ethanol)

and the DNA content was measured using a spectrophotometer. Total insulin content and Insulin

in the samples was measured using the Linco Research RIA kit and normalized to total DNA

content.

42  

3.2.6 Pancreatic islet morphology Pancreata were removed from anesthetized mice and fixed using 10% buffered formalin

for 48 hours before being processed for islet morphology. After fixation, pancreata were

embedded into paraffin wax and sections were cut using a microtome and mounted onto slides

for staining. Sections were treated with pepsin and incubated for 1 hr in either a rabbit

polyclonal anti-insulin or anti-glucagon primary antibody (1:200 or a 1:150 dilution,

respectively) obtained from Biomeda (Foster City, MA). Slides were scanned using a brightfield

scanner at 20X magnification. The program ImageScope was used to analyze insulin- and

glucagon-positive area as well as islet density using a pixel-positive algorithm. All data was

normalized to whole pancreatic slice area.

 

3.2.7 Measurement of ROS Basal levels of ROS were measured at 11mM glucose. Dispersed islets were loaded with

5μM carboxy-dichlorofluorescein diacetate (DCF) for 45 min in incubation buffer in a 37°C

incubator. After incubation, coverslips were washed and placed in the imaging chamber.

Fluorescent excitation was at 480 nm for 300 ms, and emission detected with a 525 nm band pass

filter using a 505 nm beam splitter. Fluorescence intensity levels were kept within the upper and

lower detection thresholds of the recording equipment. Fluorescence was quantified by software

and the mean emission intensity from each cell was recorded. Approximately 20-30 cells were

analyzed per coverslip. Excitations of each coverslip were kept at 3 exposures or less to reduce

any potential photobleaching effects.

3.2.8 Evaluating mRNA expression of Anti-oxidant enzymes in β-cells RNA extracted from islets was reverse transcribed to make cDNA as previously

mentioned (Chapter 2, section 2.2.5 & 2.2.7). Gene expression of various Anti-oxidant enzymes

(primer sequences listed in Table 4) was measured using RT-PCR and normalized to levels of

beta-actin. In order to ensure specificity, the sequences of all primers were blasted against the

mouse genome (Nucleotide Blast).

43  

Table 4: Primer sequences for qRT-PCR of Anti-oxidant enzymes Primers Fwd Rev Glutathione peroxidase

(GPX1)

GCATTGGCTTGGTGATTACTGGCT TCATTAGGTGGAAAGGCATCGGGA

GPX2 GCATGGCTTACATTGCCAAGTCGT AGCCCTGCCTCTGAACGTATTGAA

GPX3 TTCAGGAAGGAAGCCACATTCCCA CACAGTTGTGCCAGGCTTGTCTTT

GPX4 ATGCCCGATATGCTGAGTGTGGTT TTGATTACTTCCTGGCTCCTGCCT

Catalase AGAGGAAACGCCTGTGTGAGAACA AGTCAGGGTGGACGTCAGTGAAAT

Superoxide Dismutase

(SOD1)

GGTGTGGCCAATGTGTCCATTGAA GGGAATGTTTACTGCGCAATCCCA

SOD2 ATGTAGCTGTCTTCAGCCACACCA AATTCCCAGCAAACACAGAGTGGC

SOD3 CAGCCATGTTGGCCTTCTTGTTCT TCTTCTCAACCAGGTCAAGCCTGT

Heme Oxygenase

(HO-1)

TAGCCCACTCCCTGTGTTTCCTTT TGCTGGTTTCAAAGTTCAGGCCAC

3.2.9 Statistical Analysis

Statistical significance was assessed by using either the Student’s t test (Microsoft Excel) or a

one- or two-way ANOVA for repeated measures followed by a Bonferroni post-test comparisons

using GraphPad Prism 4. A p-value of less than 0.05 was considered significant. All data is

expressed as the mean ± SE.

3.3 Results

3.3.1 Membrane Potential After confirming sufficient deletion of UCP2 in beta-cells, uncoupling activity in beta-

cell of 12- week old UCP2BKO mice was analysed by measuring changes in mitochondrial

membrane potential. Glucose-induced changes (20 mM) were measured using a mitochondrial

specific dye (Rh 123) and differences in fluorescence intensity were quantified. A representative

trace shows that the addition of glucose results in hyperpolarization of the mitochondrial

membrane and the addition of NaN3, which is a respiratory inhibitor, results in the depolarization

of the membrane (Figure 23A). As expected, dispersed beta-cells from UCP2BKO mice (- 1.22

 

± 0.036 f

hyperpol

obtained

to be sign

 Figure 2potential RIP-Cre controls. 5, Studen

A

B

fold of basal

larization, wh

after depola

nificantly dif

23: Mitochonmeasuremecontrols. B) Imaging w

nt’s t-test.

A

B

fluorescenc

hen normali

arization with

fferent (Figu

ndrial memnts conducte) Membraneas conducted

ce) had signi

zed to RIP-C

h NaN3 (1.0

ure 23 B).

mbrane potened using Rh1e potential md by Dr. V. K

44 

ficantly incr

Cre controls

5 ± 0.05 fold

ntial. A) re123 in islets

measurementsKoshkin. *

reased gluco

(Figure 23 B

d of basal flu

epresentativeof 12-week

s normalizedp < 0.05, **

se-induced

B). Fluoresc

uorescence)

e trace of meold UCP2B

d to fluoresc* p < 0.01, **

cence values

were not fou

embrane KO relative ence intensit** p < 0.001

s

und

to ty in

1, n =

 

3.3.2 AU

islets (Zh

week old

Aldrich,

significan

DNA) an

content w

DNA) an

Figure 2islets fromDNA con** p < 0.

3.3.3 GZ

islets isol

show tha

insulin se

On the ot

model of

12-week

glucose.

A

ATP LevelsUCP2 -/- hav

hang et al. 20

d mice were

Canada). Th

nt difference

nd RIP-Cre m

was not foun

nd RIP-Cre (

24: Islet ATPm 12-week ontent in samp01, *** p <

Glucose StiZhang et al. (

lated from g

at the inhibiti

ecretion (Ch

ther hand, Pi

f UCP2 has i

old UCP2B

Although in

s ve been show

001; Joseph

lysed to extr

he islet ATP

es were obse

males (41.25

nd to be statis

(35.67 ± 5.18

P content inold mice waple. Spectro0.001, n = 5

imulated In(2001) demo

global UCP2

ion of UCP2

han et al. 199

i et al. (2009

impaired ins

KO and RIP

nsulin secret

wn to have hi

et al. 2002;

ract ATP and

P content wa

erved in ATP

5 ± 3.00 pmo

stically diffe

8 pmol/ug D

n 12-week olas measured uophotometer5, Student’s t

nsulin Secronstrated enh

-/- mice. M

2 activity or

99; Saleh et a

9) have recen

ulin secretio

P-Cre contro

tion was sign

B

45 

igher levels

Diao et al. 2

d measured u

as normalized

P content bet

ol/ug DNA, F

erent betwee

DNA) female

ld Male (A) using a lucif

r readings obt-test.

retion hanced gluco

oreover, a m

expression r

al. 2001; Zh

ntly reported

on. To addre

ls was asses

nificantly sti

B

of islet ATP

2008). Thus

using a lucif

d to the DNA

tween UCP2

Figure 24A)

en UCP2BKO

es.

and Female ferase assay btained by D

ose-stimulate

myriad of stu

results in inc

ang et al. 20

d that islets f

ess this discr

ssed in the pr

imulated wh

P content com

, isolated isl

ferase ATP k

A content in

2BKO (41.9

). Similarly,

O (42.82 ± 6

(B) mice. Akit and normr. V. Koshki

ed insulin se

udies have be

creased gluco

006; DeSouz

from their gl

repancy, GS

resences of 2

en glucose w

mpared to co

lets from 12-

kit (Sigma-

n the sample.

± 2.45 pmo

islet ATP

6.57 pmol/ug

ATP in isolatmalized to toin. * p < 0.0

ecretion from

een publishe

ose-stimulat

a et al. 2007

lobal knocko

IS in islets f

2.8 or 16.7 m

was switched

ontrol

-

No

l/ug

g

ted

otal 05,

m

ed to

ed

7).

out

from

mM

d

 

from low

between

RIP-Cre

25A). A

isolated f

and RIP-

Figure 2Males (Abuffer. I* p < 0.0

3.3.4 IsM

beta-cells

mice on a

Represen

density b

analysis t

UCP2BK

A

w to high on m

UCP2BKO

controls (2.8

s well, no st

from UCP2B

-Cre (2.8 mM

25: in vitro GA) and Femalnsulin secret

05, ** p < 0.0

slet Area

Morphologica

s resulted in

a high-fat di

ntative image

between 13-w

to quantify t

KO (0.84 ± 0

male islets f

(2.8 mM: 1.

8 mM: 1.54

tatistical diff

BKO (2.8 mM

M: 1.20 ± 0.2

GSIS in isolales (B). Isletion measure01, *** p < 0

al studies we

abnormal d

iet have been

es of pancre

week old UC

the number o

0.04 islets/mm

from 2.8 mM

.59 ± 0.36 ng

± 0.36 ng/ug

ferences in in

M: 1.79 ± 0.

25 ng/ug DN

ated islets froets were stimements were0.001, n = 8-

ere conducte

evelopment

n shown to h

ata show tha

CP2BKO and

of islets per a

m2) and RIP

46 

M to 16.7 mM

g/ug DNA, 1

g DNA, 16.7

nsulin secret

.39 ng/ug DN

NA, 16.7 mM

om 12-weekmulated with e normalized-9, Student’s

ed to determ

of islets or t

have enhance

at there were

d RIP-Cre m

area selected

P-Cre contro

B

M, equivalen

16.7 mM: 13

7 mM: 13.88

tion were ob

NA, 16.7 mM

M: 8.94 ± 0.8

k old UCP2B2.8 mM and

d to total DNs t-test.

ine whether

the pancreas

ed islet area

e no differen

male mice (Fi

d also resulte

ls (0.88 ± 0.

nt values wer

3.91 ± 2.90 n

8 ± 1.68 ng/u

bserved in fe

M: 13.24 ± 1

87 ng/ug DN

BKO and RIPd 16.7 mM g

NA content in

the deletion

s. Previousl

(Joseph et a

nces in islet m

igure 26 A&

ed in no diff

05 islets/mm

re observed

ng/ug DNA)

ug DNA, Fig

emale islets

1.77 ng/ug D

NA, Figure 2

P-Cre mice iglucose in KRn sample.

n of UCP2 fr

ly, UCP2 -/-

al. 2002).

morphology

&B). Further

ferences betw

m2, Figure 26

and

gure

DNA

5B).

in RB

rom

or

r

ween

6 C).

 

Figure 2Immunohinsulin (rislets wer** p < 0.

3.3.5 BT

mass com

determin

UCP2BK

represent

and contr

the pancr

different

A

26: Islet Arehistochemicarepresentativre counted a01, *** p <

Beta Cell arThe UCP2 -/-

mpared to wi

ned by immu

KO and RIP-

tative image

rols (Figure

reas of UCP2

from RIP-C

ea in pancreaal analysis wve images ofand normaliz0.001, n = 5

rea - model on a

ildtype mice

unohistochem

-Cre mice an

s show that

27A&B). F

2BKO (0.01

Cre controls (

ata of 13-wewas performef pancreata inzed to total p5, Student’s t

a HFD has be

e on a HFD (

mistry analys

nd normalize

no differenc

Further analy

13 ± 0.004 %

(0.012 ± 0.0

C

47 

ek old UCP2ed on pancren A & B). T

pancreatic aret-test.

een shown to

(Joseph et al

sis on pancre

ed to pancrea

ces were obs

ysis also dem

% slice area)

03 % slice a

B

2BKO and Reatic sectionThe number oea selected.

o have incre

. 2002). Thu

eatic slices f

atic slice are

erved betwe

monstrated th

was not foun

area, Figure 2

RIP-Cre mals and slices of distinct in2X magnific

ased pancrea

us, beta-cell

from 13-wee

ea selected.

een pancreata

hat insulin-po

nd to be stat

27C).

e mice. were stained

nsulin-stainecation * p <

atic beta-cel

area was

ek old male

Qualitative

a of UCP2B

ositive area

tistically

d for ed 0.05,

ll

ely,

KO

in

 

Figure 2Immunohinsulin (s& B). Inmagnific* p < 0.0

3.3.6 AL

mass com

immunoh

male mic

infiltratio

cell apop

area was

RIP-Cre

A

27: Pancreathistochemicashown in rednsulin stainination.

05, ** p < 0.0

Alpha Cell Lee et al. (20

mpared to co

histological

ce. The repr

on compared

ptosis using s

observed in

controls (0.0

tic Beta-cellal analysis wd) to look forng was quant

01, *** p < 0

area 09) have dem

ontrols. Qua

analysis with

resentative im

d to RIP-Cre

streptozotoci

n the pancrea

001 ± 0.0002

B

l area from was performer the presenctified and no

0.001, n = 5,

monstrated t

antification o

h a glucagon

mages illustr

controls (Fi

in (Lee et al

as of UCP2B

2 % slice are

48 

13-week olded on pancrece of beta-ceormalized to

, Student’s t-

that UCP2 -/

of alpha-cell

n-positive an

rate that islet

igure 28 A&

. 2009). Inte

BKO mice (0

ea, Figure 28

d UCP2BKOeatic sectionells (represen

total pancre

-test.

/- have signi

area was als

ntibody on p

ts from UCP

&B); similar t

erestingly, in

0.003 ± 0.000

8C).

C

O and RIP-Crs and slices ntative imageatic slice se

ficantly high

so conducted

ancreata from

P2BKO have

to that obser

ncreased glu

04 % slice a

re male micewere stainedes of islets inlected, 20X

her alpha-cel

d using

m 13-week o

e more alpha

rved after be

ucagon-posit

area) compar

e. d for n A

ll

old

a-cell

eta-

tive

red to

 

Figure 2Immunohglucagondemonstrcontrols. 20X mag 

 

3.3.7 RS

ROS pro

cells of 1

dye, DCF

species b

and norm

Ai)

Aii)

Aiii)

Aiv)

28: Pancreathistochemican to look for rate that UC Glucagon s

gnification. *

ROS accumo far, both g

duction (Pi e

12-week old

F specifically

by an increas

malized to the

tic Alpha-ceal analysis wthe presenceP2BKO modstaining was* p < 0.05, **

mulation global knock

et al. 2009; L

UCP2BKO

y measures t

se in fluoresc

e intensity o

Bi)

Bii)

Biii)

Biv)

ell area fromwas performee of alpha-cedel has incre quantified a* p < 0.01, *

kouts of UCP

Lee et al. 20

and RIP-Cre

the productio

cence. The r

observed in th

49 

m 13-week oed on pancreells. Represeeased alpha-cand normaliz*** p < 0.00

P2 have been

09). Measu

e mice were

on of hydrog

relative fluo

he RIP-Cre

C

old UCP2BKeatic sectionentative imacell infiltratized to total p1, n = 5, Stu

n shown to h

urements of m

conducted u

gen peroxide

rescence int

controls. Hi

KO and RIP-Cs and slices

ages of isletsion comparepancreatic sludent’s t-test

have increase

mitochondria

using DCF.

e and reactiv

tensity was q

igher ROS p

Cre controlswere stained

s in A & B ed to RIP-Crlice selected t.

ed mitochon

al ROS in be

The fluores

ve nitrogen

quantified (R

production w

s. d for

re in C,

ndrial

eta-

cent

RFU)

was

 

observed

5.85 RFU

were fou

 

Figure 2to measumeasuredUCP2BKFluoresce*** p < 0

3.3.8 AP

increased

RT-PCR

following

(GPX) 2,

that the U

conducte

gene exp

observed

A

d in the beta-

U, Figure 29

nd to be stat

29: ROS accure mitochond using the fKO and RIP-ence was qu0.001, n = 5,

Anti-oxidani et al. (2009

d oxidative s

. In their mo

g anti-oxidan

, 4; Catalase

UCP2BKO i

ed. Islets fro

pression for S

d in HO-1, it

B

-cells from U

B). Similarl

tistically sign

cumulation. ndrial hydrogfluorescent d-Cre mice. Fuantified in is, Student’s t-

nt enzyme e9) have recen

stress illustra

odel, a signi

nt enzymes:

e; and hemeo

slets had inc

om UCP2BK

SOD1, GPX

was not fou

B

UCP2BKO m

ly, beta-cells

nificant com

Beta-cells sgen peroxidedye DCF witFluorescenceslets of Male-test.

expressionntly reported

ated by incre

ficantly high

Superoxide

oxygenase 1

creased oxid

KO and RIP-

X1-4, CAT (F

und to be stat

50 

male mice co

s from UCP2

mpared to con

selected frome productionh representae recordings e (A) and Fe

in Beta-ced that their g

eased gene e

her mRNA e

dismutase (

(HO1) (Pi e

dative stress,

Cre mice we

Figure 30). A

tistically sig

ompared to R

2BKO fema

ntrols (Figur

m dispersed . Mitochond

ative images obtained by

emale (B) mi

ells global UCP2

xpression of

expression w

(SOD) 1, 2, 3

et al. 2009).

a similar ge

ere found to

Although inc

nificant (Fig

C

RIP-Cre cont

les (157.72 ±

re 29C).

islets were tdrial ROS pr(A) in dispe

y Dr. V. Koshice. * p < 0.

2 knockout m

f anti-oxidan

was observe

3; Glutathion

Thus, to fur

ene expressio

have signifi

creased expr

gure 30).

trols (124.83

± 26.54 RFU

treated with roduction waersed islets frhkin. .05, ** p < 0

model had

nt enzymes u

ed in the

ne peroxidas

rther illustrat

on study was

icantly incre

ression was

3 ±

U)

DCF as

from

0.01,

using

se

te

s

ased

 

Figure 3RIP-Cre expressioenzyme. the samp  

 

 

 

 

 

 

30: Gene expmice. RNA

on was quant All quantifi

ple. * p < 0.0

pression of awas extractetified by qR

fication was n05, ** p < 0.0

anti-oxidaned from isolaT-PCR usinnormalized t01,*** p < 0

51 

nt enzymes inated islets ang primers deto beta-actin0.001, n = 5-

n 12-week ond reverse tresigned specn (a house-ke-7 Student’s

old male UCranscribed tocifically for eeeping gene)t-test.

P2BKO ando cDNA. Geeach anti-oxi) expression

d ene idant in

52  

Chapter 4: General Discussion

4.1 Summary of findings

4.1.1 In Vivo Findings

• No significant differences were observed between the UCP2BKO and RIP-Cre controls

for both sexes for the following parameters:

o Body Weight

o Fasting Blood Glucose

o Fasting Plasma Glucagon

o Fasting Plasma Insulin

o Glucose Stimulated Insulin Secretion, in vivo

o Glucose Tolerance (ipGTT)

o Insulin Sensitivity (ipITT)

Glucose Tolerance (OGTT)

UCP2BKO had significantly impaired glucose tolerance compared to RIP-Cre controls

4.1.2 In Vitro Findings

• No significant differences were observed between the UCP2BKO and RIP-Cre controls

for the following parameters:

o Glucose Stimulated Insulin Secretion, in vitro

o Islet ATP content

o Islet Density

o Beta-Cell Area

Membrane Potential

Increased glucose-induced hyperpolarization was observed in UCP2BKO islets

compared to RIP-Cre islets

53  

Alpha-Cell Area

Pancreata from UCP2BKO had increased alpha-cell area compared to controls

ROS accumulation

Islets from UCP2BKO showed significantly higher levels of ROS accumulation

Anti-Oxidant enzyme expression in Beta-cells

Islets from UCP2BKO had significantly higher expression of SOD1,GPX1-4, & CAT

compared to RIP-Cre islets

4.2 Discussion

4.2.1 UCP2BKO in comparison to previous global knockout models Beta-Cell deletion of UCP2 has lead to a phenotype unlike any observed in the whole

body UCP2 knockout studies thus far (Zhang et al. 2001, Joseph et al. 2002, Pi et al. 2009). A

summary comparing a multitude of metabolic parameters assessed in the UCP2BKO to the two

different sets of whole-body knockout mice is provided in Table 5. For simplicity, the whole-

body knockout originally characterized by Zhang et al. (2001) will be referred to as ZUCP2 -/-

and the knockout generated by Pi et al. (2009) as PUCP2-/-.

The UCP2BKO’s had equivalent body weight and fasting blood glucose levels compared

to controls, similar to the whole body ZUCP2 -/- (Zhang et al. 2001). However, contrary to the

improved glucose tolerance observed in ZUCP2-/- (Zhang et al. 2001), intraperitoneal injections

of glucose resulted in no differences in glucose tolerance in the UCP2BKO mice compared to

controls. On the other hand, the UCP2BKO mice had impaired oral glucose tolerance compared

to RIP-Cre controls However, the impaired glucose tolerance did not translate into changes in

insulin secretion (in vivo or static incubation studies in vitro) as UCP2BKO and RIP-Cre controls

had equivalent values for GSIS. On the contrary, the ZUCP2-/- had increased GSIS, both in vivo

and in vitro, compared to controls (Zhang et al. 2001, Joseph et al. 2002, Lee et al. 2009).

Morphological studies showed that UCP2BKO and RIP-Cre controls had no differences in islet

number (per area) similar to the ZUCP2-/- (Joseph et al. 2002). However, equivalent levels of

54  

insulin-positive area were also observed in the UCP2BKO and RIP-Cre mice, while ZUCP2-/-

have been shown to have increased beta-cell area (Joseph et al. 2002; Lee et al. 2009). The

increase in beta-cell area seen by Joseph et al. (2002) was suggested to be a result of enhanced

glucose metabolism due to more efficient coupling of oxidative phosphorylation. High levels of

metabolic products of glucose such as ATP have been shown to stimulate cell proliferation by

translocating protein kinase C, phosphorylating Akt, and mitogen-activated protein kinases

(MAPK’s) (Heo & Han 2006). Intracellular regulation of ATP has also been suggested to work

through the mammalian target of rapamycin (mTOR) by modulating ribosome biogenesis and

cell growth (Dennis et al. 2001). Moreover, deletion of UCP2 in the beta-cell lead to an increase

in glucagon-positive or alpha-cell area in the UCP2BKO compared to RIP-Cre controls. Lee et

al. (2009) have also shown that ZUCP2-/- have increased alpha-cell area compared to wildtype

controls. In this study, the increase in alpha-cell area was suggested to be a result of increased

basal ROS observed in the ZUCP2-/- compared to wildtype controls (Lee et al. 2009).

The PUCP2-/- mouse was initially generated using ES cells derived from a 129 mouse

and crossed to B6 mice (Table 5, Arsenijevic 2000). This therefore represents a similar strategy

to Zhang et al. (2001) except then these mice were backcrossed to pure strains of C57BL6/J, 129

and A/J mice. The rationale behind this was that the increased insulin secretion seen in the

ZUCP2 -/- knockout model (a mixed background 129/B6 strain) (Zhang et al. 2001) may be due

to confounding effects of their background. They found that isolated islets from pure 129 mice

have a 15-fold higher insulin secretion compared to pure C57BL6/J mice have lower glucose

tolerance (Pi et al. 2009). Thus, they believe that mixing the two strains leads to a phenotype of

increased insulin secretion and improved glucose tolerance that may not necessarily be attributed

to the deletion of UCP2 from the mouse. Thus, by backcrossing their PUCP2-/- mice to pure

strains, the authors found that their UCP2 knockout model had decreased insulin secretion,

which was suggested to be due to the apparent oxidative stress in the β-cells of these mice (Pi et

al. 2009). Thus far, the PUCP2-/- have not been thoroughly characterized, especially their in

vivo metabolic functions. It would be interesting to see if the mice have impaired glucose

tolerance, differences in insulin sensitivity and in vivo GSIS. Considering the fact that UCP2 is

expressed in the brain, deletion may result in changes in insulin secretion and peripheral

55  

resistance (Parton et al. 2007). It could be possible that the decrease in insulin secretion seen in

vitro in islets of PUCP2-/- mice could be a result of improved insulin sensitivity in vivo.

Table 5: Comparison of UCP2BKO to the UCP2 whole body knockout models UCP2BKO ZUCP2 -/-

(Zhang et al. 2001) PUCP2-/-

(Pi et al. 2009)

Method of UCP2 deletion

Cre-Lox Recombination (deletion of exon 3-4)

Replacement of introns 2-7 with PGK-neo cassette in UCP2 gene from 129

mice, clones microinjected into C57Bl6/J mice

Replacement of exon 3-4 with PGK-neo cassette in

UCP2 gene from 129 mice, clones microinjected into C57Bl6/J mice – then backcrossed more than 12

generations onto pure strains

Background Mixed: 129/B6 Mixed: 129/B6 Pure strains of 129, B6, A/J

Glucose tolerance (GT)

ipGTT: no change OGTT: impaired GT Improved GT NA*

Insulin Sensitivity No change No change NA Mitochondrial

Membrane Potential ↑ glucose-induced hyperpolarization

No change NA

Insulin Secretion (in vitro) No change in GSIS ↑ GSIS ↓ GSIS

Islet ATP No change ↑ ATP content NA Alpha-Cell Area ↑ Alpha-Cell Area ↑ Alpha-Cell Area NA Beta-Cell Area No change ↑ Beta-Cell Area NA

Basal ROS accumulation (DCF) ↑ Basal ROS ↑ Basal ROS ↑ Basal ROS

Anti-oxidant enzyme expression

↑ expression of SOD1, GPX1-GPX4, CAT NA

↑ expression of SOD1, SOD2, SOD3, GPX2, GPX4, CAT, HO-1

*NA: Not Assessed

UCP2 provides a proton leak mechanism across the mitochondria and it was imperative

to see whether the deletion of UCP2 would result in changes in mitochondrial membrane

potential. The glucose-induced mitochondrial membrane potential measurements demonstrated

that pancreatic beta-cells from UCP2BKO had increased hyperpolarization compared to RIP-Cre

beta-cells. Although it was merely a 1.2 fold increase in mitochondrial membrane potential, this

change did not translate into differences in ATP production. This mild change was not due to

insufficient deletion of UCP2 (which would result in little to no changes in proton leak leading to

no differences in mitochondrial membrane potential) since we observed a 90% knockdown of

protein expression using IHC. It is interesting to note that Diao et al. (2007) did not see a change

56  

in glucose-induced membrane hyperpolarization in beta-cells of ZUCP -/- mice, but still

observed a significant increase in ATP production compared to controls. UCP2 has been shown

to be a physiologically irrelevant uncoupler, thus deleting UCP2 may not necessarily result in

significant differences in overall mitochondrial membrane potential but still modulate ATP

production and insulin secretion (Bouillaud 2009; Diao et al. 2007). It is also quite possible that

the increase in ATP production seen in islets of ZUCP2-/- mice was due to deletion of UCP2 in

extrapancreatic tissues. Beta-cell insulin secretion is influenced by a myriad of paracrine effects

such as incretin-derived, neuronal, and alpha-cell, thus results obtained from ZUCP2-/-

knockout studies could be a result of extrapancreatic deletion of UCP2 (Henquin et al. 2003).

Diao et al.(2007) have demonstrated that UCP2 is highly expressed in alpha-cells and influences

alpha-cell survival, and deletion could lead to paracrine influences on beta-cells and

consequently on insulin secretion. Moreover, Parton et al. (2008) have recently shown that

hypothalamic POMC neurons of ZUCP2-/- mice on a HFD had improved glucose sensing and

maintained superior glucose homeostasis. Thus, it is quite possible that the whole body

phenotype of ZUCP2-/- could be explained by deletion of UCP2 in the CNS with hypothalamic

neurons that synapse on beta-cells influencing ATP production and insulin secretion.

On the other hand, it is well established that even slight increases in mitochondrial

membrane potential are strongly associated with increased ROS production (Korshunov et al.

1997). The mitochondria is the primary location of ROS production and increased membrane

potential results in a higher number of electrons escaping from the ETC to form superoxides and

other ROS (Chen et al. 2003). High production of ROS can lead to the perforation of the

mitochondrial membrane (making it more ‘leaky’ to protons) (Roberts & Sindhu 2009),

decreased activity of subunits involved in the ETC , and downregulation of mitochondrial

biogenesis (Li et al. 2009) which, in turn, attenuate ATP production and insulin secretion (Pi et

al. 2009). Thus, a consequence of higher mitochondrial membrane potential could be the

increased ROS accumulation observed in the islets of UCP2BKO. The increased ROS

accumulation in UCP2BKO islets could be involved in mitochondrial dysfunction (Victor et al.

2009; Li et al. 2009). However, considering that there was a mild increase in mitochondrial

membrane potential, it may not have been significant enough to result in changes in ATP

production and insulin secretion. Moreover, it is possible that deleting UCP2 leads to efficient

coupling for ATP production, however, this may be counteracted by the competing and opposing

57  

effects of ROS damage and mitochondrial dysfunciton, which result in the attenuation of insulin

secretion.

The most significant distinction amongst the three models would have to be the 3 distinct

results obtained from GSIS studies (Table 5, highlighted in green). While islets from ZUCP2-/-

were shown to have increased GSIS, which was proposed to be due to more efficient coupling

and higher ATP production, Pi et al. observed a decrease in GSIS in islets of their PUCP2-/-

(Zhang et al. 2001; Pi et al. 2009). Similar to Pi et al. (2009), the UCP2BKO model had

relatively increased ROS accumulation (shown through increases in DCF fluorescence as well as

higher gene expression of anti-oxidant enzymes), however, no evidence of impairments in

insulin secretion were observed (in vivo or in vitro). The equivalent levels of insulin secretion

could be a result of increased levels of ROS accumulation observed in the beta-cells of

UCP2BKO mice compared to RIP-cre beta-cells. As explained in detail below, mitochondrial

ROS production can damage key subunits in the ETC and ATP production, thus attenuating the

increase of insulin secretion that could have been observed as a result of deleting UCP2 in the

pancreatic beta-cell (Li et al. 2009). As well, the higher alpha-cell or glucagon-positive area

could also explain the equivalent levels of insulin secretion observed. The hormone glucagon

secreted by alpha-cells negatively regulates insulin secretion and vice versa (Bansal & Wang

2008). As discussed below, the increase in glucagon content of UCP2BKO mice could be

playing a significant impact on GSIS from whole islets and thus, counteracting any increase in

insulin secretion usually seen when UCP2 is deleted from the beta-cell.

4.2.2 UCP2BKO and Oxidative Stress Considering UCP2’s proposed role in cytoprotection against oxidative stress, it was

important to confirm whether the UCP2BKO mice showed signs of increased ROS accumulation

and other consequences of oxidative stress. It is proposed that the production of mitochondrial

ROS such as superoxides upregulate UCP2 activity and expression, which in turn, leads to a

decrease in ROS accumulation (Echtay et al. 2002). Undoubtedly, pancreatic oxidative stress is

one of the characteristics of diabetes, where Type-2 diabetic patients have increased

accumulation of hydrogen peroxides (Nourooz-Zadeh et al. 1995). Moreover, it has been

58  

previously demonstrated that exposure of beta-cells to high levels of oxidative stress results in

decreased mitochondrial oxygen consumption and ATP production as well as a decreased

expression of respiratory chain subunits and genes responsible for mitochondrial biogenesis (Li

et. al. 2009). As Pi et al. (2009) suggest, chronic oxidative stress in their PUCP2-/- model was

proposed to result in impaired GSIS. However, considering the mild increases in ROS and

antioxidant gene expression (Figure 29&30), the UCP2BKO mice did not show any significant

consequences of chronic oxidative stress (such as severely impaired insulin-positive area, GSIS

or ATP production). Thus, although increases in similar markers of oxidative stress were

observed in the islets of UCP2BKO mice as the PUCP2-/-, this did not translate into impairments

in insulin secretion.

On the other hand, low levels of ROS accumulation have been observed to be a metabolic

signal that modulates GSIS (Pi et al. 2007) as well as shown to be an important component of

cell signaling. H2O2 production can activate various signal transduction pathways such as

MAPKs (kinases involved in mitosis & cell proliferation), NF-κB/rel (plays a key role in

regulating immune response to infection) and AP-1 (transcription factor that regulated gene

expression in response to growth factors) (Powis et al. 1997). Joseph et al. (2002) observed that

when ZUCP2-/- mice were placed on a HFD, they were able to tolerate the development of diet-

induced obesity by compensating with increased beta-cell area. This could be as a result of

increased levels of ROS. As well, Pi et al. (2007) have shown that both exogenous dosage and

endogenous production of ROS stimulates GSIS. Thus, although mitochondrial ROS

accumulation have always been understood to be a damaging by-product, low levels of ROS

could be involved in cell signaling, proliferation, and secretion pathways.

4.2.3 UCP2BKO and α-cell area Interestingly, pancreatic morphological studies indicated that the UCP2BKO had

increased staining for alpha-cell (or glucagon-positive) area. We have previously shown that the

whole body knockout model of UCP2 has both increased beta- as well as alpha-cell area on both

a chow-fed diet (Lee et al. 2009) as well as a high-fat diet (Joseph et al. 2002). Although further

analysis showed no significant differences in fasting plasma glucagon, a slightly increased

59  

glucagon-positive area may explain the mild glucose intolerance (as described in detail below)

that we observed in the UCP2BKO mice.

It is interesting to note that the immunohistochemistry staining observed for glucagon-

positive cells (Figure 28), is similar to that seen in mice treated with streptozotocin (STZ). STZ,

a chemical that specifically targets pancreatic beta-cells by triggering DNA fragmentation and

cellular dysfunction leading to apoptosis is widely used to study type-1 diabetes (Bedoya et al.

1996). Infiltration of peripheral alpha-cells due to the destruction of beta-cells in the core, is a

common observation in mice injected with low doses leading to beta-cell apoptosis (Adewole &

Ojewole 2007; Lee et al. 2009). Considering the alpha-cell morphology of UCP2BKO mice, it is

possible that the increased alpha-cell area could be an indicator of decreased proliferation of

beta-cells and/or increased apoptosis of beta-cells. Thus, increased apoptosis of the beta-cell

could also be another explanation for the impaired glucose tolerance seen in the OGTT results.

However, considering the fact that we found no evidence of beta-cell dysfunction, impairment or

decreased insulin-positive area in pancreata of UCP2BKO mice, a further explanation is

necessary for the increased glucagon-positive area in the beta-cell knockout. During metabolic

stress, the beta-cell inflammatory response results in the production of cytokines such as

interleukins (Ehses et al. 2009). One such cytokine, interleukin-6 (IL-6), has been shown to

result in increased proliferation of alpha-cells (Ehses et al. 2009). Thus, it is possible that the

increased inflammatory response in the UCP2BKO could lead to the production of IL-6 resulting

in increased glucagon secretion. Furthermore, it is well accepted that beta- and alpha-cells are

tightly regulated, where impairments of beta-cell function can lead to dysregulation of alpha-cell

proliferation and an increase in glucagon content and secretion (Henquin et al. 2003). As

mentioned above, studies suggest that low levels of ROS accumulation are involved in cell

proliferation and signal transduction pathways (Powis et al. 1997; Finkel 2000; Emre et al.

2007). ROS production may activate downstream signal transduction pathways such as the

MAPK pathway (as mentioned above) leading to cell growth and proliferation (Powis et al.

1997). The islets of UCP2BKO mice had increased production of H2O2 (as seen by DCF

fluorescence) and significantly higher levels of anti-oxidant enzyme expression (a marker of

ROS accumulation). Thus, it is also possible that greater ROS accumulation in the islets of

UCP2BKO directly results in increased cell growth and proliferation of the alpha-cells.

60  

4.2.4 UCP2BKO and impaired glucose tolerance The discrepancy posed by the results from the tolerance tests (oral versus intraperitoneal)

may be explained by the differences one observes in the amount of insulin secreted between the

two assays. When an oral gavage is given, glucose passes through the gut resulting in the

stimulation of incretin hormones such as GLP-1 and GIP (Creutzfeldt 1985). With an oral

glucose supplement, the synergistic combination of indirect and direct stimulation leads to an

augmented insulin secretion as compared to an intraperitoneal injection (in which glucose is

absorbed into the bloodstream and directly acts on the pancreas). Thus, if there are subtle

differences in terms of insulin secretion, it may be masked by an ipGTT and more clearly

deciphered through an OGTT. Moreover, it is possible that the differences were not apparent

from an ipGTT due to the ‘RIP-Cre effect’. Studies have shown that the presence of the RIP-Cre

transgene alone leads to glucose intolerance due to the significant hypoplasia (eventually

resulting in an islet hyperplasia as they age) seen in the mice (Lee et al. 2006; Pomplun et al.

2007). Considering the fact that the UCP2BKO as well as the controls expressed the RIP-Cre

transgene, it is possible that the glucose intolerance observed in these mice could be masking the

subtle differences expected due to the deletion of UCP2 in the pancreatic beta-cell.

Interestingly, the glucose intolerance in the UCP2BKO can neither be explained by

impairments in insulin secretion nor differences in insulin sensitivity. However, there are two

possible explanations for the impaired glucose tolerance; the increased glucagon positive area as

well as the higher ROS accumulation in the UCP2BKO compared to RIP-Cre controls.

Although a significant difference in fasting plasma glucagon was not observed in the UCP2BKO

mice, further analysis of glucagon secretion could decipher differences in alpha cell function. In

addition to hypoinsulinemia, hyperglucagonemia has been associated with diabetic patients

(Burcelin et al. 2008). Studies have shown that suppression of glucagon after a glucose stimulus

is apparent in non-diabetic controls, but does not occur in patients with type 2 diabetes (Muller et

al. 1970; Raskin et al. 1978). However, hyperglucagonemia can result from α-cell dysfunction

as well as from some other impaired regulatory system upstream such as in the beta-cell

(Burcelin et al. 2008). The beta- and alpha- cell are tightly regulated, where it is possible that

due to an impairment or inhibition of insulin secretion, an increase in glucagon content and

secretion could occur (Weir et al. 1976; Unger 1983; Diao et al. 2005). Although, no

61  

impairments in insulin secretion were observed in the UCP2BKO mice, it is quite possible that

the alpha-cells have defective insulin sensing (Diao et al. 2005). Thus, the impairment of insulin

sensing could result in decreased sensitivity of the alpha-cell to the suppressive effects of insulin.

As the increased glucagon-positive area suggests, glucagon secretion capacity may be impaired

in the alpha-cells of the UCP2BKO mice, which could explain the increased mass as a measure

to compensate. Moreover, as mentioned above, the increased oxidative stress and ROS

accumulation observed in the UCP2BKO mice may also elucidate the mechanism of glucose

intolerance in our mice (Roberts & Sindhu 2009; Wei et al. 2008).

It has been previously demonstrated that exposure of oxidative stress to beta cells results

in decreased mitochondrial oxygen consumption and ATP production as well as downregulation

of subunits of the respiratory chain and genes responsible for mitochondrial biogenesis (Li et al.

2009). Thus, the phenotype in question could be further explained by the increased

accumulation of beta-cell ROS in UCP2BKO, which leads to mitochondrial dysfunction,

resulting in an impairment of glucose tolerance. It is also possible that beta-cell dysfunction of

the UCP2BKO could lead to defective GLP-1 sensing and insulin secretion. A downregulation

of the GIP and GLP-1 receptor in pancreatic islets has been observed in models of type-2

diabetes (Shu et al. 2009). Increased beta-cell oxidative stress, as observed in type-2 diabetes,

results in decreased transcription of key proteins such as the GIP and GLP-1 receptor (Shu et al.

2009). This downregulation could result in a decreased amplification of GLP-1 mediated

exocytosis of insulin (Li et al. 2009). Thus, beta-cell dysfunction in the UCP2BKO could result

in reduced expression of the GIP and GLP-1 receptor leading to decreased insulin secretion. It

would be interesting to assess insulin secretion by directly stimulating beta-cells with GLP-1 and

observe possible differences between UCP2BKO and controls. Therefore, the glucose

intolerance in the UCP2BKO mice could be a combinatorial effect of impairments through

significantly increased glucagon-positive area, as well as a higher ROS accumulation and beta-

cell dysfunction.

62  

4.3 Future Directions

4.3.1 UCP2 in the Hypothalamus The reality of mouse transgenics is that there is no perfect model for studying the

knockdown of a protein. Studies have shown that expression of cre recombinase can have toxic

effects in cells including DNA damage and changes in cell growth (Loonstra 2001; Silver 2001).

Moreover, although very easily executed, the microinjection of a cre transgene into the embryo

does not control for the location of integration, which can modify the pattern and duration of cre

expression (Lee et al. 2006). As previously mentioned, both the RIP-Cre transgene and UCP2

are expressed in the hypothalamus resulting in the possibility of the deletion of UCP2 in this

tissue. Although, no significant differences were observed in UCP2 mRNA expression between

the hypothalami of UCP2BKO and RIP-Cre mice, the deletion could have occurred in a specific

set of neurons that may play a significant role in systemic glucose homeostasis. Thus, the

potential deletion of UCP2 in insulin-transcribing neurons of the CNS may have contributed to

the phenotype of our model (Chaudhary et al. 2005; Nguyen et al. 2006).

Initial studies using the RIP-Cre model to generate a beta-cell specific Insulin-receptor

substrate-2 (Irs2) knockout found that these mice had impaired glucose tolerance, reduced islet

mass as well as hypothalamic dysfunctions such as melanocortin dysfunction, and leptin

resistance (Lin et al. 2004; Kubota 2004). The studies concluded that a poorly defined set of

neurons in the hypothalamus expressed cre and contained the machinery to transcribe insulin

(Lin et al. 2004; Kubota 2004). The RIP-Cre model was initially the only beta-cell specific cre

model available and has demonstrated its importance in detecting and characterizing the role of

novel, insulin-transcribing neurons in the hypothalamus that would have gone undetected in any

other study. Difficulty of using this model only arises when the protein is expressed and has a

role in the brain, and deleting it may result in a hypothalamic-specific phenotype.

The hypothalamus is a key regulator of food intake and energy metabolism and

disruption of insulin signaling have been shown to result in insulin resistance and impaired

response to hypoglycemia. Moreover, Parton et al. (2008) have demonstrated that UCP2 is

expressed in the hypothalamus and may be involved in glucose homeostasis. POMC neurons

play a significant role in systemic glucose homeostasis and obese mice on a HFD had disrupted

63  

glucose sensing in these neurons (Parton et al. 2008). Moreover, ZUCP2-/- mice on a HFD were

found to prevent obesity-induced loss of glucose sensing in POMC neurons and maintained

superior glucose homeostasis when compared to wildtype mice on a HFD (Parton et al. 2008).

Thus, considering the evidence of UCP2 expression in the hypothalamus and its potential

involvement in neuronal glucose sensing, it would be interesting to study neuron-specific

knockout models of UCP2. LoxUCP2 mice could be crossed to neuron expression models of the

cre transgene such as the POMC-Cre, or NPY-Cre to delete UCP2 from specific sets of neurons.

These models could enable us to specifically understand the role of UCP2 in hypothalamic

insulin signaling.

4.3.2 UCP2BKO on a High-Fat Diet A chronic high-fat diet study may further elaborate on the specific mechanisms of the

phenotype observed thus far in the UCP2BKO mice. Previous studies from our lab have shown

that on a HFD, ZUCP2-/- mice maintain superior pancreatic glucose responsiveness compared to

HFD-fed wildtype mice (Joseph et. al. 2002). ZUCP2-/- on a HFD have lower fasting blood

glucose, elevated insulin levels, and are more insulin sensitive (Joseph et. al. 2002). This

enhanced beta-cell response in ZUCP2-/- on a HFD was suggested to be due to a combination of

expanded beta-cell secretory capacity (seen through significantly higher pancreatic beta-cell

mass and insulin content) as well as superior fatty acid oxidation capacity (seen through

increased gene expression of carnitine palmitoyl transferase-1, Joseph et. al. 2002). Since

obesity (a result of a HFD) induces ROS accumulation (Furkawa et al. 2004), it is interesting to

note that although both ZUCP2-/- and wildtype controls were exposed to increased levels of

oxidative stress, ZUCP2-/- maintained superior beta-cell function. Thus, it is hypothesized that

on a normal diet, UCP2 being lowly expressed in the beta cell (Diao et. al. 2008), its activity may

be advantageous in attenuating ROS accumulation and maintaining normal insulin secretion.

This would explain the mild impairment in glucose tolerance we observed in the UCP2BKO

mice on a chow-fed diet. However, in a high-fat environment, which increases oxidative stress,

deletion of the protein may be beneficial to the islets. It is proposed that UCP2BKO on a HFD

may have improved islet function compared to controls through superior insulin secretory

capacity and improved fatty acid oxidation, which may overshadow the increased mitochondrial

ROS production seen in the mice.

 

4.4 ConB

studies h

cell (Tho

balance o

From our

phosphor

islets), ho

accumula

character

glucose i

glucagon

Figure 3could be the UCP2

N

functiona

that delet

impairme

nclusions Based on our

have suggeste

omas et al. 20

of UCP2 exp

r results, the

rylation (dem

owever, the

ation thereby

rization of U

impairment s

n-positive are

31: Proposedexplained b

2 BKO mice

Nonetheless,

al role of UC

tion of UCP2

ents in β-Cel

studies, an i

ed that certa

009; Gwiazd

pression is n

e deletion of

monstrated b

increased m

y preventing

UCP2BKO de

suggested to

ea (Figure 3

d explanatioy the increas

e compared t

this study ha

CP2 in the be

2 from beta-

ll function.

inclination t

in molecules

da et al. 2009

ecessary to m

UCP2 lead t

by increased

membrane pot

g any enhanc

emonstrates

o be due to h

1).

on of the phsed ROS accto controls.

as demonstr

eta-cells. Ou

-cells leads t

Thus, by car

64 

owards a du

s may have a

9; Kaneto et

maintain pro

to more effic

glucose-ind

tential is als

cements in A

that beta-ce

igher ROS a

henotype. Tcumulation a

ated the imp

ur myriad of

to increased

refully disse

ual role for U

a pleiotropic

t al. 2007). I

oper function

cient couplin

duced hyperp

o suggested

ATP generati

ell specific d

accumulation

The impairmeas well as glu

portance of e

f in vivo and

ROS accum

ecting its role

UCP2 is sugg

c role in the p

It is possible

n of the panc

ng of oxidati

polarization

to result in h

ion and GSIS

deletion of U

n and possib

ents in glucoucagon-posi

elucidating th

in vitro stud

mulation, how

e in specific

gested. Seve

pancreatic b

e that a delic

creatic beta-c

ive

in UCP2BK

higher ROS

S. Overall, t

CP2 results

bly an increa

ose toleranceitive area see

he specific

dies have sho

wever, with n

tissues (whe

eral

beta-

ate

cell.

KO

the

in

se in

e en in

own

no

ether

65  

it is the neurons in the hypothalamus, macrophages, or the alpha or beta-cells), we will be able to

determine the pharmacological potential of targeting this protein for diabetes.

66  

Reference List

1. Adewole SO, Ojewole JA. Insulin-induced immunohistochemical and morphological changes in pancreatic beta-cells of streptozotocin-treated diabetic rats. Methods Find Exp Clin Pharmacol. 29(7): 447-55, 2007.

2. Argyropoulous G, Brown AM, Willi SM, Zhu J, He Y, Reitman M, Gevao SM, Spruill I, Garvey WT. Effects of mutations in the human uncoupling protein 3 gene on the respiratory quotient and fat oxidation in severe obesity and type 2 diabetes. J Clin. Invest. 102: 1345-1351, 1998.

3. Armann B, Hanson MS, Hatch E, Steffen A, Fernandez LA. Quantification of basal and stimulated ROS levels as predictors of islet potency and function. Am J Transplant. 7: 38-47, 2007.

4. Arsenijevic D, Onuma H, Pecqueur C, Raimbault S, Manning BS, Miroux B, Couplan E, Alves-Guerra MC, Goubern M, Surwit R, Bouillaud F, Richard D, Collins S, Ricquier D: Disruption of the uncoupling protein-2 gene in mice reveals a role in immunity and reactive oxygen species production. Nature Genetics 26: 435-439, 2000.

5. Asghar Z, et al. Insulin resistance causes increased β-cell mass but defective glucose-stimulated insulin secretion in a murine model of type 2 diabetes. Diabetologia 49:90–99, 2006.

6. Bansal P, Wang Q. Insulin as a physiological modulator of glucagon secretion. Am J Physiol Endocrinol Metab. 295(4): E751-61, 2008.

7. Bedoya FJ, Solano F, Lucas M. N-monomethyl arginine and nicotinamide prevent streptozotocin-induced double strand DNA break formation in pancreatic rat islets. Experientia. 52: 344-347, 1996.

8. Bezaire V, Hofmann W, Kramer JK, Kozak LP, Harper ME. Effects of fasting on muscle mitochondrial energetic and fatty acid metabolism in UCP3(-/-) and wild-type mice. Am J Physiol Endocrinol Metab. 281: E975-E982, 2001.

9. Bezaire V, Seifert EL, Harper ME. Uncoupling protein-3: clues in an ongoing mitochondrial mystery. FASEB J. 2: 312-324, 2007.

10. Bindokas VP, Kuznetsov A, Sreenan S, Polonsky KS, Roe MW, Philipson LH. Visualizing superoxide production in normal and diabetic rat islets of Langerhans. J Biol Chem. 278: 9796-801, 2003.

11. Blanc J, Alves-Guerra MC, Esposito B, Rousset S, Gourdy P, Ricquier D, Tedgui A, Miroux B, Mallat Z. Protective role of uncoupling protein 2 in atherosclerosis. Circulation. 107: 388-390, 2003.

12. Bordone L, Motta MC, Picard F, Robinson A, Jhala US, Apfeld J, McDonagh T, Lemiuex M, McBurney M, Szilvasi A, Easlon EJ, Lin SJ, Guarente L. Sirt1 regulates insulin secretion by repressing UCP2 in pancreatic beta cells. PLos Biol. 4(2):e31, 2006.

13. Buettner C, Pocai A, Muse ED, Etgen AM, Myers MG Jr, Rossetti L. Critical role of STAT3 in leptin’s metabolic actions. Cell Metab 4: 49–60, 2006.

14. Boss, O., S. Samec, et al.: Uncoupling protein-3: a new member of the mitochondrial carrier family with tissue-specific expression. FEBS Lett 408(1): 39-42, 1997.

15. Bratanova-Tochkova TK, Cheng H, Daniel S, Gunawardana S, Liu YJ, Mulvaney-Musa J, Schermerhorn T, Straub SG, Yajima H, Sharp GW: Triggering and augmentation mechanisms, granule pools, and biphasic insulin secretion. Diabetes 51 Suppl 1:S83-90, 2002.

67  

16. Brissova M, Fowler MJ, Nicholson WE, Chu A, Hirshberg B, Harlan DM, Powers AC: Assessment of human pancreatic islet architecture and composition by laser scanning confocal microscopy. J Histochem Cytochem 53:1087-1097, 2005.

17. Brubaker,P.L., So,D.C., and Drucker,D.J: Tissue-specific differences in the levels of proglucagon-derived peptides in streptozotocin-induced diabetes. Endocrinology 124: 3003-3009, 1989.

18. Bouillaud F. UCP2, not a physiologically relevant uncoupler but a glucose sparing switch impacting ROS production and glucose sensing. Biochim Biophys Acta. 1787(5): 377-83, 2009.

19. Burcelin R, Knauf C, Cani PD. Pancreatic alpha-cell dysfunction in diabetes. Diabetes Metab. Feb: 34 Suppl 2: S49-55, 2008.

20. Butler AE, Janson J, Bonner-Weir S, Ritzel R, Rizza RA, Butler PC: β-cell deficit and increased B-cell apoptosis in humans with type 2 diabetes. Diabetes 52: 102-110, 2003.

21. Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P. Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural netoworks. Science 269: 546–549, 1995.

22. Cantley J, Burchfield JG, Pearson GL, Schmitz-Pfeiffer C, Leitges M, Biden TJ. Deletion of PKCepsilon selectively enhances the amplifying pathways of glucose stimulated insulin secretion via incrased lipolysis in mouse beta-cells. Diabetes. 58: 1826-1834, 2009.

23. Cannon B, Nedergaard J. Brown adipose tissue: function and physiological significance. Physiol. Rev. 84: 277-359, 2004.

24. Chan CB., MacDonald PE, et al. Overexpression of uncoupling protein 2 inhibits glucose-stimulated insulin secretion from rat islets. Diabetes 48(7): 1482-6, 1999.

25. Chen Q, Vazquez EJ, Moghaddas S, Hoppel CL, Lesnefsky EJ. Production of reactive oxygen species by mitochondria: central role of complex III. J Biol Chem 278:36027-36031, 2003.

26. Choi D, Nguyen KT, Wang L, Schroer SA, Suzuki A, Mak TW, Woo M. Partial deletion of Pten in the hypothalamus leads to growth defects that cannot be rescued by exogenous growth hormone. Endocrinology. 149(9):4382-6, 2008.

27. Choudhury, A. I., H. Heffron, M. A. Smith, H. Al-Qassab, A. W. Xu, C. Selman, M. Simmgen, M. Clements, M. Claret, G. Maccoll, D. C. Bedford, K. Hisadome, I. Diakonov, V. Moosajee, J. D. Bell, J. R. Speakman, R. L. Batterham, G. S. Barsh, M. L. Ashford, and D. J. Withers. The role of insulin receptor substrate 2 in hypothalamic and beta cell function. J. Clin. Investig. 115:940–950, 2005.

28. Cnop M, Welsh N, Jonas JC, Jorns A, Lenzen S, Eizirik DL: Mechanisms of pancreatic beta-cell death in type 1 and type 2 diabetes: many differences, few similarities. Diabetes 54: S97-107, 2005.

29. Coppari R, Ichinose M, Lee CE, Pullen AE, Kenny CD, McGovern RA, Tang V, Liu SM, Ludwing T, Chua SC, Lowell BB, Elmquist JK. The hypothalamic arcuate nucleus: a key site for mediating leptin’s effects on glucose homeostasis and locomotor activity. Cell Metab. 1: 63-72, 2005.

30. Creutzfeldt W, Ebert R: New developments in the incretin concept today. Diabetologia 28:565–573, 1985.

31. D'Adamo M, Perego L, Cardellini M, Marini MA, Frontoni S, Andreozzi F, Sciacqua A, Lauro D, Sbraccia P, Federici M, Paganelli M, Pontiroli AE, Lauro R, Perticone F, Folli

68  

F, Sesti G. The -866A/A genotype in the promoter of the human uncoupling protein 2 gene is associated with insulin resistance and increased risk of type 2 diabetes. Diabetes 53:1905-1910, 2004.

32. Dennis PB, Jaeschke A, Saitoh M, Fowler B, Kozma SC, Thomas G. Mammalian TOR: a homeostatic ATP sensor. Science. 294(5544): 1102-5.

33. Diao J, Asghar Z, Chan CB, Wheeler MB. Glucose-regulated glucagon secretion requires insulin receptor expression in pancreatic alpha-cells. J Biol Chem 280:33487–33496, 2005.

34. Diao J, et al.: UCP2 is highly expressed in pancreatic α-cells and influences secretion and survival. PNAS 105(33):12057-62, 2008.

35. Duval C, Negre-Salvayre A, Dogilo A, Salvayre R, Penicaud L, Casteilla L. Increased reactive oxygen species production with antisense oligonucleotides directed against uncoupling protein 2 in murine endothelial cells. Biochem Cell Biol. 80:757-764, 2002.

36. Echtay KS. Mitochondrial uncoupling proteins – What is their physiological role? Free Radical Biology & Medicine. 43: 1351-1371, 2007.

37. Echtay KS, Roussel D, St-Pierre J, Jekabsons MB, Cadenas S, Stuart JA, Harper JA, Roebuck SJ, Morrison A, Pickering S, Clapham JC, Brand MD. Superoxide activates mitochondrial uncoupling proteins. Nature (London). 415: 96-99, 2002.

38. Echtay KS, Winkler E, Frischmuth K, Klingenberg M. Uncoupling proteins 2 and 3 are highly active H(+) transporters and highly nucleotide sensitive when activated by conenzyme Q (ubiquinone). Proc Natl Acad Sci USA. 98:1416-1421.

39. Ehses JA, Ellingsgaard H, Boni-Schnetzler M, Donath MY. Pancreatic islet inflammation in type 2 diabetes: From alpha to beta cell compensation to dysfunction. Archives of Physiology and Biochemistry. 115(4): 240-247.

40. Emre Y, Hurtaud C, Nubel T, Criscuolo F, Ricquier D & Cassard-Doulcier AM. Mitochondria contribute to LPS-induced MAPK activation via uncoupling protein UCP2 in macrophages. Biochemical Journal 402, 271–278, 2007.

41. Enerback, S., Jacobsson, A., Simpson, E.M., Guerra, C., Yamashita,H, Harper, M.E., and Kozak, L.P. Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387:90–94, 1997.

42. Ferrannini E, Maria A. How to measure insulin sensitivity. Journal of Hypertension. 16(7): 895-906, 1998.

43. Finkel T. Redox-dependent signal transduction. FEBS Letters. 476, 52–54, 2000. 44. Formiguera, X. and A. Canton: Obesity: epidemiology and clinical aspects. Best Pract

Res Clin Gastroenterol 18(6): 1125-46, 2004. 45. Frayling TM Genome-wide association studies provide new insights into type 2 diabetes

aetiology. Nat Rev Genet 8(9):657-662, 2007. 46. Fujimoto K, Shilbasaki T, Yokoi N, Kashima Y, Matsumoto M et al. Piccolo, a Ca2+

sensor in pancreatic beta-cells. Involvement of cAMP-GEFII.Rim2. Piccolo complex in cAMP-dependent exocytosis. J Biol Chem. 277: 50497-50502, 2002.

47. Furukawa S, Fujita T, Shimabukuro M, Iwaki M, Yamada Y, Nakajima Y, Nakayama O, Makishima M, Maatsuda M, Shimomura I. Increased oxidative stress in obesity and its impact on metabolic syndrome. J Clin Invest. 114(12): 1752-61, 2004.

48. Gable DR, Stephens JW, Cooper JA, Miller GJ, Humphries SE. Variation in the UCP2-UCP3 gene cluster predicts the development of type 2 diabetes in healthy middle-aged men. Diabetes 55:1504-1511, 2006.

69  

49. Gelling RW, Morrison CD, Niswender KD, Myers MG Jr., Rhodes CJ, Schwartz MW. Insulin action in the brain contributes to glucose lowering during insulin treatment of diabetes. Cell Metab. 3: 67-73, 2006.

50. Gembal M, Gilon P, Henqin JC. Evidence that glucose can control insulin release independently from its action on ATP-sensitive K+ channels in mouse beta-cells. J Clin Invest. 89: 1288-1295, 1992.

51. Gembal M, Detimary P, Gilon P, Gao ZY, Henquin JC. Mechanisms by which glucose can control insulin release independently from its action on ATP-sensitive K+ channels in mouse beta-cells. J Clin Invest. 91: 871-880, 1993.

52. Gilon P, Henquin JC. Mechanisms and physiological significance of the cholinergic control of the pancreatic Beta-cell function. Endocrin Rev. 22: 565-604, 2001.

53. Gwiazda KS, Yang TL, Lin Y, Johnson JD. Effects of palmitate on ER and cytosolic Ca2+ homeostasis in beta-cells. Am J Physiol Endocrinol Metab. 296(4):E690-701, 2009.

54. Hagman DK, Hay LB, Parazzoli SD, Poitout V. Palmitate inhibits insulin gene expression by altering PDX-1 nuclear localization and reducing MafA expression in isolated rat islets of Langerhans. J. Biol Chem. 280: 32413-32418, 2005.

55. Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, Lallone RL, Burley SK, Friedman JM. Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269: 543–546, 1995.

56. Hamilton DL, Abremski K. Site-specific recombination by the bacteriophage P1 lox-cre system. Cre-mediated synapsis of two lox sites. J Mol Biol. 178: 481-486, 1984.

57. Henquin JC, Ravier MA Nenqin M, Jonas JC, Gilon P. Hierarchy of the beta-cell signals controlling insulin secretion. European Journal of Clinical investigation. 33: 742-750, 2003.

58. Heo JS & Han HJ. ATP stimulates mouse embryonic stem cell proliferation via protein kinase C, phosphatidylinositol 3-kinase/Akt, and mitogen-activated protein kinase signaling pathways. Stem Cells. 24(12): 2637-48, 2006.

59. Inoue H, Ogawa W, Asakawa A, Okamoto Y, Nishizawa A, Matsumoto M, Teshigawara K, Matsuki Y, Watanabe E, Hiramatsu R, Notohara K, Katayose K, Okamura H, Kahn CR, Noda T, Takeda K, Akira S, Inui A, Kasuga M. Role of hepatic STAT3 in brain-insulin action on hepatic glucose production. Cell Metab. 3: 267-275, 2006.

60. Ito E, Ozawa S, Takahashi K, Tanaka T, Katsuta H, Yamaguchi S, Maruyama M, Takizawa M, Katahira H, Yoshimoto K, Nagamatsu S, Ishida H. PPAR-gamma overexpression selectively suppresses insulin secretory capacity in isolated pancreatic islets through induction of UCP-2 protein. Biochem Biophys Res Commun 324:810-814, 2004.

61. Jones PM, Persaud SJ. Protein kinases, protein phosphorylation, and the regulation of insulin secretion from pancreatic beta-cells. Endocrine Rev. 19: 429-461, 1998.

62. Joseph, J. W., V. Koshkin, et al.: Uncoupling protein 2 knockout mice have enhanced insulin secretory capacity after a high-fat diet. Diabetes 51(11): 3211-9, 2002.

63. Joseph JW, et al.: Free fatty acid-induced β-cell defects are dependent on uncoupling protein 2 expression. J Biol Chem 279:51049–51056, 2004.

64. Kaneto H, Miyatsuka T, Kawamori D, Matsuoka TA. Pleiotropic Roles of PDX-1 in the Pancreas. Rev Diabet Stud. 4(4): 209-25, 2007.

65. Könner AC, Janoschek R, Plum L, Jordan SD, Rother E, Ma X, Xu C, Enriori P, Hampel B, Barsh GS, Kahn CR, Cowley MA, Ashcroft FM, Brüning JC. Insulin action in AgRP-

70  

expressing neurons is required for suppression of hepatic glucose production. Cell Metab 5: 438–449, 2007.

66. Korshunov SS, Skulachev VP, Starkov AA. High protonic potential actuates a mechanism of production of reactive oxygen species in mitochondria. FEBS Letters 416:15-18, 1997.

67. Kubota, N., et al. Insulin receptor substrate 2 plays a crucial role in β cells and the hypothalamus. J. Clin. Invest. 114:917–927, 2004.

68. Lam CKL Chari M, Lam TKT: CNS regulaton of glucose homeostasis. Physiology 24, 159-170, 2009.

69. Lam TK, Gutierrez-Juarez R, Pocai A, Rossetti L. Regulation of blood glucose by hypothalamic pyruvate metabolism. Science 309: 943–947,2005.

70. Lee JY, Ristow M, Lin X, White MF, Magnuson MA, Hennighausen L. RIP-Cre Revisited, Evidence for Impairments of Pancreatic Beta-Cell function. The Journal of Biological Chemistry. 281(5):2649-2653, 2006.

71. Lee SC, Robson-Doucette CA, Wheeler MB. Uncoupling protein 2 regulates reactive oxygen species formation in islets and influences susceptibility to diabetogenic action of streptozotocin. Journal of Endocrinology. 203, 1-12, 2009.

72. Levin BE, Routh VH, Kang L, Sanders NM, Dunn-Meynell AA. Neuronal glucosensing: what do we know after 50 years? Diabetes. 53: 2521-2528, 2004.

73. Li N, Brun T, Cnop M, Cunha DA, Eizirik DL, Maechler P. Transient oxidative stress damages mitochondrial machinery inducing persistent beta-cell dysfunction. J Biol Chem. Jun 22. [Epub ahead of print], 2009.

74. Lin, X., et al. Dysregulation of insulin receptor substrate 2 in β cells and brain causes obesity and diabetes. J. Clin. Invest. 114:908–916, 2004.

75. Loonstra, A., Vooijs, M., Beverloo, H. B., Allak, B. A., van Drunen, E., Kanaar, R., Berns, A., and Jonkers, J. Growth inhibition and DNA damage induced by Cre recombinase in mammalian cells. Proc. Natl. Acad. Sci. U. S. A. 98, 9209–9214, 2001.

76. MacLelllan JD, Gerrits MF, Gowing A, Smith PJ, Wheeler MB, Harper ME. Diabetes. 54(8): 2343-2350, 2005.

77. Maestre I Jordan J Soledad C Reig JA Cena V Soria B Prentki M Roche E. Mitochondrial dysfunction is involved in apoptosis induced by serum withdrawal and fatty acids in the beta-cell line INS-1. Endocrinology. 144: 335-345, 2003.

78. Mattiasson G, Shamloo M, Gido G, Mathi K, Tomasevic G, Yi S, Warden CH, Castilho RF, Melcher T, Gonzalez-Zulueta M, Nikolich K, Wieloch T. Uncoupling protein-2 prevents neuronal death and diminishes brain dysfunction after stroke and brain trauma. Nat Med 9:1062-1068, 2003.

79. Muller WA, Faloona GR, Aguilar-Parada E, Unger RH. Abnormal alpha-cell dysfunction in diabetes. Response to carbohydrate and protein ingestion. N Engl J Med. 283: 109-15, 1970.

80. Muoio DM, Newgard CB: Molecular and metabolic mechanisms of insulin resistance and β-cell failure in type 2 diabetes. Nature Reviews 9(3): 193-205, 2008.

81. Nabben M, Hoeks J: Mitochondrial uncoupling protein 3 and its role in cardiac- and skeletal muscle metabolism. Physiology & Behaviour. 94(2): 259-69, 2008.

82. Nagy A. Cre recombinase: the universal reagent for genome tailoring. Genesis 26:99-109, 2000.

71  

83. Nguyen KT, Tajmir P, Lin CH, Liadis N, Zhu XD, Eweida M, Tolasa-Karaman G, Cai F, Wang R, Kitamura T, Belsham DD, Wheeler MB, Suzuki A, Mak TW, Woo M. Essential role of Pten in body size determination and pancreatic beta-cell homeostasis in vivo. Mol Cell Biol. 26(12): 4511-8, 2006.

84. Nibbelink M, Moulin K, Arnaud E, Duval C, Penicaud L, Casteilla L. Brown fat UCP1 is specifically expressed in uterine longitudinal smooth muscle cells. J Biol. Chem. 276: 47291-47295, 2001.

85. Obici S, Feng Z, Morgan K, Stein D, Karkanias G, Rosetti L. Central administration of oleic acid inhibits glucose production and food intake. Diabetes. 51: 271-275, 2002.

86. Obici S, Zhang BB, Karkanias G, Rossetti L. Hypothalamic insulin signaling is required for inhibition of glucose production. Nat Med 8: 1376–1382, 2002.

87. Olofsson CS, Collins S, Bengtsson M, Eliasson L, Salehi A, Shimmomura K, Tarasov A, Holm C, Ashcroft F, Rorsman P. Long-term exposure to glucose and lipids inhibits glucose-induced insulin secretion downstream of granule fusion with plasma membrane. Diabetes. 56: 1888-1897, 2007.

88. Parton, L.E., Ye, C.P., Coppari, R., Enriori, P.J., Choi, B., Zhang, C.Y., Xu, C., Vianna, C.R., Balthasar, N., Lee, C.E., Elmquist, J.K., Cowley, M.A., Lowell, B.B: Glucose sensing by POMC neurons regulates glucose homeostasis and is impaired in obesity. Nature 449, 228-232, 2007.

89. Patane G, Anello M, Piro S, Vigneri R, Purrello F, Rabuazzo AM. Role of ATP production and uncoupling protein-2 in the insulin secretory defect induced by chronic exposure to high glucose or free fatty acids and effects of peroxisome proliferator-activated receptor-gamma inhibition. Diabetes 51:2749-2756, 2002.

90. Pecqueur C, M. C. Alves-Guerra, et al.: Uncoupling protein 2, in vivo distribution, induction upon oxidative stress, and evidence for translational regulation. J Biol Chem 276(12): 8705-12, 2001.

91. Pecqueur C, Cassard-Doulcier AM, Raimbault S, C. Fleury B, Gelly C, Bouillaud F, Ricquier D. Biochemical and Biophysical Research Communications. 255(1): 40-46, 1999.

92. Pelleymounter MA, Cullen MJ, Baker MB, Hecht R, Winters D, Boone T, Collins F. Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269: 540–543, 1995.

93. Pi J, Bai Y, Zhang Q, Wong V, Floering LM, Daniel K, Reece JM, Deeney JT, Andersen ME, Corkey BE, Collins S. Reactive oxygen species as a signal in glucose-stimulated insulin secretion. Diabetes 56:1783-91, 2007.

94. Pi J, Bai Y, Daniel KW, Liu D, Lyght O, Edelstein D, Brownlee M, Corkey BE, Collins S. Persistent oxidative stress due to absence of uncoupling protein 2 associated with impaired pancreatic beta-cell function. Endocrinology. Feb 26. [Epub ahead of print], 2009.

95. Poitout,V, Robertson,RP: Minireview: Secondary beta-cell failure in type 2 diabetes-a convergence of glucotoxicity and lipotoxicity. Endocrinology 143:339-342, 2002.

96. Pomplun D, Florian, S, Schulz, T, Pfeiffer, AFH, Ristow M: Alterations of Pancreatic Beta-cell Mass and Islet Number due to Ins2-controlled Expression of Cre Recombinase: RIP-Cre Revisited; Part 2. Horm. Metab. Res. 39: 1-5, 2007.

97. Produit-Zengaffinen,N., Davis-Lameloise,N., Perreten,H., Becard,D., Gjinovci,A., Keller,P.A., Wollheim,C.B., Herrera,P., Muzzin,P., and Assimacopoulos-Jeannet,F:

72  

Increasing uncoupling protein-2 in pancreatic beta cells does not alter glucose-induced insulin secretion but decreases production of reactive oxygen species. Diabetologia 50, 84-93, 2007.

98. Raskin P, Aydin I, Yamamoto T, Unger RH. Abnormal alpha cell function in human diabetes: the response to oral protein Am J Med. 64: 988-97, 1978.

99. Ray MK, Fagan SP, Moldovan S, DeMayo FJ and Brunicardi FC: A Mouse Model for Beta Cell-Specific Ablation of Target Gene(s) Using the Cre-loxP System. Biochemical and Biophysical Research Communications. 253, 65-69, 1998.

100. Rhodes CJ: Type 2 diabetes – a matter of beta-cell life and death? Science 307(5708): 380-384, 2005.

101. Roberts CK, Sindhu KK. Oxidative stress and metabolic syndrome. Life Sci. May 22;84(21-22):705-12, 2009

102. Saleh, M.C., Wheeler, M.B., Chan, C.B.: Uncoupling protein-2 evidence for its function as a metabolic regulator. Diabetologia 45: 174-187, 2002.

103. Samec, S., Seydoux, J, Dulloo, A.G: Role of UCP homologues in skeletal muscles and brown adipose tissue: mediators of thermogenesis of regulators of lipids as fuel substrates? Faseb J 12(9): 715-24, 1998.

104. Scheffler, I.E.: Mitochondria make a comeback. Advanced Drug Delivery Reviews. 49(1-2): 3-26, 2001.

105. Sesti G, Cardellini M, Marini MA, Frontoni S, D'Adamo M, Del Guerra S, Lauro D, De Nicolais P, Sbraccia P, Del Prato S, Gambardella S, Federici M, Marchetti P, Lauro R. A common polymorphism in the promoter of UCP2 contributes to the variation in insulin secretion in glucose-tolerant subjects. Diabetes 52:1280-1283, 2003.

106. Shimabukuro M, Higa M, Zhou YT, Wang MY, Newgard CB, Unger RH. Lipoapoptosis in beta-cells of obese prediabetic fa/fa rats. Role of serine palmitoyltransferase overexpression. J Biol Chem. 273: 32487-32490, 1999.

107. Shu L, Matveyenko AV, Kerr-Conte J, Cho JH, McIntosh CHS, Maedler K. Decreased TCF7L2 protein levels in type 2 diabetes mellitus correlate with downregulation of GIP- and GLP-1 receptors and impaired beta-cell function. Human Molecular Genetics. 18(13): 2388-2399, 2009.

108. Silver, D. P., and Livingston, D. M. Self-excising retroviral vectors encoding the Cre recombinase overcome Cre-mediated cellular toxicity. Mol. Cell 8, 233–243, 2001.

109. De Souza CT, Araujo EP, Stoppiglia LF, Pauli JR, Ropelle E, Rocco SA, Marin RM, Franchini KG, Carvalheira JB, Saad MJ et al. Inhibition of UCP2 expression reverses diet-induced diabetes mellitus by effects on both insulin secretion and action. FASEB Journal. 21 1153–1163, 2007.

110. Thomas HE, Graham KL, Angstetra E, McKenzie MD, Dudek NL, Kay TW. Interferon signallin in pancreatic beta cells. Front Biosci. 14: 644-56, 2009.

111. Takahashi A, Motomura K, Kato T, Yoshikawa T, Nakagawa Y, Yahagi N, Sone H, Suzuki H, Toyoshima H, Yamada N, Shimano H. Transgenic mice overexpressing nuclear SREBP-1c in pancreatic beta-cells. Diabetes 54:492-499, 2005.

112. Unger R. Insulin glucagon relationship in the defense against hypoglycaemia. Diabetes. 32: 575-83, 1983.

113. Victor VM, Rocha M, Banuls C, Sanchez-Serrano M, Sola E, Gomez M, Hernandez-Mijares A. Mitochondrial Complex I Impairment in Leukocytes from

73  

Polycystic Ovay Syndrome Patients with Insulin Resistance. J Clin Endocrinol Metab. Jun 30. [Epub ahead of print], 2009.

114. Voyziyanov Y, Pathania S, Jayaram M. A general model for site-specific recombination by the integrase family recombinases. Nucleic Acids Res. 27:930-941, 1999.

115. Walker JE, Runswick MJ: The mitochondrial transport protein superfamily. J Bioenerg Biomembr. 25(5), 435-446, 1993.

116. Wei Y, Chen K, Whaley-Connell AT, Stump CS, Ibdah JA, Sowers JR. Skeletal muscle insulin resistance: role of inflammatory cytokines and reactive oxygen species. American Journal of Physiology. 294 (3), R673–680, 2008.

117. Weir GC, Knowlton SD, Atkins RF, McKennan KX, Martin DB. Glucagon secretion from the perfused pancreas of streptozotocin-treated rats. Diabetes. 25: 275-82, 1976.

118. Zhang CY, Parton LE, Ye CP, Krauss S, Shen R, Lin CT, Porco JA, Jr., Lowell BB. Genipin inhibits UCP2-mediated proton leak and acutely reverses obesity- and high glucose-induced beta cell dysfunction in isolated pancreatic islets. Cell Metab. 3:417-427, 2006.

119. Zhang CY, G. Baffy, et al.: Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, beta cell dysfunction, and type 2 diabetes. Cell. 105(6): 745-55, 2001.