, revisedM3:00213

Dexamethasone Enhances Osteoclast Formation Synergistically with Transforming Growth

Factor-ß by Stimulating the Priming of Osteoclast Progenitors for Differentiation into

Osteoclasts*

Atsushi Takuma‡§¶, Toshio Kaneda‡†¶, Takuya Sato‡, Setsuo Ninomiya§,

Masayoshi Kumegawa‡, and Yoshiyuki Hakeda‡**

From the ‡Department of Oral Anatomy, Meikai University School of Dentistry, Sakado,

Saitama 350-0283, Japan; §Department of Orthopaedic Surgery, Saitama Medical School,

Moroyama, Saitama 350-0495, Japan; and †Department of Pathophysiology, Faculty of

Pharmaceutical Sciences, Hoshi University, 2-4-41 Ebara, Shinagawa, Tokyo 142-8501, Japan

Running title: Direct Action of Dexamethasone on Osteoclasts

**To whom correspondence should be addressed: Yoshiyuki Hakeda, Ph.D.,

Department of Oral Anatomy, Meikai University School of Dentistry,

Sakado, Saitama 350-0283, Japan.

Tel: +81-492-79-2769;

Fax: +81-492-71-3523;

E-mail: y-hakeda@dent.meikai.ac.jp

1

Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on August 27, 2003 as Manuscript M300213200 by guest on July 1, 2018

http://ww

w.jbc.org/

Dow

nloaded from

SUMMARY

Long-term administration of glucocorticoids (GCs) causes osteoporosis with a rapid and severe

bone loss, and with a slow and prolonged bone disruption. Although the involvement of GCs in

osteoblastic proliferation and differentiation has been extensively studied, their direct action on

osteoclasts is still controversial and not conclusive. In this study, we investigated the direct

participation of GCs in osteoclastogenesis. Dexamethasone (Dex) at <10-8 M stimulated, but at

>10-7 M depressed, receptor activator of NF-κB ligand (RANKL)-induced osteoclast formation

synergistically with transforming growth factor-ß. The stimulatory action of Dex was restricted

to the early phase of osteoclast differentiation and enhanced the priming of osteoclast progenitors

(bone marrow-derived monocytes/macrophages) toward differentiation into cells of the

osteoclast lineage. The osteoclast differentiation depending on RANKL requires the activation of

NF-κB and AP-1, and the DNA binding of these transcription factors to their respective

consensus cis-elements was enhanced by Dex, consistent with the stimulation of

osteoclastogenesis. However, Dex did not affect the RANKL-induced signaling pathways such

as the activation of IKK followed by NF-κB nuclear translocation or the activation of JNK. On

the other hand, Dex significantly decreased the endogenous production of interferon-ß (IFN-ß),

and this cytokine depressed the RANKL-elicited DNA binding of NF-κB and AP-1 as well as

osteoclast formation. Thus, the down-regulation of inhibitory cytokines such as IFN-ß by Dex

may allow the osteoclast progenitors to be freed from the suppression of osteoclastogenesis,

resulting in an increased number of osteoclasts, as is observed in the early phase of GC-induced

osteoporosis.

2

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

INTRODUCTION

Osteoclasts, the cells primarily responsible for bone resorption, are of hemopoietic stem cell

origin. Precursors of osteoclasts have been demonstrated to share common properties with those

of the monocyte/macrophage (M/MØ)1 cell lineage (1, 2). Although many systemic hormones

and local cytokines participate in regulating osteoclast differentiation (3, 4), the receptor activator

of NF-κB (RANK) ligand (RANKL) is the most critical molecule for osteoclastogenesis in

cooperation with macrophage colony-stimulating factor (M-CSF) in the interaction between

stromal cells and cells of the osteoclast lineage (5-7). Extensive studies indicate that the

induction of osteoclast differentiation by RANKL requires the activation of NF-κB and JNK

pathways via tumor necrosis factor (TNF) receptor-associated factor (TRAF) family proteins

from RANK, the RANKL receptor (8-10). We recently demonstrated that the endogenous

production of transforming growth factor (TGF-ß) was also essential for osteoclastogenesis as a

cofactor with RANKL and M-CSF (11). Besides these proteins, a variety of local cytokines

participate in regulating osteoclast differentiation (3, 4), Most of the osteotropic factors

regulating osteoclast differentiation also affect the immune system, suggesting an intimate

relationship between these two systems. These immune mediators such as interleukins, TNF-α,

and interferons (IFNs) can be categorized into different groups based on their stimulatory or

inhibitory effects and their direct or indirect action on osteoclast differentiation (12-16). Others

and we more recently reported that the endogenous production of type-I IFNs such as IFN-ß

induced by RANKL in osteoclast progenitors intrinsically inhibited the differentiation of

osteoclasts (17, 18). Thus, osteoclast differentiation is governed by a delicate balance between

the above stimulatory and inhibitory cytokines.

Glucocorticoids (GCs) have a multitude of effects on the immune response at several sites and

are both anti-inflammatory and immunosuppressive when administered therapeutically (19-21).

Although GCs are effective for the treatment of a wide variety of disorders ranging from

autoimmune diseases to acute situations such as spinal cord injury, long-term therapy with GCs

3

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

causes osteoporosis, resulting in severe bone loss that, at present, has become a big clinical

problem (22-25). GCs decrease calcium absorption in the gastrointestinal system and increase

calcium excretion in the renal system, resulting in a high level of parathyroid hormone (PTH, 26,

27). Therefore, GC-induced osteoporosis has been accepted for a long time to be caused by the

secondary hyperparathyroidism (26). In addition, another possible mechanism for GC-induced

osteoporosis is that GCs decrease gonadotropin production, which may result in increased bone

resorption due to estrogen deficiency (28, 29). Considerable evidence, however, indicates that

elevated levels of PTH or subnormal vitamin D metabolite concentrations are not typical of

patients receiving GC-therapy, and there is no direct evidence indicating that GC-induced

hypogonadism is responsible for the enhanced bone resorption, thus suggesting the existence of

some other mechanism for GC-induced bone loss (30). On the other hand, many in vitro studies

have indicated the direct action of GCs on osteoblasts (31-33). Recent studies show that GC

directly acts on osteoblasts to up-regulate the expression of RANKL and M-CSF and that the

steroid oppositely down-regulates osteoprotegerin (OPG), a decoy receptor of RANKL that

prevents the transmission of the RANKL-signal into cells of the osteoclast lineage (34, 35). This

regulation is likely to be a mechanism for induction of bone resorption by GCs. However, direct

effects of GCs on osteoclasts are controversial and are not conclusive (36-38). The aim of this

study was to evaluate precisely the direct action of GCs on osteoclast differentiation and to

determine the point of GC action in the process of osteoclastogenesis.

In this study, we found that dexamethasone (Dex), at low concentrations (< 10-8 M), enhanced

RANKL-induced osteoclast formation synergistically with TGF-ß by stimulating the priming of

bone marrow-derived M/MØ as osteoclast progenitors for differentiation toward osteoclasts.

Although numerous studies have indicated the negative regulation of NF-κB and AP-1

activation by GCs as anti-inflammatory and immunosuppressive agents (39-42), the

enhancement of osteoclastogenesis was accompanied by the additional activation by Dex of these

transcription factors evoked by RANKL. However, Dex did not influence the signaling pathways

from RANK by which these transcription factors are translocated into nucleus. On the other

4

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

hand, Dex significantly depressed the endogenous production of a type-I IFN, IFN-ß. IFN-ß

potently inhibited osteoclastogenesis, as demonstrated previously (17, 18); and the cytokine

depressed the activation of NF-κB and AP-1 in osteoclast progenitors. Thus, down-regulation

of the inhibitory cytokines such as IFN-ß by Dex may cause release from the suppression of

osteoclastogenesis, thus resulting in an increase in osteoclast number, as is observed in the early

phase of GC-induced bone loss.

EXPERIMENTAL PROCEDURES

Reagents-----Recombinant human M-CSF and recombinant mouse soluble RANKL (sRANKL)

were kindly provided by Morinaga Milk Industry Co. (Tokyo, Japan) and Snow Brand Milk Industry

Co. (Tochigi, Japan), respectively. Recombinant human TGF-ß1 and recombinant mouse IFN-ß were

obtained from Genzyme/Techne (Cambridge, MA) and PBL Biomedical Laboratories (New

Brunswick, NJ), respectively. Recombinant GST-conjugated c-Jun was from BIOMOL Research

Laboratories, Inc., (Plymouth Meeting, PA). Anti-glucocorticoid receptor (GR), anti-NF-κB p50,

anti-NF-κB p65, anti-IκB-α, anti-phospho IκB-α, anti-JNK, anti-c-Jun/AP-1, anti-c-Fos, anti-

STAT-1, anti-STAT-2, and anti-ISGF-3γ antibodies were purchased from Santa Cruz

Biotechnologies, Inc. (San Diego, CA). Anti-phospho NF-κB p65 was from Cell Signaling

Technology, Inc. (Beverly, MA).

Osteoclastogenesis from M/MØ -Like Hemopoietic Cells -----Femora and tibiae were

obtained from 4 - 5-week-old ICR mice (Shizuoka Laboratories Animal Center, Shizuoka,

Japan), and the connective soft tissues were removed from the bones. Bone marrow cells were

flushed out from the bone marrow cavity, suspended in α-MEM (ICN Biomedicals, Aurora, OH)

supplemented with 10% FBS (Intergen, Purchase, NY), M-CSF (100 ng/ml), and 100 U/ml of

penicillin, and cultured in Petri dishes in a humidified atmosphere of 5% CO2. During 3 days in

culture, the cells remaining on the bottom of the dishes consisted of a large population of

5

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

adherent M/MØ-like cells, expressing MØ-specific antigens such as Mac-1 and F4/80 and

exhibiting phagocytotic activity (11), and only a small population of nonadherent cells and

adherent stromal cells. After removal of these nonadherent cells and stromal cells by washing the

dishes with PBS and by subsequent incubation for 5 min in 0.25% trypsin/0.05% EDTA,

respectively, the M/MØ-like hemopoietic cells were harvested in α-MEM/10% FBS by vigorous

pipetting. The isolated M/MØ-like hemopoietic cells were seeded at an initial density of

2.5×104/cm2 and cultured in α-MEM/10% FBS/M-CSF (20 ng/ml) with or without sRANKL (40

ng/ml) and/or other cytokines or agents. The culture medium was exchanged for fresh medium

every 2 days. After a culture period of the desired length, the cells were fixed in 10% formalin

and stained for tartrate-resistant acid phosphatase (TRAP) activity with a leukocyte acid

phosphatase kit (Sigma). The number of TRAP-positive multinucleate cells (MNCs) with more

than 3 nuclei, which were considered to be osteoclastic cells, was counted under a microscope.

Quantification of TRAP by Fluorescence Spectroscopy -----Cellular TRAP activity was

measured by fluorescence spectroscopy as described by Gallwitz et al. (43) with minor

modifications. Isolated M/MØ-like hemopoietic cells were pre-cultured in α-MEM/10%

FBS/M-CSF (20 ng/ml) and/or other cytokines or agents for 2 days, and then further cultured

in the presence of sRANKL (40 ng/ml) under various conditions for 4 days. After the culture

period, the cells were washed with PBS and lysed by 2 cycles of freezing and thawing in 0.05%

Triton X-100. After centrifugation, the supernatant was used for determination of TRAP

activity. The cell lysate was incubated for 30 min at 37 ÚC in a reaction mixture consisting of

0.48 M sodium acetate/0.48 M acetic acid (pH 5.0), 20 mM tartaric acid, and 2 mM

methylumbelliferyl phosphate as a substrate, and then the reaction was terminated by adding

glycine and EDTA (pH 10.5), each for a final concentration of 50 mM. The concentration of

methylumbelliferone produced in the reaction mixture was determined by fluorometry with

excitation at 366 nm and emission at 456 nm. Enzyme activity was expressed as nanomoles of

methylumbelliferyl phosphate hydrolyzed/min/mg protein. The concentration of proteins in the

6

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

cell lysate was measured with a bicinchoninic acid protein assay kit (Pierce Chemical Co.,

Rockford, IL).

Reverse Transcription-Polymerase Chain Reaction (PCR)-----Total RNA (1 µg) extracted

from cultured cells was used as a template for cDNA synthesis. cDNA was prepared by use of a

Superscript II preamplification system (Life Technologies, Gaithersburg, MD). Primers were

synthesized on the basis of the reported mouse cDNA sequences for TRAP, cathepsin K,

calcitonin receptor, integrin αv, integrin ß3, CD14, GR, RANK, TRAF2, TRAF6, c-fos, fra-1,

c-jun, IFN-ß, suppressor of cytokine signaling-1 (SOCS-1), SOCS-3, STAT-1, STAT-2,

IFN-stimulated gene factor (ISGF)-3γ and ß-actin. Sequences of the primers used for PCR were

as follow: TRAP forward, 5’-CACGATGCCAGCGACAAGAG-3’; TRAP reverse, 5’-

TGACCCCGTATGTGGCTAAC-3’; cathepsin K forward, 5’-

GGAAGAAGACTCACCAGAAGC-3’; cathepsin K reverse, 5’-

GTCATATAGCCGCCTCCACAG-3’; calcitonin receptor forward, 5’-

ACCGACGAGCAACGCCTACGC-3’; calcitonin receptor reverse, 5’-

GCCTTCACAGCCTTCAGGTAC-3’;

integrin αv forward, 5-GCCAGCCCATTGAGTTTGATT-3; integrin αv reverse, 5-

GCTACCAGGACCACCGAGAAG-3; integrin ß3 forward, 5-

TTACCCCGTGGACATCTACTA-3; integrin ß3 reverse, 5-

AGTCTTCCATCCAGGGCAATA-3; CD14 forward, 5-AAGTTCCCGACCCTCCAAGTT-3;

CD14 reverse, 5-CTGCCTTTCTTTCCTTACATC-3’; GR forward, 5’-

CGCTCAGTGTTTTCTAATGG-3’; GR reverse, 5’-ATCAGGAGCAAAGCATAGCA-3’;

RANK forward, 5’-CTCTGCGTGCTGCTCGTTCC-3’; RANK reverse, 5’-

TTGTCCCCTGGTGTGCTTCT-3’; TRAF2 forward, 5’-CCGTGAAGTAGAGAGGGTAGC-

3’; TRAF2 reverse, 5’-TTGGACACAGGGCAGAAGAGG-3’; TRAF6 forward, 5’-

AGCCCACGAAAGCCAGAAGAA-3’; TRAF6 reverse, 5’-

CCCTTATGGATTTGATGATGC-3’; c-fos forward, 5’-CATCGGCAGAAGGGGCAAAG-

7

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

3’; c-fos reverse, 5’-GAGAAGGGGCAGGGTGAAGG-3’; fra-1 forward, 5’-

AACCTTGCTCCTCCGCTCACC-3’; fra-1 reverse, 5’-GCTGCTGGCTGTTGATGCTGT-3;

c-jun forward, 5-CTGGCGGCGGTGGTGGCTAC-3; c-jun reverse, 5-

CGGTCTGCGGCTCTTCCTTC-3; IFN-ß forward, 5-CTTCTCCACCACAGCCCTCTC-3;

IFN-ß reverse, 5-CCCACGTCAATCTTTCCTCTT-3; SOCS-1 forward, 5-

AGGATGGTAGCACGCAACCAGGT-3; SOCS-1 reverse, 5-

GATCTGGAAGGGGAAGGAACTCAGGTA-3; SOCS-3 forward, 5-

GCCATGGTCACCCACAGCAAGTT-3; SOCS-3 reverse, 5-

AAGTGGAGCATCATACTGATCCAGGA-3; STAT-1 forward, 5-

CGAAGAGCGACCAAAAACAG-3; STAT-1 reverse, 5-TGCTGGAAGAGGAGGAAGGT-

3; STAT-2 forward, 5-TTTGCTGGGACCTGTGCTCA-3; STAT-2 reverse, 5-

TGGGTTCTCGGGGATGTTCT -3; ISGF-3γ forward, 5-GAACCCTCCCTAACCAACCA-3;

ISGF-3γ reverse, 5-AGGTGAGCAGCAGCGAGTAG-3; and ß-actin forward, 5-

TCACCCACACTGTGCCCATCTAC-3’; ß-actin reverse, 5-

GAGTACTTGCGCTCAGGAGGAGC-3’. Amplification was conducted for 22-32 cycles, each

of 94 ÚC for 30 s, 58 ÚC for 30 s, and 72 ÚC for 1 min in a 25-µl reaction mixture containing

0.5 µl of each cDNA, 25 pmol of each primer, 0.2 mM dNTP, and 1 U of Taq DNA polymerase

(Qiagen, Valencia, CA). After amplification, 15 µl of each reaction mixture was analyzed by

1.5% agarose gel electrophoresis, and the bands were then visualized by ethidium bromide

staining.

Western blot analysis-----After various treatments, the cells were washed with PBS, scraped into a

solution consisting of 10 mM sodium phosphate (pH 7.5), 150 mM NaCl, 1% NP-40, 0.5% sodium

deoxycholate, 0.1% SDS, 1 mM EDTA, 1 mM p-aminoethyl-benzenesulfonyl fluoride (p-ABSF), 10

µg/ml leupeptin, 10 µg/ml pepstatin, and 10 µg/ml aprotinin, and sonicated for 15 s. The samples,

containing equal amounts of protein, were subjected to 10% SDS-polyacrylamide gel electrophoresis

(PAGE); and the proteins separated in the gel were subsequently electrotransferred onto a

8

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

polyvinylidene difluoride membrane. After having been blocked with 5% skim milk, the membrane

was incubated with anti-GR, anti-NF-κB p50, anti-NF-κB p65, anti-phospho NF-κB p65, anti-

IκB-α, or anti-phospho IκB-α antibodies, and subsequently with peroxidase-conjugated anti- mouse or

anti-rabbit IgG antibody. Immunoreactive proteins were visualized with Western blot

chemiluminescence reagents (Amersham Co., Arlington Heights, IL) following the manufacturer’s

instructions.

Assay of JNK activity------M/MØ-like hemopoietic cells were pretreated or not with Dex

and/or TGF-ß in the presence of M-CSF for 2 days prior to treatment with RANKL for 1 h.

After the treatment, the cells were extracted in a lysis buffer consisting of 20 mM Tris-HCl (pH

7.4), 150 mM NaCl, 1mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium

pyrophosphate, 1 mM ß-glycerophosphate, 1mM sodium orthovanadate, 1 µg/ml leupeptin, and 1

mM p-ABSF. The cell lysis was then incubated with anti-JNK antibody (2 µg) at 4 ÚC

overnight, and further incubated with protein A-beads for an additional 3 h. After several

washes, the immunoreacted beads were suspended in a kinase reaction mixture (25 mM Tris-HCl

(pH 7.5), 5 mM ß-glycerophosphate, 2 mM dithiothreitol, 0.1 mM sodium orhtovanadate, 10

mM MgCl2) supplemented with 100 µM [γ-32P]ATP (5 µCi) and 1 µg of recombinant GST-c-

Jun, and incubated at 30ÚC for 30 min. The reaction was terminated by adding SDS sample

buffer, and the mixture was then boiled. After the samples had been subjected to SDS-PAGE

(12% gel), the phosphorylated GST-c-Jun in the gel was visualized by autoradiography at 80

ÚC.

Electrophoretic mobility shift assay (EMSA)-------After pretreatment or not with Dex and/or

TGF-ß in the presence of M-CSF for 2 days, the cells were treated with sRANKL for 1 h, then

washed twice with ice-cold PBS, incubated for 10 min on ice in 1 ml of ice-cold buffer A (10

mM Hepes (pH 7.4), 10 mM KCl, 0.1 mM EDTA, 0.1% NP-40, 1 mM DTT, 1 mM p-ABSF, 2

µg/ml aprotinin, 2 µg/ml pepstatin, 2 µg/ml leupeptin), and scraped into the buffer. The cell

9

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

lysates were incubated further for 10 min on ice and then transferred to tubes. The nuclei

obtained by centrifugation for 1 min at 5000 X g were extracted by a 30-min incubation in ice-

cold buffer C, consisting of 50 mM Hepes (pH 7.5), 420 mM KCl, 0.1 mM EDTA, 5 mM MgCl2,

20 % glycerol, 1 mM DTT, 1 mM p-ABSF, 2 µg/ml aprotinin, 2 µg/ml pepstatin, and 2 µg/ml

leupeptin. Then, the extracts were centrifuged at 14,000 X g for 30 min, and the supernatants

were used for the EMSA. Double-stranded oligonucleotides containing an NF-κB binding site

(5-AGTTGAGGGGACTTTCCCAGGC-3), an AP-1 binding site (5-

CGCTTGATGAGTCAGGAA-3) or an IFN-stimulated response element (ISRE, 5-

GATCCATGCCTCGGGAAAGGGAAACCGAAACTGAAGCC-3, element underlined (44))

were end-radiolabeled with [γ-32P] ATP by using T4 polynucleotide kinase (Promega, Madison,

WI) according to the manufacturer’s instruction, and combined and incubated for 30 min at room

temperature with 1 µg of nuclear extract in binding buffer (10 mM Tris-HCl (pH 7.5), 4%

glycerol, 50 mM NaCl, 1 mM MgCl2, 0.5 mM EDTA, and 0.5 mM dithiothreitol). The

specificity of the reaction was confirmed by competition with a 50-fold molar excess of

nonlabeled oligonucleotides. The protein-DNA complexes were resolved by PAGE in 0.5 X

TBE buffer and visualized by autoradiography. In addition, other nuclear extracts were incubated

with anti-NF-κB p50, anti-NF-κB p65, anti-c-Jun/AP-1, anti-c-Fos, anti-STAT-1, anti-

STAT-2, or anti-ISFG-3γ antibodies for 30 min on ice after binding to the oligonucleotides, and

then were subjected to PAGE.

Densitometry------Intensity of bands obtained from RT-PCR, JNK activity, and EMSA

analyses was quantified by densitometry with an image analyzer (B. I. Systems Corp., Ann

Arbor, MI).

Statistical Analysis------Means of groups were compared by ANOVA, and significance of

differences was determined by post-hoc testing using Bonferroni’s method.

10

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

RESULTS

Dexamethasone Stimulates Osteoclastogenesis from Bone Marrow M/MØ Cells----When bone

marrow-derived M/MØ were incubated with M-CSF and sRANKL, and particularly when

TGF-ß was also present, most of the cells differentiated into cells of the osteoclast lineage and

became mature osteoclasts, as described previously (11). The addition of exogenous Dex

increased the number of osteoclastic TRAP-positive MNCs formed in these cultures in the

presence of TGF-ß in a Dex dose-related manner, with the maximal increase at 10-9-10-8 M

(Fig. 1A); whereas the total number of nuclei was not changed (data not shown). However, at a

higher concentration of 10-7 M, Dex completely depressed the osteoclast formation. Thus, Dex

revealed biphasic effects on osteoclastogenesis, one being stimulatory at lower concentrations

(<10-8 M) and the other, inhibitory at higher doses (>10-7 M). A time-course experiment showed

that Dex accelerated the osteoclast formation from osteoclast progenitors in the both presence and

absence of TGF-ß (Fig. 1B). As shown in Fig. 1C-1F, when the M/MØ cells were treated for 4

days with Dex at 10-9 M in the presence of sRANKL, M-CSF, and TGF-ß, TRAP-positive

MNCs were fully generated in the culture dish. In the absence of TGF-ß, Dex also enhanced the

formation of osteoclastic TRAP-positive MNCs, but the stimulation was much less than in the

presence of TGF-ß. We next examined the effect of Dex at a stimulatory dose on mRNA levels

of TRAP, cathepsin K, calcitonin receptor, and integrin αv and ß3 in the cultures of osteoclast

progenitors, all of which molecules are abundantly expressed in osteoclasts (Fig. 2A). On day 2

after the addition of sRANKL in combination with TGF-ß and Dex in the presence of M-CSF,

although formation of osteoclastic TRAP-positive MNCs had not yet occurred, as was shown in

Fig. 1B, this combination slightly increased the mRNA level of TRAP and integrin αv. On day

4, at which time osteoclastic MNCs had fully formed in the cultures, Dex stimulated the mRNA

levels of the above molecules additively or synergistically with TGF-ß in parallel with the degree

of osteoclast formation. On the other hand, the mRNA level of CD14, a marker molecule of

macrophage differentiation, was inversely decreased with the progression of osteoclast

11

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

differentiation. These above results were supported by the fact that the cells of the osteoclast

lineage expressed glucocorticoid receptors (Fig. 2B).

Dexamethasone with TGF-ß Enhances the Priming of Osteoclast Progenitors toward

Differentiation into Osteoclasts-----To determine at what stage of osteoclast differentiation

Dex acts to stimulate osteoclastogenesis, we incubated M/MØ cells with Dex on days 0-2, 2-4 or

for the entire 4 days of the culture in the presence of sRANKL, M-CSF, and TGF-ß (Fig. 3A).

When the osteoclast progenitors were exposed to Dex for the entire 4 days, the osteoclast

formation was significantly increased compared with that in the cultures without Dex. In

addition, the Dex-exposure for 0-2 days resulted in osteoclast formation to the same extent as

that in the cultures treated with Dex for the entire 4 days. However, when the cells were treated

only for the last 2 days with Dex, the stimulation of osteoclast formation was not observed,

suggesting that Dex acts on osteoclast progenitors at the early stage in the process of osteoclast

differentiation.

In addition, when the isolated progenitors were pretreated only with M-CSF prior to treatment

with M-CSF or the combination of M-CSF and TGF-ß, or M-CSF, TGF-ß, and Dex in the

presence of sRANKL, the TRAP activity of the cells induced by sRANKL was stimulated by

TGF-ß, and further enhanced by the combination of TGF-ß and Dex (Fig. 3B, the first group

including 4 bars starting at the left). However, the pretreatment with M-CSF and TGF-ß caused

the equivalent increase in the activity even in the absence TGF-ß during the last 4-day treatment

with sRANKL, suggesting the TGF-ß-stimulated priming of the osteoclast progenitors toward

differentiation into osteoclasts as described before (ref. 11; Fig. 3B, the second group of bars

from the left) . In addition, pretreatment with M-CSF, TGF-ß, and Dex resulted in the further

enhancement of the activities compared with those induced by pretreatment with M-CSF and

TGF-ß (Fig. 3B, the fourth group from the left). However, with Dex alone in the presence of M-

CSF during the pretreatment, such those stimulations were less (Fig. 3B, the third group from the

left). These obtained results indicate that Dex acts synergistically with TGF-ß to enhance the

12

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

priming of osteoclast progenitors toward osteoclastic differentiation in the early stage of

osteoclast differentiation.

Dexamethasone Stimulates Activation of NF-κB and AP-1 in Osteoclast Progenitors

Synergistically with TGF-ß-----Activation of NF-κB and AP-1 has been indicated to be

required for osteoclastogenesis induced by sRANKL (8-10). Thus, we next examined how Dex

is involved in the activation of these transcription factors . We found that Dex up to 10-8 M in

the both presence and absence of TGF-ß stimulated the sRANKL-evoked binding of nuclear

proteins in osteoclast progenitors to oligonucleotide sequences containing the NF-κB or AP-1

binding site in a dose-related manner and that the stimulation was synergistic with TGF-ß (Fig.

4). When the probes and the nuclear extracts were incubated with anti- NF-κB p50 or anti-NF-

κB p65 antibodies, or with anti-c-Jun or c-Fos antibodies, the complex was further shifted to a

slower mobility or its labeling intensity was decreased in the gel (Fig. 4). However, the

stimulation of the binding decreased at 10-7 M. These dose-dependent and synergistic effects of

Dex are consistent with those seen on osteoclast formation, suggesting a positive linkage between

Dex-induced activation of NF-κB and AP-1 and accelerated osteoclastogenesis.

Dexamethasone Does Not Affect the Signaling Pathway of the RANKL/RANK System up to the

Translocation of NF-κB and AP-1 into the Nucleus-----The above results suggest a possible

up-regulation by Dex of signalings from the association of RANKL and RANK up to the nuclear

translocation of NF-κB and AP-1. Therefore, we first examined the effect of Dex on the

expression of molecules related to the RANK-signaling pathway such as RANK, TRAF2,

TRAF6, c-Fos, Fra-1, and c-Jun. At the time (day 0) of isolating osteoclast progenitors after a

3-day preculture in M-CSF at a high concentration (100 ng/ml), the mRNAs of RANK, TRAF2,

and TRAF6 were already expressed, and the levels of these mRNAs were not changed by the 2

days- treatments with the combination of Dex and TGF-ß in the presence of M-CSF (data not

shown). On the other hand, the constitutive expression of c-fos mRNA in osteoclast progenitors

13

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

was suppressed by the treatment with the combination of Dex and TGF-ß to 15% of the level in

the cultures treated only with M-CSF (Fig. 5A), the effect inconsistent with the up-regulation of

RANKL-induced AP-1 binding to its cis-element by Dex and/or TGF-ß. However, the levels of

fra-1 and c-jun mRNA were not altered by Dex and/or TGF-ß.

We next examined the influence of Dex on the activation of NF-κB by RANKL in the cytosol

of osteoclast progenitors. The level of phosphorylated IκB-α, the degradation of IκB-α, and the

phosphorylation rate of NF-κB evoked by sRANKL were not changed by the pretreatment with

Dex and/or TGF-ß (data not shown). In addition, the combination of Dex and TGF-ß altered

neither the level of NF-κB p50 and p65 proteins expressed in osteoclast progenitors (data not

shown) nor the level of these transcription factors that had been translocated to the nucleus (Fig.

5B). On the other hand, activation of JNK kinase activity elicited by sRANKL was slightly

decreased by the pretreatment with Dex and/or TGF-ß (Fig. 5C), consistent with the decrease in

the constitutive expression of c-fos mRNA (Fig. 5A). These findings indicate that although the

combination of Dex and TGF-ß synergistically stimulated the DNA binding of NF-κB and AP-

1 to their binding consensus oligonucleotide sequences, resulting in stimulation of osteoclast

formation, this combination did not impact the signaling pathway of the RANKL/RANK system

up to the nuclear translocation of NF-κB, but rather depressed the activation of AP-1, suggesting

some other mechanism for the stimulation of the DNA binding of these transcription factors and

of osteoclastogenesis.

Dexamethasone Suppresses Expression of Inhibitory Cytokine IFN-ß in Osteoclast Progenitors-

----Other investigators and we recently demonstrated the inhibitory action of endogenous

production of type-I IFNs such as IFN-ß on osteoclast differentiation (17, 18). Thus, we

suspected that the endogenous expression of IFN-ß in osteoclast progenitors might be involved

in the stimulation of osteoclastogenesis and the activation of the DNA binding of NF-κB and

AP-1. Therefore, we examined the effect of Dex and/or TGF-ß on the expression of IFN-ß

mRNA in osteoclast progenitors. Dex or TGF-ß strongly decreased the amount of IFN-ß mRNA

14

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

expressed in the cells, and the combination of these factors further reduced the level (Fig. 6A);

whereas the mRNA levels of SOCS-1 and 3, signaling suppressors of IFNs, and those of STAT-

1, STAT-2 and ISGF-3γ, were not altered (data not shown), suggesting that the signaling of

IFN-ß in the osteoclast progenitors was decreased by the action of Dex and/or TGF-ß. In fact,

when osteoclast progenitors were incubated with Dex and/or TGF-ß without adding exogenous

IFN-ß, the constitutive binding activity of ISGF-3, composed of STAT-1, STAT-2, and ISGF-

3γ (determined by a supershift experiment), to oligonucleotides containing IRSE was attenuated

by the treatment with these factors alone or in combination (Fig. 6B). In addition, when

osteoclast progenitors in the presence of M-CSF, TGF-ß, and Dex, under which conditions the

endogenous production of IFN-ß was less, were exposed to exogenous IFN-ß, the DNA binding

activity of NF-κB evoked by sRANKL was depressed by the exposure in a time-dependent

manner (Fig. 6C). Binding activity of AP-1 was also significantly reduced by the exposure to

exogenous IFN-ß. These results indicate that Dex and/or TGF-ß down-regulates the

endogenous production of IFN-ß, thereby releasing the cells from the differentiation-inhibiting

action of inhibitory cytokines such as IFN-ß.

DISCUSSION

In this study, we demonstrated that Dex at <10-8 M enhanced, but at >10-7 M depressed,

RANKL-induced osteoclast formation synergistically with TGF-ß by acting at the early stage of

osteoclast differentiation when bone marrow-derived osteoclast progenitors are primed toward

osteoclasts. Consistent with the enhancement of osteoclastogenesis, Dex with TGF-ß

additionally stimulated DNA binding of NF-κB and AP-1 elicited by sRANKL to consensus

oligonucleotide sequence containing their respective binding sites. However, Dex did not activate

the signaling pathways from the RANKL/RANK association to the activation of JNK or the

nuclear translocation of NF-κB. On the other hand, Dex significantly decreased the endogenous

production of IFN-ß, which depressed the DNA binding of NF-κB and AP-1 in osteoclast

15

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

progenitors as well as osteoclastogenesis, as we had reported previously (17); thereby the

osteoclast differentiation could progressively proceed, resulting in an increased number of

osteoclasts, as is observed in the early phase of GC-induced bone loss.

With GC treatment for various diseases, the loss of bone is biphasic with a rapid initial phase of

approximately 12 % during the first few months, followed by a slow phase of about 2-5% per

year (25). Consequently, the GC-induced bone loss is categorized as a low turnover type of

osteoporosis that is defined by impaired recruitment and function of osteoblasts and osteoclasts.

The inhibition of osteoblastogenesis and the apoptosis of osteoblasts and osteocytes induced by

GC are currently considered to be the primary cause for the bone loss (33, 36, 45, 46). However,

the involvement of osteoclasts in the early phase of great bone loss has not satisfactorily been

elucidated and is still controversial, as inhibitory (38, 47) and stimulatory (36, 37) effects of GC

on osteoclastic differentiation and bone-resorbing activity have been reported. Weinstein et al.

(48) recently demonstrated that Dex decreased the number of osteoclast progenitors in bone

marrow, but showed, inversely, that the total number of osteoclasts on the bone surface was

increased by the promotion of osteoclast survival by Dex via the prevention of their apoptosis.

However, many in vitro studies using cultures of bone marrow cells, in which osteoclast

differentiation-supporting stromal or osteoblastic cells were present, showed the enhancement of

osteoclast formation by GCs in the presence of osteotropic factors such as 1,25-

dihydroxyvitamin D3 (36, 49), the stimulatory effect being consistent with our findings presented

here. In our culture system, however, the stimulation occurred even in the absence of the

osteoclast-supporting cells such as osteoblasts. In addition, Dex has been demonstrated in

cultures of human and murine osteoblasts to increase the expression of RANKL and M-CSF,

which are essential for osteoclastogenesis, and to decrease the production of OPG, which is a

decoy receptor of RANK that interferes with RANKL/RANK signalings (34, 35, 50, 51). This

indirect action of GC via osteoblastic cells is one of the mechanisms for GC-induced

osteoclastogenesis. In the present study, we demonstrated the biphasic effects of Dex on

osteoclastogenesis. It should be particularly noted that Dex at lower concentrations directly

16

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

enhanced the osteoclast formation and that the action was restricted to the early stage of the

osteoclast differentiation when the priming for the osteoclast phenotype occurs. This restricted

action is consistent with earlier results indicating the stimulatory effect of Dex on osteoclast

formation in cultures of human monocytes (52). However, Dex did not affect the late stage of

osteoclast differentiation and, furthermore, did not prevent the apoptotic death of the formed

osteoclastic MNCs (data not shown), as was previously demonstrated by others (48). Taken

together, the available data indicate that the action of Dex depends on the dose, the

microenvironment of bone (e.g., composition of cell components), and the cell differentiation

stage. However, Dex intrinsically stimulates osteoclastogenesis, resulting in a temporary increase

in osteoclast number and bone resorption during GC-treatment, until the proliferation and

function of osteoblastic cells are fully down-regulated by Dex and subsequently the signals

controlling osteoclastogenesis through osteoblasts are no longer generated.

From numerous studies elucidating the mechanisms for anti-inflammatory and anti-

proliferative effects of GCs on the immune system, the antagonism between GC receptor (GR)

and pro-inflammatory transcription factors such as NF-κB and AP-1 has been extensively

demonstrated for inhibition of the expression of pro-inflammatory cytokines dependent on the

activation of NF-κB and AP-1 (39-42, 53). This inhibition by GCs is exerted by blockade of

the transactivation of genes through NF-κB and AP-1 (54). The blockade by Dex is currently

viewed as being due to the following possible mechanisms: The first is GC-activated GR binding

of NF-κB or AP-1, forming a GR/transcription factor complex that does not bind to DNA (54,

55). In the second one the ligand-activated GR does not bind to DNA, but associates with the

transcription factor bound at its DNA binding site, leading to inhibition of down-stream

transcriptional activities (56, 57). The third mechanism states that GC-activated GR, by binding

to nuclear coactivators such as CBP, competes with the transcription factors for the nuclear

coactivators, thereby breaking the link between the transcription factors and the pre-initiation

complex with DNA polymerase II (58, 59). However, in this study we demonstrated the up-

regulation by Dex (at lower concentrations) of NF-κB and AP-1 binding to their DNA binding

17

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

site sequences evoked by RANKL. To our knowledge, this is the first report indicating the

agonism between GC and these inflammatory transcription factors. However, we observed that

the GR did not form a complex with NF-κB and AP-1 in the nuclei of osteoclast progenitors, as

judged from the data of EMSA supershift experiments with anti-GR antibody (data not shown),

thus suggesting a GR-independent mechanism. In addition, Dex did not affect the signaling

cascade transduced from RANKL/RANK such as the IKK activation followed by the nuclear

translocation of NF-κB, but rather slightly decreased the JNK activation, in the osteoclast

progenitors. These results suggest some other possible mechanism for the stimulation of the

DNA-binding activity of these transcription factors.

The inhibition of osteoclastogenesis by type-I IFN was recently reported by our group and

others (17, 18). Takayanagi et al. (18) showed that the production of this cytokine induced by

RANKL was dependent on c-Fos. However, as shown in this study, even in the absence of

RANKL-signaling, the osteoclast progenitors constitutively expressed IFN-ß; and the decreased

expression of this cytokine caused by Dex and/or TGF-ß paralleled the reduced expression of the

constitutive c-Fos. We also found that exogenous IFN-ß abrogated the enhancement of DNA-

binding activity of NF-κB and AP-1 caused by the combination of Dex and TGF-ß.

Furthermore, the constitutive expression of SOCSs, suppressors of IFN-signaling, was not

affected by Dex and/or TGF-ß, implying that the negative signaling by IFN-ß for

osteoclastogenesis is negated by the reduced expression of this cytokine. Such a down-regulation

of type-I IFN expression by GCs has been demonstrated in cultures of human fibroblasts amd

peripheral blood mononuclear cells (60, 61), and GCs has more recently been reported to inhibit

IFN-γ signaling mainly due to the decreased STAT-1 expression in macrophages dependent on

lymphocytes coexisting in peripheral blood mononuclear cells (62). In addition, similar to GC-

induced osteoporosis, mice deficient in one of the IFN-α/ß receptor components (IFNAR1-/-

mice) exhibit severe osteopenia resulting from loss of bone mass accompanied by enhanced

osteoclastogenesis even without any inflammatory stimuli (18). Taken together, these results

indicate that the down-regulation of the IFN-ß expression by Dex and/ or TGF-ß is yet another

18

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

mechanism for the Dex-enhanced osteoclast formation. However, accumulating evidence has

indicated a positive transcriptional synergy between NF-κB and JAK/STAT in mediating IFN-

signaling in a variety of cells (63-65). Our findings presented here cannot account for such a

positive interaction between these transcription factors, and the precise mechanism at the

molecular level remains to be clarified.

In conclusion, although Dex did not affect the nuclear translocation of NF-κB or the activation

of JNK induced by RANKL, the steroid in collaboration with TGF-ß enhanced the DNA-

binding activities of these transcription factors, and subsequently accelerated the formation of

osteoclasts. The stimulation by Dex of osteoclastogenesis is at least associated with the down-

regulation of production of IFN-ß, allowing osteoclast progenitors to be freed from the

differentiation-depressing effect of this inhibitory cytokine and to proceed toward the phenotype

of mature osteoclasts. Our present results provide a novel cellular mechanism for rapid and

severe bone loss observed at the early phase of GC-induced osteoporosis caused by long-term

therapy of GCs.

Acknowledgment----We thank Drs. K. Yamaguchi (Snow Brand Milk Industry Co.) and M.

Yamada (Morinaga Milk Industry Co.) for their generous gifts of recombinant sRANKL and

recombinant M-CSF, respectively.

19

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

REFERENCES

1. Felix, R., Cecchini, M. G., Hofstetter, W., Elford, P. R., Stutzer, A., and Fleisch, H. (1990) J. Bone

Miner. Res. 5, 781-789

2. Kodama, H., Yamasaki, A., Nose, M., Niida, S., Ohgame, Y., Abe, M., Kumegawa, M., and T.

Suda. (1991) J. Exp. Med. 173, 269-272

3. Chambers, T. J. (1985) J. Clin. Pathol. 38, 241-252

4. Suda, T., Udagawa, N., Nakamura, I., Miyaura, C., and Takahashi, N. (1995) Bone 17, 87S-

91S

5. Lacey, D. L., Timms, E., Tan, H. L., Kelley, M. J., Dunstan, C. R., Burgess, T., Elliott, R.,

Colombero, A., Elliott, G., Scully, S., Hsu, H., Sullivan, J., Hawkins, N., Davy, E., Capparelli, C.,

Eli, A., Qian, Y. X., Kaufman, S., Sarosi, I., Shalhoub, V., Senaldi, G., Guo, J., Delaney, J., and

Boyle, W. J. (1998) Cell 93, 165-176

6. Yasuda, H., Shima, N., Nakagawa, N., Yamaguchi, K., Kinosaki, M., Mochizuki, S., Tomoyasu, A.,

Yano, K., Goto, M., Murakami, A., Tsuda, E., Morinaga, T., Higashio, Udagawa, N., Takahashi,

N., and Suda, T. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 3597-3602

7. Kong, Y. Y., Yoshida, H., Sarosi, I., Tan, H. L., Timms, E., Capparelli, C., Morony, S.,

Oliveira-dos-Santos, A. J., Van, G., Itie, A., Khoo, W., Wakeham, A., Dunstan, C. R.,

Lacey, D. L., Mak, T. W., Boyle, W. J., and Penninger, J. M. (1999) Nature 397, 315 –323

8. Darnay, B. G., Haridas, V., Ni, J., Moore, P. A., and Aggarwal, B. B. (1998) J. Biol. Chem.

273, 20551-20555.

9. Ye, H., Arron, J. R., Lamothe, B., Cirilli, M., Kobayashi, T., Shevde, N. K., Segal, D.,

Dzivenu, O. K., Vologodskaia, M., Yim, M., Du, K., Singh, S., Pike, J. W., Darnay, B. G.,

Choi, Y., and Wu, H. (2002) Nature 418, 443-447

10. Armstrong, A.P., Tometsko, M.E., Glaccum, M., Sutherland, C.L., Cosman, D., and Dougall,

W.C. (2002) J. Biol. Chem. 277, 44347-44356

11. Kaneda, T., Nojima, T., Nakagawa, M., Ogasawara, A., Kaneko, H., Sato, T., Mano, H.,

Kumegawa, M., and Hakeda, Y. (2000) J. Immunol. 165, 4254-4263

20

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

12. Palmqvist, P., Persson, E., Conaway, H. H., and Lerner, U.H. (2002) J. Immunol. 169, 3353-

3362

13. Martin, T. J., Romas, E., and Gillespie, M. T. (1998) Crit. Rev. Eukaryot. Gene Expr. 8, 107-

123

14. Suda, T., Takahashi, N., Udagawa, N., Jimi, E., Gillespie, M.T., and Martin, T. J. (1999)

Endocr. Rev. 20, 345-357

15. Kitazawa R, Kimble RB, Vannice JL, Kung VT, and Pacifici R. (1994) J. Clin. Invest. 94,

2397-2406

16. Horowitz, M.C., Xi, Y., Wilson, K., and Kacena, M.A. (2001) Cytokine Growth Factor Rev.

12, 9-18

17. Hayashi, T., Kaneda, T,. Toyama, Y., Kumegawa, M., and Hakeda, Y. (2002) J. Biol. Chem.

277, 27880-27886

18. Takayanagi, H., Kim, S., Matsuo, K., Suzuki, H., Suzuki, T., Sato, K., Yokochi, T., Oda, H.,

Nakamura, K., Ida, N., Wagner, E. F., and Taniguchi, T. (2002) Nature 416, 744-749

19. Pitzalis, C., Pipitone, N., and Perretti, M. (2002) Ann. N. Y. Acad. Sci. 966, 108-118

20. Langenegger, T., and Michel, B. A. (1999) Clin. Orthop. 366, 22-30

21. Riccardi, C., Zollo, O., Nocentini, G., Bruscoli, S., Bartoli , A., D’Adamio, F., Cannarile, L.,

Delfino, D., Ayroldi, E., and Migliorati, G. (2000)Therapie 55, 165-169

22. Canalis, E., and Delany, A. M. (2002) Ann. N. Y. Acad. Sci. 966, 73-81

23. Weinstein, R. S. (2001) Rev. Endocr. Metab. Disord. 2, 65-73

24. Patschan, D., Loddenkemper, K., and Buttgereit, F. (2001) Bone 29, 498-505

25. Manolagas, S. C., and Weinstein, R. S. (1999) J. Bone Miner. Res. 14, 1061-1066

26. Bikle, D. D., Halloran, B., Fong, L., Steinbach, L., and Shellito, J. (1993) J. Clin. Endocrinol.

Metab. 76, 456-461

27. Klein, R. G, Arnaud, S. B., Gallagher, J. C., Deluca, H. F., and Riggs, B. L. (1977) J. Clin.

Invest. 60, 253-259

28. Michael, A. E., and Cooke, B. A. (1994) Mol. Cell Endocrinol. 100, 55-63

21

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

29. Jilka, R. L., Hangoc, G., Girasole, G., Passeri, G., Williams, D. C., Abrams, J. S., Boyce, B.,

Broxmeyer, H., and Manolagas, S. C. (1992) Science 257, 88-91

30. Paz-Pacheco, E., Fuleihan, G. E., and LeBoff, M. S. (1995) J. Bone Miner. Res. 10, 1713-

1718

31. Chyun, Y. S, Kream, B. E, and Raisz, L. G. (1984) Endocrinology 114, 477-480

32. Smith, E., Coetzee, G. A., and Frenkel, B. (2002) J. Biol. Chem. 277, 18191-18197

33. Weinstein, R. S., Jilka, R. L., Parfitt, A. M., and Manolagas, S. C. (1998) J. Clin. Invest. 102,

274-282

34. Hofbauer, L. C., Gori, F., Riggs, B. L., Lacey, D. L., Dunstan, C. R., Spelsberg, T. C., and

Khosla, S. (1999) Endocrinology 140, 4382-4389

35. Rubin, J., Biskobing, D. M., Jadhav, L., Fan, D., Nanes, M. S., Perkins, S., and Fan, X.

(1998) Endocrinology 139, 1006-1012

36. Shuto, T., Kukita, T., Hirata, M., Jimi, E., and Koga, T. (1994) Endocrinology 134, 1121-

1126

37. Kaji, H., Sugimoto, T., Kanatani, M., Nishiyama, K., and Chihara, K. (1997) J. Bone Miner.

Res. 12, 734-741

38. Tobias, J., and Chambers, T. J. (1989) Endocrinology 125, 1290-1295

39. Adcock, I.M., and Caramori, G. (2001) Immunol. Cell. Biol. 79, 376-84

40. Jenkins, B. D., Pullen, C. B., and Darimont, B. D. (2001) Trends Endocrinol. Metab. 12, 122-

126

41. Wissink, S., van Heerde, E.C., vand der Burg, B., and van der Saag, P. T. (1998) Mol.

Endocrinol. 12, 355-363

42. McKay, L. I., and Cidlowski, J. A. (1999) Endocr. Rev. 20, 435-59

43. Gallwitz, W. E., Mundy, G. R., Lee, C. H., Qiao, M., Roodman, G. D., Raftery, M., Gaskell,

S. J., and Bonewald, L. F. (1993) J. Biol. Chem. 268, 10087-10094

44. Petricoin, E. 3rd, David, M., Igarashi, K., Benjamin, C., Ling, L., Goelz, S., Finbloom, D. S.,

and Larner, A. C. (1996) Mol. Cell. Biol. 16, 1419-1424

22

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

45. Weinstein, R. S., Nicholas, R. W., and Manolagas, S. C. (2000) J. Clin. Endocrinol. Metab.

85, 2907-2912

46. Eberhardt, A. W., Yeager-Jones, A., and Blair, H. C. (2001) Endocrinology 142, 1333-1340

47. Dempster, D. W., Moonga, B. S., Stein, L. S., Horbert, W. R., and Antakly, T. (1997) J.

Endocrinol. 154, 397-406

48. Weinstein, R.S., Chen, J.R., Powers, C.C., Stewart, S.A., Landes, R.D., Bellido, T., Jilka,

R.L., Parfitt, A.M., and Manolagas, S.C. (2002) J. Clin. Invest. 109, 1041-1048

49. Udagawa, N., Takahashi, N., Akatsu, T., Sasaki, T., Yamaguchi, A., Kodama, H., Martin, T.

J., and Suda, T. (1989) Endocrinology 125, 1805-1813

50. Kitazawa, R., Kitazawa, S., and Maeda, S. (1999 ) Biochim. Biophys. Acta 1445, 134-141

51. Vidal, N. O., Brandstrom, H., Jonsson, K. B., and Ohlsson, C. (1998) J. Endocrinol. 159,

191-195

52. Hirayama, T., Sabokbar, A., and Athanasou, N. A. (2002) J. Endocrinol. 175, 155-163

53. Almawi, W. Y., and Melemedjian, O.K. (2002) J. Mol. Endocrinol. 28, 69-78

54. De Bosscher, K., Schmitz, M. L., Vanden Berghe, W., Plaisance, S., Fiers, W., and

Haegeman, G. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 13504-13509

55. De Bosscher, K., Vanden Berghe, and W., Haegeman, G. (2000) J. Neuroimmunol. 109, 16-

22

56. Nissen, R. M., and Yamamoto, K. R. (2000) Genes Dev. 14, 2314-2329

57. De Bosscher, K., Vanden Berghe, W., Vermeulen, L., Plaisance, S., Boone, E., and

Haegeman, G. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 3919-3924

58. Sheppard, K. A., Phelps, K. M., Williams, A. J., Thanos, D., Glass, C. K., Rosenfeld, M. G.,

Gerritsen, M. E., and Collins, T. (1998) J. Biol. Chem. 273, 29291-29294

59. McKay, L. I., and Cidlowski, J. A. (2000) Mol. Endocrinol. 14, 1222-1234

60. Gessani, S., McCandless, S., and Baglioni, C. (1988) J. Biol. Chem. 263, 7454-7457

61. Reissland, P., and Wandinger, K. P. (1999) Immunobiology 200, 227-233

62. Hu, X., Li, W. P., Meng, C., and Ivashkiv, L. B. (2003) J Immunol. 170, 4833-4839

23

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

63. Ohmori, Y., Schreiber, R. D., and Hamilton, T. A. (1997) J. Biol. Chem. 272, 14899-14907

64. Pine, R. (1997) Nucleic Acids Res. 25, 4346-4354

65. Nguyen, V. T., and Benveniste, E. N. (2002) J. Biol. Chem. 277, 13796-13803

24

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

FOOTNOTES

*This work was supported by a grant-in-aid for scientific research (No. 15591946) from the

Japanese Ministry of Education, Science, Sports, and Culture.

¶Both authors contributed equally to this work.

1The abbreviations used are: M/MØ, monocyte/macrophage; RANK, receptor activator of NF-

κB; RANKL, RANK ligand; M-CSF, macrophage colony-stimulating factor; TGF-ß, transforming

growth factor-ß; IFN, interferon; GC, glucocorticoid; PTH, parathyroid hormone; Dex,

dexamethasone; TRAP, tartrate-resistant acid phosphatase; MNCs, multinucleate cells; SOCS,

suppressor of cytokine signaling; ISRE, interferon-stimulated response element; JAK, Janus

kinases; STAT, signal transducers and activators of transcription; ISGF-3, IFN-stimulated gene

factor-3; PBS, phosphate-buffered saline.

25

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

FIGURE LEGENDS

FIG. 1. Stimulatory effect of exogenous Dex on formation of osteoclasts from their precursors.

A, osteoclast progenitors (M/MØ cells) were isolated after 3-day treatment of bone marrow cells

with M-CSF (100 ng/ml), and the isolated M/MØ (2 x 104 cells/each well of 48-well plate) were

then cultured with various concentrations of Dex in the presence of M-CSF (20 ng/ml) and

sRANKL (40 ng/ml) for 5 days (open circles), or in the presence of M-CSF (20 ng/ml),

sRANKL (40 ng/ml), and TGF-ß1 (2 ng/ml) for 4 days (closed circles). B, isolated M/MØ cells

were incubated with (closed symbols) or without (open symbols) Dex (10-9 M) in the presence

of M-CSF and sRANKL (triangles) or M-CSF, sRANKL, and TGF-ß (circles) for the indicated

times. At the end of the culture period, the cells were stained for TRAP activity, and number of

TRAP-positive MNCs per well was counted. The experiments were performed 4 times, and the

reproducibility was confirmed. Values are the means + SE for 4 cultures in a representative

experiment. C-F, photomicrographs of the TRAP-stained cells in cultures. The isolated M/MØ

cells were incubated with (E and F) or without (C and D) Dex (10-9 M) in the presence of M-

CSF and sRANKL (C and E) for 5 days or M-CSF, sRANKL, and TGF-ß (D and F) for 4 days.

FIG. 2. RT-PCR analysis of the expression of various mRNAs involved in osteoclast

differentiation, and expression of glucocorticoid receptors . Isolated M/MØ cells were treated

with M-CSF (20 ng/ml) + sRANKL (40 ng/ml, MR), M-CSF + TGF-ß (2 ng/ml) + sRANKL

(MTR), M-CSF + Dex (10-9 M) + sRANKL (MDexR), or M-CSF + TGF-ß + Dex + sRANKL

(MTDexR) for 0, 2, or 4 days. A, primers used were designed for mouse genes of TRAP,

cathepsin K, calcitonin receptor, integrins αv and ß3, all of which are known to be abundantly

expressed in the process of osteoclast differentiation; CD14, a marker molecule of macrophage

differentiation; and ß-actin. Numbers in parentheses indicate the numberf of PCR cycles. B,

expression of GR in cells treated as described above was determined by RT-PCR and Western

blotting (GR-IB). The cDNA was amplified for the number of PCR cycles indicated in

26

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

parentheses. In both “A” and “B” the respective cDNAs were not saturated.

FIG. 3. Point of Dex action in the process of osteoclast differentiation and the synergistic

effect with TGF-ß. A, isolated M/MØ cells were treated or not with Dex (10-9 M) for the

entire 4 days, or for the first 2 days or the last 2 days in the presence of M-CSF (20 ng/ml),

TGF-ß (2 ng/ml), and sRANKL (40 ng/ml). After the end of the culture period, the cells were

stained for TRAP activity, and number of TRAP-positive MNCs per well was then counted. B,

isolated M/MØ cells were pretreated with M-CSF alone (M), M-CSF + TGF-ß (MT), M-CSF

+ Dex (MDex), or M-CSF + TGF-ß + Dex (MTDex) for 2 days; and thereafter, the cells were

further treated for an additional 4 days with sRANKL in the presence of M-CSF (open bars),

M-CSF + TGF-ß (diagonal bars), M-CSF + Dex (hatched bars), or M-CSF + TGF-ß + Dex

(closed bars). Then the cells were extracted, and the TRAP activity was measured. The

experiments were performed 3 times, and the reproducibility was confirmed. Values are the

means + SE for 4 cultures in a representative experiment.

FIG. 4. Electrophoretic mobility shift assay targeting NF-κB and AP-1 binding sites.

Isolated M/MØ cells were pretreated or not with various concentrations of Dex in the presence of

M-CSF (20 ng/ml), or M-CSF and TGF-ß (2 ng/ml) for 2 days prior to treatment with sRANKL

(40 ng/ml) for 1 h, and then nuclear extracts were prepared. The extracts were incubated with

32P-labeled oligonucleotide probes for NF-κB (A) and AP-1 (B) binding sites, and the mixtures

were then subjected to PAGE. In addition, extracts from the cells pretreated with M-CSF, TGF-

ß, and Dex (10-9 M, last 3 lanes from the left) were incubated with the labeled NF-κB or AP-1

probes in the presence or absence of anti-NF-κB p50, anti-NF-κB p65, anti-c-Jun/AP-1 or

anti-c-Fos antibody. The experiments were performed 3 times, and the reproducibility was

confirmed.

27

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

FIG. 5. Expression of c-fos mRNA, and sRANKL-induced JNK activity and nuclear

translocation of NF-κB in osteoclast progenitors trated with Dex and/or TGF-ß. A, isolated

M/MØ cells were immediately extracted for preparing total RNA (Day-0); or the cells were

pretreated with M-CSF (20 ng/ml, M), M-CSF + TGF-ß (2 ng/ml, MT), M-CSF + Dex (10-9

M, MDex), or M-CSF + TGF-ß + Dex (MTDex) for 2 days, and then total RNA in each culture

was extracted. Primers used were designed for mouse genes of mouse c-fos, fra-1, c-jun and ß-

actin. The numbers in parentheses indicate the number of PCR cycles. The experiments were

performed 3 times, and the reproducibility was confirmed. The number under each band is the

mean of pretreated/control (Day-0) ratio of the intensity of each band normalized to that of ß-

actin measured by densitometry for 3 individual experiments. *P<0.05, **P<0.01 vs. the culture

pretreated with M-CSF alone for 2 days. B, after the above pretreatments, the cells were

incubated or not with sRANKL (40 ng/ml) for 1 h. Then, nuclear fractions for NF-κB p-50 and

p65 immuno-blotting were prepared (B). C, after the treatment or not with sRANKL, JNK in

whole cell lysates was pulled-down with anti-JNK antibody, and the kinase activity of JNK was

determined from the level of phosphorylated recombinant GTS-c-Jun. The experiments were

performed 3 times, and the reproducibility was confirmed. The number under each band is the

mean of treated/control (the culture pretreated with M-CSF alone and subsequently treated with

sRANKL) ratio of the intensity of each band for 3 individual experiments.

FIG. 6. Down-regulation of endogenous expression of IFN-ß in osteoclast progenitors by the

synergistic action of TGF-ß and Dex. A , isolated M/MØ cells were pretreated with M-CSF (20

ng/ml, M), M-CSF + TGF-ß (2 ng/ml, MT), M-CSF + Dex (10-9 M, MDex), or M-CSF +

TGF-ß + Dex (MTDex) for 2 days, and then total RNA in each culture was extracted. Primers

used were designed for mouse genes of mouse IFN-ß and ß-actin. The numbers in parentheses

indicate the number of PCR cycles. The experiments were performed 3 times, and the

reproducibility was confirmed. The number under each band in IFN-ß panel is the

pretreated/control (Day-0) ratio of the intensity of each band normalized to that of ß-actin

28

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

measured by densitometry. B, after the pretreatments described as above, the cells were

incubated with (+) or without (-) IFN-ß (20 units/ml) for 1 h. Then, the nuclear extract in each

culture was prepared and incubated with the 32P-labeled oligonucleotide probe for the ISGF-3

binding site (ISRE); and then the mixture was subjected to PAGE. The experiments were

performed 3 times, and the reproducibility was confirmed. The number under each band is the

pretreated/control (M-pretreatment but no IFN-ß-treatment) ratio of the intensity of each band.

In addition, extract from the cells pretreated with M-CSF and subsequently treated with IFN-ß

(the first lane from the left) was incubated with the labeled ISRE probes in the presence or

absence of anti-STAT-1, anti-STAT-1, or anti-ISGF-3γ antibody. C, the isolated M/MØ cells

were exposed or not to exogenous IFN-ß (20 units/ml) for the last 1 day, 6 h or 1h during 2-day

pretreatment with M-CSF + TGF-ß + Dex prior to treatment with sRANKL (40 ng/ml) for 1 h,

and thereafter nuclear extracts were prepared. The extracts were incubated with 32P-labeled

oligonucleotide probes for NF-κB and AP-1 binding sites, and the mixtures were then subjected

to PAGE. The experiments were performed 3 times, and the reproducibility was confirmed.

29

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from

and Yoshiyuki HakedaAtsushi Takuma, Toshio Kaneda, Takuya Sato, Setsuo Ninomiya, Masayoshi Kumegawa

into osteoclastsdifferentiationgrowth factor-ß by stimulating the priming of osteoclast progenitors for

Dexamethasone enhances osteoclast formation synergistically with transforming

published online August 27, 2003J. Biol. Chem. 

  10.1074/jbc.M300213200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on July 1, 2018http://w

ww

.jbc.org/D

ownloaded from