Cancer Investigation, 26:900–904, 2008ISSN: 0735-7907 print / 1532-4192 onlineCopyright c© Informa Healthcare USA, Inc.DOI: 10.1080/07357900802087259

ORIGINAL ARTICLECellular and Molecular Biology

Can The Lack of HSP90α Protein in Brain NormalTissue and Cell Lines, Rationalise it as a Possible

Therapeutic Target for Gliomas?Amal Shervington,1 Nichola Cruickshanks,1 Robert Lea, Gareth Roberts,2 Tim Dawson,3 and Leroy Shervington1

Neurosurgery Department, Royal Preston Hospital, Brain Tumor North West, Preston, UK1

Faculty of Science and Technology, University of Central Lancashire, Preston, UK2

Pathology Laboratory, Royal Preston Hospital, Preston, UK3

ABSTRACT

Despite studies suggesting a role for HSP90α in tumorigenesis, there are no reports as to itsexpression in normal human brain tissue. In this study, the expression of HSP90αwas evaluatedin both cell lines (3 gliomas and 2 controls) and brain tissue specimens of 10 patients (8 gliomasand 2 normal brain tissues). No HSP90α protein was detected in either normal cell lines ornormal brain tissue. However, 8/8 glioma tissues and 3/3 glioma cell lines did express HSP90α.These findings provide a rationale for targeting HSP90α protein as a therapeutic candidate forglioma.

INTRODUCTION

The heat shock protein (HSP90), also described as a molecu-lar chaperone, is one of the most abundant proteins in eukaryoticcells (1–3). Its large conformational flexibility together with amultitude of dynamic co-chaperone complexes contribute to afunctional diversity which covers various pathways, includingsignaling, protein folding and tumor repression (1–3). However,the mechanisms and specificities of HSP90 function in each rolevaries (1–5). In humans, there are two major cytoplasmic HSP90isoforms α and β with a sequence homology of 85%, whichprobably results from gene duplication events and have occurredover evaluation (8). HSP90β, the minor form constitutively ex-pressed, whereas, in contrast, HSP90α the major form is induced(6, 7). Due to its inducible expression and its role in cell cycleprogression and apoptosis, in addition to its role involving malig-nant phenotypes, such as invasion, angiogenesis, and metastasis

Keywords: HSP90α, normal brain tissues, gliomas, expressionThis work was supported by a grant from the Royal PrestonHospital, SeedCorn and Sydney Driscoll NeuroscienceFoundation (SDNF).Correspondence to:Amal Shervingtontel: +44 (0) 1772893589fax: +44 (0) 1772892929e-mail: aashervington@uclan.ac.uk.

(9, 10), HSP90α possibly represents a relevant role as a gliomadrug target. For HSP90α to be a valid therapeutic candidate, itneeds to be exclusively expressed in glioma cells. Thus, the aimof this research was to measure and compare HSP90α expressionin normal brain, glioma tissue and specific cell lines.

MATERIAL AND METHODS

Tissues and cells culture

Tumor samples were obtained from glioma cancer patients,admitted to the Royal Preston Hospital, UK. Control materialwas obtained from patients who required resection of normalbrain for purposes other than primary glioma treatment. Writ-ten consent and ethical approval was granted prior to the tissuesbeing used in this investigation. For each patient, one samplewas surgically dissected and immediately frozen in liquid nitro-gen prior to assay. Tissue used in the investigation included: arecurrent anaplastic astrocytoma, seven glioblastomas and twonormal brain samples.

The human brain cell lines 1321N1 (astrocytoma) (ECACC,Salisbury, UK), GOS-3 (mixed astro-oligodendroglioma)(DMSZ, Braunschweig) and U87-MG (glioblastoma astrocy-toma) (ECCAC) were routinely cultured in the laboratory.1321N1 and GOS-3 cells were cultured in Dulbecco’s mod-ified Eagle’s medium (DMEM) (Sigma, Poole, UK), whilstU87-MG cells were cultured in Eagle’s minimum essential

900

Can

cer

Inve

st D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

B K

iel o

n 11

/06/

14Fo

r pe

rson

al u

se o

nly.

medium (EMEM) (Sigma). The normal embryonic brain tissueFLOW3000 cell line was cultured in EMEM, and all the cul-ture media were supplemented with 2 mM L-glutamine (Sigma)and 10% (v/v) FBS (Gibco-BRL, Paisley, UK). One exceptionwas that 4 mM of L-glutamine was added to the GOS-3 cellline medium. Normal human astrocytes: NHA cells (ScienCell,Carlsbad, CA, USA)were cultured in astrocyte medium (Scien-Cell), and cells were incubated at 37◦ C in a humidified 5% CO2

incubator.

mRNA isolation, reverse transcription andqRT-PCR

An average of 1 ρg/cell of mRNA was extracted from tis-sues or cell lines using a mRNA Isolation Kit (Roche, WestSussex, UK) according to the manufacturer’s instructions. Iso-lated mRNA (100 ng) was transcribed to cDNA using a FirstStrand cDNA Synthesis Kit (Roche), which was then used as atemplate for PCR. QRT-PCR (Real time PCR) was used to eval-uate the expression of hsp90α and GAPDH (glyceraldehyde-3-phosphate dehydrogenase as a control). Primer (TIB MOL-BIOL, Berlin, Germany) sequence and length of the ampliconswere: hsp90α (189 bp) sense: 5’tctggaagatccccagacac, anti-sense: 5’agtcatccctcagccagaga, and GAPDH (226 bp) sense:5′gagtcaacggatttggtcgt, antisense: 5′ttgattttggagggatctcg. PCRwas performed using Fast Start DNA master PLUS SYBR Green1 (Roche) in a LightCycler real-time PCR detection system(Roche Diagnostics, Grenzach-Wyhlen, Germany) according tothe protocol described previously (11). All PCR reactions wereperformed in triplicate, and a negative control (no DNA) wasincluded.

Immunofluorescence

Cells were initiated on culture slides in 6 well plates so asto achieve 60% adherence after 48 hours. After this time, cellswere fixed with 4% paraformaldehyde, washed three times withwarmed PBS and permeablised with 0.3% Triton X-100 at roomtemperature for 7 minutes. The cells were then removed, washed(PBS, x3) and incubated in blocking solution before mono-clonal antibodies against primary HSP90α (1:50) (CambridgeBioscience, Cambridge, UK) was added for 1 hour. Followingwashing, a secondary antibody (goat anti-rat IgG FITC [1:128])was added to the wells and incubated for 1 hour with gentle agi-tation. Cells were washed again with PBS, counter stained withPI, mounted and fixed on slides for analysis.

Copy number calculation and statisticalanalysis

Quantitative amplification was monitored by the level offluorescence reflecting the cycle number at detection thresh-old (crossing point). Crossing points were used for quantifica-tion of the copy number of genomic DNA normalized by usingGAPDH as a reference gene. A standard curve was generated us-ing the crossing points generated from different concentrationsof genomic DNA with known copy numbers. Different crossing

points of each gene were normalized using a standard curve toobtain the copy numbers for each of the amplified genes. Allexperiments were carried out using similar cells numbers.

All quantitative data was presented as mean ± S.D. of threeseparate experiments and subjected to a Student’s two-tailed t-test for between group differences and pairwise comparisonsamong groups. P < 0.001 was regarded as statistically signifi-cant.

RESULTS

The expression of HSP90α was evaluated in 3 gliomas, anembryonic brain and a normal astrocyte cell line, in addition tobrain tissue specimens of 10 patients (8 gliomas and 2 normalbrain tissues; 4 males and 6 females aged 16 to 66 years with amean age of 45.7 ± 19.14 years) by RT-PCR and immunofluo-rescence.

The three glioma cell lines, 1321N1, U87-MG and GOS-3,transcribed hsp90α at a high copy number, whilst in contrast,the embryonic and astrocyte normal brain cells demonstrated alow though detectable level of mRNA (Fig.1, Table 1). A differ-ent transcription pattern was detected with the tissues, hsp90α

mRNA was highly transcribed in the glioma tissue in additionto the normal tissues (Fig. 1, Table 1).

Fig. 2 represents a sample of the stained cells and tissuesshowing the positive staining for HSP90α. Immunofluorescentdetection of protein expression was quantified as a percentageof HSP90α positive cells in each sample. For each sample, 250cells were counted.

Hsp90α antigen detected with FITC conjugate secondary an-tibody was mainly observed in the cytoplasm. However, in a fewcells expression was also observed in the nucleus (Fig. 2). Therewas a clear correlation between mRNA copies and protein levelin glioma cell lines and tissues; however, such a relationship isabsent in the normal cell lines and tissues (Table 1). The induc-tion level of HSP90α was high in the glioma cell lines and tissueswith little or trace amount of HSP90α protein detected in nor-mal cell lines and normal brain tissue (Table 1). Age and genderdid not appear to significantly influence expression within thetissues.

DISCUSSION

The integral roles of heat shock proteins in the cell cycletogether with the extracellular role of HSP90α in cancer inva-siveness have been explored (12). However, neither constitutivenor induced expression of HSP90α have been studied in gliomaor normal brain tissues.

The results from the study indicate that Hsp90α is highlyexpressed at both mRNA and protein level in glioma cell linesand tissues. Furthermore, the median increase in mRNA tran-scription in glioma compared with non-glioma brain tissue issignificantly higher for the cell lines (6.8x103-fold) comparedwith tissues (27-fold). In the glioma cell lines, the median ex-pression of hsp90α is much higher than glioma tissues (6.15x104 versus 2.1x104 mRNA copies).

Lack of HSP90α Protein in Brain Normal Tissue and Cell Lines 901

Can

cer

Inve

st D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

B K

iel o

n 11

/06/

14Fo

r pe

rson

al u

se o

nly.

Figure 1. Copy numbers of constitutive gene expression level of (A) 1321N1, U87-MG, GOS-3, FLOW3000 and NHA cell lines; (B) Primarycancerous cells (T1-T8) and primary normal cells (N1-N2) (data values are mean + standard deviation of three independent experiments).

An interesting observation from this study is the notionthat there is a higher hsp90α gene amplification in gliomacell lines compared to tissues. This may be attributed to ahigher demand of the deregulated client proteins in the celllines.

No HSP90α protein was detected in the normal cell lines,and only trace amounts were detected in one of the normal braintissues. However, low copy numbers of hsp90α mRNA weredetected in normal cell lines with higher copy numbers in thenormal brain tissues. This data is in agreement with previouscitations where Hsp90α mRNA level has also been reported asbeing significantly higher in breast and colon cancer tissue incomparison to non-cancer tissue, suggesting that the increased

expression of HSP90α may be associated with proliferation ofhuman cancer cells (13–15).

The relationship between gene expression measured at themRNA level and the corresponding protein level has not beenvery well characterized in human cancer (16). Data from previ-ous studies carried out on adenocarcinomas lung tissues showedthat no significant mRNA/protein correlation coefficient wasfound among proteins with multiple isoforms, suggesting sep-arate isoform-specific mechanisms for the regulation of proteinabundance (16). The expression of the α and β isoforms ofHSP90 together with events, such as post-translational mecha-nisms, may account for the regulation of HSP90 in normal andcancer tissues.

Table 1. Human cell lines and tissues used in the study

Cell Line Diagnosis

% cellsexpressing

Hsp90α

Hsp90α mRNA/100ηg cells extract

(1 x 106cells)

1 1321N1 Astrocytoma 71 1715672 U87-MG Glioblastoma astrocytoma 64 115613 GOS-3 Mixed astrooligodendroglioma 84 12784 FLOW3000 Embryonic, brain 0 35 NHA Normal astrocytes 0 15

Tissues

Diagnosisaccording to

WHO Age Gender

% cellsexpressing

Hsp90α

Hsp90α

mRNA/ 100ηg tissues

T1 Recurrent anaplasticependymoma

34 Female 38 195

T2 Glioblastoma 16 Female 24 106T3 Glioblastoma 23 Female 75 150722T4 Glioblastoma 37 Male 41 386T5 Glioblastoma 46 Female 68 16793T6 Glioblastoma 62 Male 50 1535T7 Glioblastoma 67 Female 48 779T8 Glioblastoma 68 Male 43 264N1 Normal Brain 38 Female 5 1081N2 Normal Brain 66 Male 0 501

902 A. Shervington et al.

Can

cer

Inve

st D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

B K

iel o

n 11

/06/

14Fo

r pe

rson

al u

se o

nly.

Figure 2. Hsp90α protein levels assessed using immunofluorescence: (A) T3 (Primary cancerous cell); (B) 1321N1 cells. (1) nuclei labelled withpropidium iodide, (2) Hsp90α antigen detected with FITC conjugate secondary antibody and (3) Combined nuclei and antigen staining.

HSP90α is expressed at low or undetectable levels in theconstitutive unstressed normal cells and tissues, and its ex-pression is rapidly induced by cancer (12). Due to the factthat HSP90α is a highly induced form (6,15), the high mRNAcopy numbers detected in normal tissues may be essential forthe induction and activation of HSP90α in cancers and otherdiseases.

Cells are known to rate limit gene expression by alteringtheir mRNA and subsequently their protein levels through copynumber, splicing pattern, induction level, and mRNA stabilitycontrol elements (17). The hsp90α gene is inducibly regulatedby exposure to stress from a low basal level to a high rate oftranscription, utilizing splicing variance for its 10 introns (6,18).

Although normal proteins appear to require limited assistancefrom chaperones, their aberrant counterparts are highly depen-dent on Hsp90, whereas the enhanced Hsp90 affinity for mutatedor functionally deregulated client proteins have been observedfor several oncoproteins (19). In cancer, HSP90 is induced andretained to help stabilize mutated proteins in an effort to maintainits functionality. Thus, it is expected that mutated proteins, suchas oncoproteins, are much more sensitive to HSP90α inhibitioncompared to normal proteins. Furthermore, induced HSP90α,and not HSP90β, is found to be expressed extracellularly infibrosarcoma and breast cancer cells where it interacts with var-ious proteins (12). Hence, Hsp90α as an extracellular proteinmay enhance the role of cell impermeable anti-HSP90α drugsto decrease cancer invasiveness without concerns inherent in in-hibiting intracellular HSP90. The data obtained from this study

demonstrates that HSP90α protein induction in both glioma tis-sue and cell lines validates its role as a possible therapeutic targetfor gliomas.

REFERENCES1. Pearl, L.H.; Prodromou, C. Structure, function, and mechanism

of the Hsp90 molecular chaperone. Adv Protein Chem 2001, 59,157–186.

2. Csermely, P.; Schnaider, T.; Soti, C.; Prohaszka, Z.; Nardai, G.The 90-kDa Molecular Chaperone Family Structure, Function, andClinical Applications. A Comprehensive Review Pharmacol Ther1998, 79, 129–168.

3. Richter, K.; Buchner, J. Hsp90: Chaperoning signal transduction.J Cell Physiol 2001,188, 281–290.

4. Picard, D. Heat-shock protein 90, a chaperone for folding and reg-ulation Cell. Mol Life Sci 2002, 59, 1640–1648.

5. Pratt, W.B.: Toft, D.O.: Regulation of signalling protein function andtrafficking by the hsp90/hsp70-based chaperone machinery. ExpBiol Med 2003, 228, 111–133.

6. Sreedhar, A.: Kalmar, E.: Csermely, P. Shen, Y. Hsp90 isoforms:functions, expression and clinical importance FEBS 2004, 562,11–15.

7. Millson, S.: Truman, A.: Racz, A.: Hu, B.: Panaretou, B.: Nuttall,J.: Mollapour, M.: Soti, C.: Piper, P. Expressed as the sole Hsp90of yeast, the α and β isoforms of human Hsp90 differ with regardto their capacities for activation of certain client proteins, whereasonly Hsp90β generates sensitivity to the Hsp90 inhibitor radicicolFEBS 2007, 274, 4453–4463.

8. Gupta, R.S.: Phylogenetic analysis of the 90 kD heat shock familyof protein sequences and an examination of the relationship amonganimals, plants, and fungi species. Mol Biol Evol 1995, 12, 1063–1073.

Lack of HSP90α Protein in Brain Normal Tissue and Cell Lines 903

Can

cer

Inve

st D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

B K

iel o

n 11

/06/

14Fo

r pe

rson

al u

se o

nly.

9. Ciocca, D.R.: Calderwood, S.K. Heat Shock Proteins in Cancer:diagnosis, prognostic predictive and treatment implications. CellStress and Chaperones 2005, 10, 86–103.

10. Graner, M.: Bigner, D.: Chaperone proteins and brain tumours:Potential targets and possible therapeutics. Neuro-Oncology 2005,7, 260–277.

11. Patel, R.: Shervington, L.: Lea, R.: Shervington, A. Epigeneticsilencing of telomerase and a non-alkylating agent as a noveltherapeutic approach for glioma, Brain Res 2008, 1188, 173–181.

12. Eustace, B.K.: Sakurai, T.: Stewart, J.K.: Yimlamai, D.: Unger, C.:Zehetmeier, C.: Lain, B.: Torella, C.: Henning, S.W.: Beste, G.:Scroggins, B.T.: Neckers, L.: Ilag, L.L.: Jay, D.G.: Functional pro-teomic screens reveal an essential extracellular role for hsp90alpha in cancer cell invasiveness. Nat Cell Biol 2004, 6, 507–514.

13. Yano, M.: Naito, Z.: Yokoyama, M.: Shiraki, Y.: Ishiwata, T.:Inokuchi, M.: Asano, G. Expression of hsp90 and cyclin D1 in hu-man breast cancer. Cancer lett 1999, 137, 45–51.

14. Park, K.: Byun, H.: Won, M.: Yang, K.: Shin, S.: Piao, L.:Kim, J.: Yoon, W.: Junn, E.: Park, J.: Seok, J.: Hur’ G.: Sus-

tained activation of protein kinase C downregulates nuclearfactor-B signaling by dissociation of IKK- and Hsp90 complexin human colonic epithelial cells Carcinogenesis 2007, 28, 71–80.

15. Pearl, L.H.: Prodromou, G.: Workman, P. The Hsp90 molecularchaperone: an open and shut case for treatment, Biochem J 2008,410, 439–453.

16. Chen, G.: Gharib, T.: Huang, C.: Taylor, J.: Misek, D.: Kardia, S.:Giordano, T.: Iannettoni, M.: Orringer, M.: Hanash, S.: Beer, D. Dis-cordant protein and mRNA expression in lung ddenocarcinomas.Molecular & Cellular Proteomics 2002, 1, 304–313.

17. Patel, A.: McCarthy, M.: Steitz, J. The splicing of U12-type intronscan be a rate-limiting step in gene expression. EMBO 2002, 21,3804–3815.

18. Jolly, C.: Vourc’h, C.: Robert-Nicoud, M.: Morimoto, R. Intron-independent association of splicing factors with active genes. JCell Biol 1999, 145, 1133–1143.

19. Luo, W.: Dou, F.: Rodina, A.: Chip, S.: Kim, J.: Zhao, Q.: Moulick, K.:Aguirre, J.: Wu, N.: Greengard, P.: Chiosis. G. Roles of heat-shockprotein 90 in maintaining and facilitating the neurodegenerativephenotype in tauopathies. PNAS 2007, 21, 9511–9516.

904 A. Shervington et al.

Can

cer

Inve

st D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

B K

iel o

n 11

/06/

14Fo

r pe

rson

al u

se o

nly.