Indian Journal of Biotechnology

Vol. 7, October 2008, pp 478-481

The PCR amplification, sequencing and computer-aided analysis of

ovine αS1-casein gene promoter

S K Bhure* and B Sharma

1

*Project Directorate on Animal Disease Monitoring And Aurveillance, IVRI Campus, Hebbal, Bangalore 560 024, India

1Indian Veterinary Research Institute, Izatnagar 243 122, India

Received 12 October 2006; revised 13 February 2008 ; accepted 15 April 2008

The paper reports 5'-flanking sequences of ovine αS1-CSNGP (casein gene promoter) of 2185 bp. It has shown many

deletions, substitutions and a 12 bp addition compared to bovine sequence. The comparative study showed 2136 bp of

5′-flanking region and 49 bp exon I sequence. The exon I sequence contained two ribosomal binding sites. The

computational analysis showed presence of core promoter elements, viz., TATA box, CAAT box and initiator sequence.

However, no typical GC box was found. Of five known mammary gland specific sequences, three sequences, viz., milk box,

Groenen structure and Yu Lee 6, were found. The 220 bp Groenen structure contained other milk protein gene specific

sequences (MGF, MPBF, Yu Lee 2, 4 and 5, and Oka box C) and hormone responsive elements (PRE, PRL-RE). Other

HREs (GRE, CRE, GHRE and IRE) and ubiquitous transcription factor binding sites were also present. These milk protein

gene specific regulatory sequences and HREs are responsible for tissue specific and multi-hormone regulation of the ovine

αS1-CSNG.

Keywords: Ovine αS1-caseine gene promoter, gene regulation, transcription factor binding sites, hormone responsive elements

Introduction

The production of transgenic animals, expressing

the foreign DNA sequence introduced into their

genome, is a powerful technique for both biological

research and bio-industry. The promoters of milk

protein genes have been used to produce human

proteins in mammary glands that are essential for the

treatment of many diseases1,2

. The elements which

regulate tissue specific expression have to be present

in the promoter region for production of heterologous

protein of interest. So far, the studies utilizing bovine

αS1-casein gene (αS1-CSNG) promoter demonstrated

high level of expression in the milk of transgenic

animals3,4

. The characterization of transcript

regulatory sequences in the promoter regions of any

gene is an important prerequisite for understanding

the interplay of various regulatory/hormone

interactions which control their expression. However,

this kind of study requires a mammary gland specific

cell lines which are capable of expressing

heterologous protein gene consistently. The

computer-aided search of milk protein gene promoters

for various cis-acting DNA elements and trans-acting

factors will simplify the transcription regulation

studies to a greater extent. The promoter of

αS1-CSNG gene of sheep has not been characterized.

Therefore, the promoter region was cloned and

sequenced. The sequence was then submitted to

GenBank database of the National Center for

Biotechnology Information (NCBI, acc. no.

AJ784891).

Materials and Methods The genomic DNA was isolated from 5 mL of

sheep blood as per the method described by

Sambrook and Russel5. The DNA isolated from

polymorph nuclear leucocytes was used as template

for PCR. A set of primers was designed from the

conserved regions of heterologous sequences of

αS1-CSNG available on NCBI, GenBank. The Hot-

start PCR conditions were standardized by using

gradient PCR with varied concentration of MgCl2.

The PCR mixture contained 25 pM of each primer

(Forward Primer, 5′-CCA GAT GGG CAT GAA

AAA GGA-3′ and Reverse Primer, 5′-AAC CCA

AGA CTG GGA AGA AG-3′), 200 M of each dNTP

and 1.5 U of XT-Taq DNA polymerase (Banglore

Genei, India) in a final volume of 50 µL. The Hot-

start PCR was performed as follows: denaturation at

94°C for 60 sec; annealing at 65°C for 60 sec;

_________________

*Author for correspondence:

Tel: 91-80-23419576; Fax: 91-80-23415329

E-mail: sdbhure@rediffmail.com

BHURE & SHARMA: OVINE α S1 CASEIN GENE PROMOTER

479

extension at 72°C for 2 min in 35 cycles. The PCR

product was gel purified by using GenTM

Elute Gel

extraction kit (Sigma, USA) as per the

manufacturer’s protocol and cloned in pGEMT-Easy

cloning vector (Promega, USA). Two recombinant

clones were sequenced completely for both strands

(ABI Prism 310).

All the related milk protein gene sequences were

down loaded from GenBank, NCBI. The sequences

were edited for 5′-flanking regions and checked for

sequence homology with ovine αS1-CSNGP using

MegAlign of DNAstar molecular biology software.

Homology map of 5′-flanking regions was

constructed between ovine αS1-CSNGP and different

casein genes of sheep, goat, cattle, buffalo, yak, rabbit

and rat. Computer analysis of putative cis- and trans-

regulatory sequences in the promoter region of ovine

αS1-CSNG was carried out by Gene Tool Lite and

DNASIS molecular biology software. Separate

database was prepared in DNASIS for various milk

protein associated consensus transcription factor-

binding sequences available in the literature.

Results and Discussion The full-length cloned fragment was 2185 bp. The

comparison of 3′-end sequence of cloned 2185 bp

fragment with that of 5′-end 45 bp ovine αS1-CSNG

mRNA showed absolute homology. This 49 bp region

is exon I sequence, which is conserved across rat

α-, β-, γ-casein and bovine αS1-casein gene6. This

exon I sequence was edited from the ovine DNA

fragment to get 5′-flanking region of the ovine αS1-

CSNG. The sequence had shown 91.2% homology

with goat (GenBank acc. no. AJ504712), 91.7% with

cattle (GenBank acc. no. X59856), 81.9% with yak

(GenBank acc. no. AF194983), 89.9% with bovine

αS1-CSN (GenBank acc. no. AF529305 segment 1).

Thus, comparison showed significant homology with

closely related species (bovine, goat, buffalo and yak)

and low/insignificant homology was observed with

camel, rabbit and rat αS1-casein gene. The highest

homology was with bovine and caprine αS1-CSNG

5′-flanking regions.

Since the complete 5′-flanking sequence of bovine

αS1-CSNG was available and had shown significant

homology with ovine amplicon. The bovine sequence

(GenBank acc. no. X59856) was considered for

further analysis and also because of close

evolutionary relationship and presumably unmodified

transcription factor binding site preferences. The

ovine promoter region had shown additional

sequences at -1005 to -992, -240 to -237 and -221 to -

218. A 12 bp additional sequence was also noted

whose role, if any, in influencing promoter activity

requires further study.

On the basis of sequence comparison with bovine

αS1-casein gene promoter6, we predicted a putative

transcription start site CCA+1

TCA, which has the

same sequence as that of initiator consensus

YYA+1

(T/A)YY. The exon I showed two ribosomal

binding sites CCTTGATCA, centered at +5/+13 and

GCTGCTTC at +26/+336-8

. The amplified ovine αS1-

CSNGP contained complete non-coding exon I except

for last four nucleotides, CAAG.

The comparison with known consensus sequences

of both ubiquitous and specific transcription factor

motifs described for milk protein gene promoters

showed several motifs common to different milk

protein gene promoters as described previously9-13

.

The data of consensus sequences showing stringent

homology are arranged as milk protein specific

sequences (Table 1) and hormone receptor consensus

sequences (Table 2). The motifs are distributed

throughout the ovine αS1-casein 5′-flanking region.

However, most of the milk gene promoter specific

motifs are clustered between transcription initiation

Table 1 —Mammary gland-specific-transcription factors and consensus sequences analysed in ovine αS1-CSNGP.

Abbreviation Mammary specific factor Consensus Position

MAF Mammary cell activating factor GRRGSAAGK -757

MPBF/MGF/STAT 5 Mammary gland specific

nuclear factor

RNTTCYTRGAAYY -98, -1937

YY 1 Yin and Yang factor 1 CCATNT -196, -1420, -1514, -1712

Yu-Lee 2 MCYYAGAATYT -155

Yu-Lee 4 TTCTTAGAATT -98

Yu-Lee 5

Mammary gland specific

sequences

RAAACCACARAATTAGCAT -64

Yu-Lee 6 RGTWTAWATAG -31

Oka box C AAACCACAAAATTAGCATTTTA -63

INDIAN J BIOTECHNOL, OCTOBER 2008

480

site and -155, except for MAF and an upstream MGF

site. The sequence was also searched for basal

promoter elements, viz., transcription start

site/initiator sequence, TATA signal, GC box and

CAAT box. The ovine αS1-CSNGP contains a

sequence TTTAAATA at -29, which showed

homology with the TATA box of cattle, buffalo,

camel, rat αS1-CSNG and γ-CSN gene of rat. A

sequence, CAAAAT resembling CAAT box of rabbit

β-casein gene promoter was found at -57 (Gen Bank

acc. no. X 15735). An MGF/MPBF STAT5 sequence

were located at -98 and -193711-15

. MGF is a

transcription factor discovered initially in the

mammary epithelial cells of lactating animals and is a

novel member of the cytokine-regulated transcription

factor gene family and known to mediate prolactin

responsiveness of milk protein gene expression. The

MGF/MPBF/STAT5 site found in ovine αS1-CSNGP

may be presumed to confer prolactin hormone

induction. In ovine αS1-CSNGP, the DNA segment

between -240 to -20 showed 96% homology to the

“Groenen structure” consensus sequence11

. This 220

bp DNA segment contains MGF/MPBF, Yu Lee 2, 4,

5 and 6, Oka box C, PRE, PRL-RE, and γ- and β-

interferon responsive elements. There are four

sequences showing 65-70% homology to the

consensus milk box sequence as described by Laird

et al10

. Five mammary gland specific sequences

associated with milk protein genes have been

reported, viz., milk box, Groenen structure, Yu Lee

sequence 1 and 6, and Oka box A16

; three of them are

present in the ovine sequence. The presence of these

mammary gland specific sequences contributes to the

tissue specificity of the promoter (Table 1).

Milk protein gene expression is regulated by a

combination of steroid and polypeptide hormones,

viz., prolactin, insulin, glucocorticoids and

estrogens being the most important positive and

progesterone the main negative regulator of gene

expression17

. The hexanucleotide, TGTYCT is a

part of a number of glucocorticoid receptor binding

sites18

, which is located at -278, -1351 and -1602. A

sequence, ATTTCCGATGT at -116 had shown

homology to rabbit progesterone receptor binding

sequence at -110 19

. A sequence, CTGATTA at -40

showed resemblance to rat prolactin unit20

but is

present in inverted position relative to the

orientation of gene. The sequence, GCCATCTG at

-1421 showed homology to rat insulin unit21

and

TGACATCA at -1748 to human promoter CRE

element22

; they were found in ovine αS1-CSNGP.

These results agree well with experimental data

showing that the expression of milk protein genes is

subject to hormone regulation by glucocorticoids,

progesterone, prolactin and insulin17

. The milk

protein gene expression is also regulated by

mammary tissue specific transcription factors11

.

The other ubiquitous transcription factor binding

sites found in the promoter region include AP 1, AP

2, AP 3, W-element, TTS and possible two types of

enhancer elements found were PEA 3-CS. However,

the ubiquitously expressed Oct 1 transcription factor,

which is involved in the regulation of expression of

many tissue specific and housekeeping genes, was not

found in the ovine αS1-CSNGP23

.

The temporal and tissue-specific expression of milk

protein genes are controlled by a distinct class of co-

operating and antagonistic class of transcription

factors, which are associated with multiple,

sometimes clustered, binding sites. The number and

position of potential binding sites can play a decisive

role in the outcome of these synergistic and

antagonistic interactions. The general theme is that

common consensus sequences are present in all but

their different spatial arrangements exist in the

promoters from different species, which also holds

true for ovine αS1-CSNGP. The promoter with

deletion of tissue specific regulatory sequences and

certain negative regulatory elements can make it

useful for the construction an inducible eukaryotic

Table 2—Hormone-receptor-consensus sequence in ovine αS1-CSNGP

Abbreviation Hormone response element Consensus Position

GRE Glucocorticoid responsive element TGTYCT -1602, -1351, -278

PRE Progesterone responsive element ATTTCCGATGT -116

CRE Cyclic AMP responsive element TGA[TC][GC]TCA -1768

GH-RE1

GH-RE2

Growth hormone unit TAAATTA

AATAAAT

-1333, -216

-1335, -499, -419

PRL Rat prolactin unit, CTGATTA -40

IRE IRE1 factor, rat insulin 1 unit, MAMM system GCCATCTG -1421

BHURE & SHARMA: OVINE α S1 CASEIN GENE PROMOTER

481

expression vector. The computational analysis

showed the presence of mammary gland specific

regulatory elements, which can make ovine αS1-

CSNGP useful for transgenic vector construction.

Acknowledgement

Authors sincerely thank the Director, Indian

Veterinary Research Institute, Izatnagar and Indian

Council of Agricultural Research, New Delhi for

providing the necessary facilities and financial

support during the research work.

References 1 Wilmut I, Archibald A L, McClenaghan, M, Simons J P,

Whitelaw C B et al, Production of pharmaceutical proteins in

milk, Experientia, 47 (1991) 905-912.

2 Houdebine L M, Production of pharmaceutical proteins from

transgenic animals, J Biotechnol, 34 (1994) 269-287.

3 Toman P D, Pieper F, Sakai N, Karatzas C, Platenburg E

et al, Expression of HBsAg gene in transgenic goats under

direction of bovine α-S1 casein control sequence, Transgenic

Res, 8 (1999) 415-427.

4 Tan X H, Cheng X, Zhou J, Chen H X, Un F Y et al, Bovine

α-S1-casein gene sequences direct expression of a variant of

human tissue plasminogen activator in the milk of transgenic

mice, Yi-Chuan-Xue-Bao, 28 (2001) 405-410.

5 Sambrook J & Russel D W, Molecular cloningA

laboratory manual, 3rd edn (Cold Spring Harbor, New York)

2001, 6.4-6.12.

6 Koczan D, Hobom G & Seyfert H M, Genomic organization

of the bovine α-S1-casein gene, Nucleic Acids Res, 19 (1991)

5591-5596.

7 Mercier J C, Gaye P, Soulier S, Hue-Delahaie D & Villotte J

L, Construction and identification of recombinant plasmids

carrying cDNAs coding for ovine αS1-, αS2-, β-, κ-casein

and β-lactoglobulin. Nucleotide sequence of αS1-casein

cDNA, Biochemie, 67 (1985) 959-971.

8 Yu-Lee L Y, Richter-Mann L, Couch C H, Stewart A F,

Mackinlay AG et al, Evolution of the casein multigene

family: Conserved sequences in the 5’-flanking and exon

regions, Nucleic Acids Res, 14 (1986)1883-1902.

9 Hall L, Emery D C, Davies M S, Parker D & Craig R K,

Organization and sequence of human α-lactalbumin gene,

Biochem J, 242 (1987) 735-742.

10 Laird J E, Jack L, Hall L, Boulton A P & Parker D, Structure

and expression of the guinea-pig α-lactalbumin gene,

Biochem J, 254 (1988) 85-94.

11 Groenen M A M, Dijkhof R J, van der Poel J J, van Diggelen

R & Verstege E, Multiple octamer binding sites in the

promoter region of bovine αS2-casein gene, Nucleic Acids

Res, 20 (1992) 4311-4318.

12 Yoshimura M & Oka T, Isolation and structural analysis of

mouse β-casein gene, Gene, 78 (1989) 267-275.

13 Watson C J, Gordon K E, Robertson M & Clark A J,

Interaction of DNA-binding proteins with milk protein gene

promoter in vitro: Identification of mammary gland specific

factor, Nucleic Acids Res, 19 (1991) 6603-6610.

14 Schmitt-Ney M, Doppler W, Ball R K & Groner B, β-Casein

gene promoter activity is regulated by hormone-mediated

relief of transcriptional repression and a mammary gland-

specific nuclear factor, Mol Cell Biol, 7 (1991) 3745-3755.

15 Wakao H, Gouilleux F & Groner B, Mammary gland factor

(MGF) is a novel member of the cytokine regulated

transcription factor gene family and confers the prolactin

response, Eur Mol Biol Organ J, 13 (1994) 2182-2191.

16 Malewski T & Zwierzchowski L, Computer-aided analysis of

potential transcription-factor binding sites in rabbit β-casein

gene promoter, BioSystems, 36 (1995) 109-119.

17 Vonderhaar B K & Ziska S E, Hormonal regulation of milk

protein gene expression, Annu Rev Physiol, 51 (1989)

641-652.

18 Scheidereit C, Geisse S, Westphal H M & Beato M, The

glucocorticoid receptor binds to defined nucleotide

sequences near the promoter of mouse mammary tumor

virus, Nature (Lond), 304 (1983) 749-752.

19 von der Ahe D, Janich S, Sceidereist C, Renkawitz R, Schutz

G et al, Glucocorticoid and progesterone receptors bind to

the same sites in two hormonally regulated promoters,

Nature (Lond), 313 (1985) 706-709.

20 Schuster W A, Treacy M N & Martin F, Tissue specific

trans-acting factor interaction with proximal rat prolactin

gene promoter sequences, EMBO J, 6 (1988) 1721-33.

21 Ohlasson H, Karlsson O & Edlund T, A beta specific protein

binds to two major regulatory sequences of insulin gene

enhancer, PNAS J, 85 (1988) 4228-31.

22 Lichtenheld M G & Podack E R, Structure of human perforin

gene. A simple gene organization with interesting potential

regulatory sequences, J Immunol, 143 (1989) 4267-4274.

23 Zhao F Q, Zheng Y, Dong B & Oka T, Cloning, genomic

organization, expression, and effect on β-casein promoter

activity of a novel isoform of the mouse Oct-1 transcription

factor, Gene, 326 (2004) 175-187.