Supplementary material

Differential roles of kallikrein-related peptidase 6 in malignant transformation and

ΔNp63β-mediated epithelial-mesenchymal transition of oral squamous cell

carcinoma

Naoki Kaneko, Shintaro Kawano*, Kaori Yasuda, Yuma Hashiguchi, Taiki Sakamoto,

Ryota Matsubara, Yuichi Goto, Teppei Jinno, Yasuyuki Maruse, Masahiko Morioka,

Taichi Hattori, Shoichi Tanaka1, Hideaki Tanaka, Ryoji Kitamura, Tamotsu Kiyoshima,

Seiji Nakamura

*Correspondence to: Shintaro Kawano, DDS, PhD.

Section of Oral and Maxillofacial Oncology, Division of Maxillofacial Diagnostic and

Surgical Sciences, Faculty of Dental Science, Kyushu University,

3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan.

Tel: +81-92-642-6447, E-mail: skawano@dent.kyushu-u.ac.jp

Supplementary methods

RNA extraction, RT-polymerase chain reaction (PCR), and real-time PCR

Total RNA was isolated from cultured cells using Trizol reagent (Invitrogen, Carlsbad,

CA, USA), and the isolated RNA was reverse-transcribed into cDNA. cDNA was

analyzed using RT-PCR and real-time PCR with gene-specific primers

(Supplementary Table S1). The RT-PCR reaction comprised template DNA, primers,

MgCl2, Taq DNA Polymerase Buffer (Bio Basic, Markham, Canada), Taq DNA

Polymerase (Bio Basic), dNTPmix (Toyobo, Osaka, Japan). The PCR program was as

follows: 30 cycles of denaturing at 94°C for 30 sec, annealing at 60°C for 30 sec, and

elongation at 72°C for 15 sec. Real-time PCR was performed using the Real-Time PCR

System (Mx3000P, Stratagene, San Diego, CA USA), Brilliant Ⅲ Ultra-Fast SYBR

Green qPCR Master Mix (Agilent Technologies, Santa Clara, CA, USA). The PCR

program was as follows: 45 cycles of denaturing at 95°C for 30 sec, annealing at 60°C

for 30 sec, and elongation at 72°C for 15 sec. Relative mRNA levels were calculated by

normalizing mRNA expression levels of the target gene to mRNA levels of

glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Immunohistochemistry

Immunohistochemistry analyses of formalin-fixed and paraffin-embedded tissues

derived from OSCC patients’ biopsy specimens were conducted using the avidin–

biotin–peroxidase method. All sections were counterstained with hematoxylin. The

primary antibodies used are shown in Supplementary Table S2. The negative control

samples were treated with phosphate buffered saline (PBS) in the absence of a primary

antibody. In this study, we pathologically defined “the invasive front” as the most

progressed and detached cancer cell groups at the advancing edge of the OSCC. To

compare the intensity of KLK6 immunostaining at the invasive front with the central

region, KLK6 staining intensity in at least three randomly selected areas (×200

magnification) of each region was calculated using a BZ-II analyzer (Keyence, Osaka,

Japan). The patients were classified into two groups based on the intensity of KLK6

expression at the invasive front relative to the central region.

Gene expression microarrays

Complementary RNA was amplified and labeled using a Low Input Quick Amp

Labeling Kit (Agilent Technologies) according to the manufacturer’s instructions, and

hybridized to a SurePrint G3 Human Gene Expression Microarray 8 × 60 K v2 (Agilent

Technologies). The hybridized microarray slides were analyzed using an Agilent

scanner. Relative hybridization intensities and background hybridization values were

calculated using Agilent Feature Extraction Software ver. 9.5.1.1.

Data analysis and filtering

The raw signal intensities and flag values associated with each probe were calculated

from the hybridization intensities (gProcessedSignal) and spot information

(gIsSaturated) according to the manufacturer’s instructions. The raw signal intensities

were log2-transformed and normalized using a quantile algorithm with the

preprocessCore library package included in the Bioconductor software. We selected

probes referred to as “Present” flag in each group. Z-scores and ratios (non-log-scaled

fold change) were calculated from the normalized signal intensities of each probe. Up-

regulated genes were defined as those with a Z-score ≥ 2.0 and a ratio ≥ 1.5-fold, and

down-regulated genes were defined as those with a Z-score ≤ -2.0 and a ratio ≤ 0.66-

fold.

Western blot assays

Cells were lysed in modified radioimmunoprecipitation buffer supplemented with

protease cocktail and phosphatase inhibitors (Nacalai Tesque, Kyoto, Japan). Whole‐

cell lysates were separated using sodium dodecyl sulfate and polyacrylamide gel

electrophoresis (SDS-PAGE), and the separated proteins were transferred to a

polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA). The membranes

were probed with primary antibodies (Supplementary Table S2) overnight at 4°C. The

primary antibodies were then visualized using secondary antibodies (Jackson

ImmunoResearch, West Grove, PA, USA or Santa Cruz Biotechnology, Dallas, TX,

USA; all diluted 1:5000) at room temperature for 1 h, and digital images were

subsequently captured. β-actin was used as a positive control.

Small interfering RNA (siRNA) transfection

The sequences of siRNA constructs used in this study are as follows: ΔNp63 siRNA: 5ʹ-

GGACAGCAGCATTGATCAATT-3ʹ; PAR2 siRNA, MISSION esiRNA (Sigma-

Aldrich, St. Louis, MO, USA) scrambled siRNA: 5ʹ-CAGTCGCGTTTGCGACTGG-3ʹ;

KLK6 siRNA, ON-TARGET plus SMART pool siRNA (Dharmacon, Lafayette, CO,

USA). The cells were cultured in 6-well dishes for 24 h. When the cells reached 50–

70% confluence, they were transfected with siRNA using RNAi MAX reagent

(Invitrogen). RNA and protein extractions were conducted 48 and 72 h after the

transfection.

Establishment of stable cell lines transfected with short hairpin (sh) RNA

To establish stable KLK6 knockdown clone, SQUU-A cells were transfected with an

empty vector (pLKO.1) (Sigma-Aldrich) or with pLKO.1-shKLK6 (Sigma-Aldrich)

using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions.

Stably transfected clones were selected using 0.5 μg/ml puromycin (Gibco, Thermo

Fisher Scientific, Waltham, MA, USA) for two weeks, and the selected cells were

transferred to 96-microtiter plates for single-cell cloning using the limited dilution

method. The single-cell cloning procedure was conducted three times, and two clonal

cell lines were ultimately established: the shKLK6 cell line constitutively KLK6

knockdown and the shCtrl cell line constitutively expressing the empty vector.

Water-soluble tetrazolium (WST)-8 cell proliferation assay

Cell proliferation was assessed using the Cell Count Reagent Kit (Nacalai Tesque),

according to the manufacturer’s instructions. The number of viable cells was

determined using a microplate reader (Multiskan FC, Thermo Scientific).

Wound healing assay

Cells were seeded in 6-well culture dishes and incubated until they reached confluence.

A wound was introduced in the center of the culture dish using a pipette tip. The wound

area was analyzed using a phase-contrast microscope (CKX41 NB-31PHP, Olympus,

Tokyo, Japan).

Matrigel invasion assay

Cells were seeded on 24-well BioCoat™ Matrigel™ chamber inserts (BD Biosciences,

Franklin Lakes, NJ, USA). After 24 h, the cells on the inside of the inserts were

removed using cotton swabs, and invasive cells on the outside of the inserts were

visualized using HE staining.

Exogenous KLK6 treatment

Recombinant human KLK6 (rhKLK6) protein was obtained from R&D Systems

(Minneapolis, MN, USA). OSCC cells were treated with rhKLK6 (0.1 μg/ml) for 20

min, and whole-cell extracts were subsequently analyzed using western blot assays.

Total RNA was isolated from cells treated with rhKLK6 (0.1 μg/ml) for 24 hours.

Supplementary Table S1. Primer sequences

mRNA Size (bp) 　 Sequence

∆Np63 117forward TGCCCAGACTCAATTTAGTGAG

reverse TGCGCGTGGTCTGTGTTATA

KLK6 311forward CATGGCGGACCCTGCGACAAGAC

reverse AGGGGAAGGGGCTGGATGAGTT

PAR1 240forward TCCGGATAT TTGACCAGCTC

reverse AGACCCAAACTGCCAATCAC

PAR2 236forward TCCGCACTGTAAAGCAGAT

reverse AATCCTGAGAGGT GCTGCAT

E-cadherin 196forward TGCTCTTCCAGGAACCTCTG

reverse AGGGAAACTCTCTCGGTCCA

CK19 174forward TCCGAACCAAGTTTGAGACG

reverse TGATTTCCTCCTCATGGTTGTT

vimentin 196forward TGCCCTTAAAGGAACCAATG

reverse CTCAATG TCAAGGGCCATCT

N-cadherin 163forward TGAAGGAGTCAGCAGAAGTTGA

reverse TCAGACCTGATCCTGACAAGC

fibronectin 170forward GCAAGCCCATAGCTGAGAAG

reverse GTCCTGATCGTTGCATCTATTT C

ZEB1 118forward AAGACATGTGACGCAGTCTGG

reverse TGGCTTCTCTCCACTGTGAATTC

ZEB2 211forward AGCGGAAACAAGGATTTC

reverse GGTCTTTTTCCTGTGTGTTCG

Snail 231forward GCAGGACTCTAATCCAGAGTTTACC

reverse CCTTTCCCACTGTCCTCATC

Slug 224forward CACATACAGTGATTATTTCCCCG

reverse GTCCTTGGAGGAGGTGTCAG

twist 201forward GGAGTCCGCAGTCTTACGAG

reverse TCTGGAGGACCTGGTAGAGG

GAPDH 104forward ATCAGCAATGCCTCCTGCAC

reverse ATGGCATGGACTGTGGTCAT

Supplementary Table S2. Antibodies

Antibody Application (Dilution)Monoclonal mouse anti-human ∆Np63 (M724701) (Dako, Denmark) IHC (1:200), WB (1:1000)Polyclonal goat anti-human KLK6 (AF2008) (R&D Systems) IHC (1:200)Monoclonal mouse anti-human KLK6 (sc-374564) (Santa Cruz Biotechnology) WB (1:500)Monoclonal mouse anti-human PAR1 (sc-13503) (Santa Cruz Biotechnology) IHC (1:100), WB (1:500)Monoclonal rabbit anti-human PAR2 (ab180953) (Abcam, UK)Polyclonal mouse anti-human ERK1/2 (sc-292838) (Santa Cruz Biotechnology)

IHC (1:100), WB (1:500)WB (1:500)

Monoclonal rabbit anti-human p-ERK1/2 (#4370) (Cell Signaling Technology) IHC (1:400), WB (1:2000)Monoclonal rabbit anti-human AKT (C67E7) (Cell Signaling Technology)Monoclonal rabbit anti-human p-AKT Ser473 (#4060) (Cell Signaling Technology)

WB (1:1000)WB (1:2000)

Monoclonal rabbit anti-human p-AKT Thr308 (#2965) (Cell Signaling Technology) WB (1:1000)Monoclonal rabbit anti-human E-cadherin (#3195) (Cell Signaling Technology) WB (1:1000)Monoclonal rabbit anti-human Vimentin (#5741) (Cell Signaling Technology) WB (1:1000)Monoclonal rabbit anti-human Cytokeratin19 (ab52625) (Abcam, UK) WB (1:500)Monoclonal rabbit anti-human N-cadherin (#13116) (Cell Signaling Technology) WB (1:1000)Monoclonal rabbit anti-human fibronectin (ab32419) (Abcam, UK) WB (1:1000)Monoclonal rabbit anti-human ZEB1 (#3396) (Cell Signaling Technology) WB (1:1000)Monoclonal rabbit anti-human snail (#3879) (Cell Signaling Technology) WB (1:1000)Monoclonal rabbit anti-human slug (#9585) (Cell Signaling Technology) WB (1:1000)Monoclonal mouse anti-human twist (sc-81417) (Santa Cruz Biotechnology) WB (1:500)Monoclonal mouse anti-human β-actin (sc-47778) (Santa Cruz Biotechnology) WB (1:500)

Rank Gene symbol NCBI Acc. No. Gene name Z-score ratio

1 KLK6 NM_001012964 Kallikrein-related peptidase 6 10.30 3866.7

2 KRT19 NM_002276 Keratin 19 10.00 81.2

3 MAL2 NM_052886 Mal, T-cell differentiation protein 2 9.89 398.7

4 CLDN4 NM_001305 Claudin 4 9.79 230.3

5 WFDC2 NM_006103 WAP four-disulfide core domain 2 9.59 333.6

6 FXYD3 NM_001136007 FXYD domain containing ion transport regulator 3 9.56 2145.7

7 DMKN NM_001035516 Dermokine 8.94 225.5

8 PRSS8 NM_002773 Protease, serine, 8 8.72 1087.9

9 EPCAM NM_002354 Epithelial cell adhesion molecule 8.53 175.3

10 KRT19P2 NR_036685 Keratin 19 pseudogene 2 8.39 161.5

11 LAD1 NM_005558 Ladinin 1 8.39 834.1

12 KRT83 NM_002282 Keratin 83 8.19 94.2

13 SPINT2 NM_021102 Serine peptidase inhibitor, Kunitz type, 2 8.03 86.2

14 S100A14 NM_020672 S100 calcium binding protein A14 7.94 582.4

15 KLK5 NM_012427 Kallikrein-related peptidase 5 7.90 3890.9

16 KLK8 NM_144505 Kallikrein-related peptidase 8 7.82 3609.5

17 CDH1 NM_004360 E-cadherin 7.74 495.1

18 CDH3 NM_001793 P-cadherin 7.63 454.3

19 WFDC2 NM_006103 WAP four-disulfide core domain 2 7.60 443.1

20 ERP27 NM_152321 Endoplasmic reticulum protein 27 7.58 2798.1

21 ALPP ENST00000485563 Alkaline phosphatase, placental 7.52 95.0

22 TACSTD2 NM_002353 Tumor-associated calcium signal transducer 2 7.44 26.2

23 ITGB4 NM_000213 Integrin, beta 4 7.42 89.4

24 FGD3 NM_033086 FYVE, RhoGEF and PH domain containing 3 7.41 2350.9

25 DMKN NM_033317 Dermokine 7.31 352.1

26 KRT83 NM_002282 Keratin 83 7.27 340.2

27 CLDN7 NM_001307 Claudin 7 7.24 80.3

28 S100P NM_005980 S100 calcium binding protein P 7.24 80.3

29 GPR110 NM_153840 G protein-coupled receptor 110 7.14 1759.4

30 JUP NM_002230 Junction plakoglobin 7.13 75.1

Supplementary Table S3. The 30 most highly upregulated mRNAs among the 43870

genes analyzed

Rank Gene symbol NCBI Acc. No. Gene name Z-score Ratio

1 CCL2 NM_002982 Chemokine (C-C motif) ligand 2 -6.887 0.00076

2 F2RL2 NM_004101 Coagulation factor IIeceptor-like 2 -6.711 0.00091

3 WNT5A NM_003392 Wingless-type integration site family, 5A -6.459 0.00119

4 NCAM1 NM_001242607 Neural cell adhesion molecule 1 -6.337 0.00135

5 KCNG1 NM_002237 Potassium channel voltage gated subfamily G1 -6.037 0.00792

6 HTRA1 NM_002775 HtrA serine peptidase 1 -5.873 0.00903

7 IGF2 NM_000612 Insulin-like growth factor 2 -5.847 0.00226

8 AKR1C1 NM_001353 Aldo-keto reductase family 1, member C1 -5.837 0.03793

9 SNAR-B2 NR_024230 Small ILF3/NF90-associated RNA B2 -5.824 0.23048

10 NNMT NM_006169 Nicotinamide N-methyltransferase -5.734 0.04018

11 CXCL1 NM_001511 Chemokine (C-X-C motif) ligand 1 -5.729 0.03102

12 AKR1C1 NM_001353 Aldo-keto reductase family 1, member C1 -5.682 0.04135

13 SLCO2B1 NM_007256 Solute carrier organic anion transporter family, 2B1 -5.633 0.00282

14 SRGN NM_002727 Serglycin -5.610 0.00289

15 GLI3 NM_000168 GLI family zinc finger 3 -5.575 0.00300

16 TMTC1 NM_175861 Transmembrane and tetratricopeptide containing 1 -5.552 0.00307

17 LOC283140 ENST00000532168 -5.406 0.03774

18 TNIP3 NM_024873 TNFAIP3 interacting protein 3 -5.357 0.00376

19 FOXP1 NM_032682 Forkhead box P1 -5.346 0.01378

20 MAGEA10 NM_001011543 Melanoma antigen family A, 10 -5.281 0.01451

21 BEX1 NM_018476 Brain expressed, X-linked 1 -5.258 0.04129

22 SNAR-A3 NR_024214 Small ILF3/NF90-associated RNA A3 -5.183 0.27082

23 EMP3 NM_001425 Epithelial membrane protein 3 -5.093 0.01688

24 SPANXA1 NM_013453 Sperm protein associated with nucleus X-linked A1 -5.065 0.01727

25 OSBPL6 NM_032523 Oxysterol binding protein-like 6 -4.906 0.00603

26 HKDC1 NM_025130 Hexokinase domain containing 1 -4.891 0.01984

27 TMTC1 NM_175861 Transmembrane and tetratricopeptide containing 1 -4.888 0.00614

28 KIAA1644 NM_001099294 KIAA1644 -4.856 0.00641

29 BDKRB2 NM_000623 Bradykinin receptor B2 -4.855 0.00257

30 CXCL2 NM_002089 chemokine (C-X-C motif) ligand 2 -4.842 0.05312

Supplementary Table S4. The 30 most highly downregulated mRNAs among the

43870 genes analyz

Supplementary Table S5. Multivariate Cox regression analysis of various factors for

cumulative survival rate.

Variables

Cumulative survival rate

Relative

risk 95% confidence interval p -value

Gender

Male Reference - -

Female 1.6711781 0.6854878 - 4.1049797 0.2566

Primary site

Tongue Reference - -

Others 1.5010796 0.6537208 - 3.5296628 0.3381

Clinical T stage

T1, T2 Reference - -

T3, T4 1.2283423 0.3516121 - 4.6988866 0.7514

Clinical stage

, Ⅰ Ⅱ Reference - -

Ⅲ, Ⅳ 1.1867806 0.3098103 - 4.2446533 0.7963

Histologic grade

Grade 1 Reference - -

Grade 2 1.0239431 0.3920471 - 2.5110153 0.9599

Grade 3 0.7433336 0.0360792 - 5.3127712 0.7932

Mode of tumor invasion

(Yamamoto-Kohama’s criteria)

Grade 1 Reference - -

Grade 2 0.3236925 0.0347843 - 3.0121858 0.3758

Grade 3 0.4033842 0.0470791 - 3.4562857 0.4553

Grade 4C 0.9796259 0.1085388 - 8.8416950 0.9854

Grade 4D 0.7761027 0.0747129 - 8.0619991 0.8350

Treatment

Surgery Reference - -

Surgery with chemoradiotherapy 1.0521283 0.3491327 - 3.0341856 0.9262

Low KLK6 expression

No Reference - -

Yes 4.0095108 1.7896577 - 9.5930169 0.0007

The clinicopathological factors were analyzed in a multivariate manner using a Cox

regression model.

Supplementary Figure S 1. Gene expression patterns in SQUU-BO and SQUU-BC cells.

The scatterplot analysis used to analyze and visualize the differences in gene expression in

SQUU-BO and SQUU-BC cells. Red dots represent up-regulated genes, and blue dots

represent down-regulated genes in SQUU-BO cells compared with SQUU-BC cells.

SQUU-BC

SQUU-BO

: upregulated gene (707 genes): downregulated gene (475 genes)

Supplementary Figure S 2. Effects of KLK6 knockdown in SQUU-BO.

(A) KLK6 expression is strongly inhibited in SQUU-BO cells transfected with KLK6

siRNA (siKLK6). (B) Real-time PCR demonstrate that epithelial cell markers are down-

regulated, while mesenchymal markers and EMT markers are up-regulated in siKLK6

compared with siCtrl (Mann–Whitney U-test, *p < 0.05). (C) The WST-8 assay revealed

that proliferation is significantly inhibited in cells transfected with KLK6 siRNA compared

with siCtrl 96 h after cell seeding (Mann–Whitney U-test, *p < 0.05). (D) The wound

healing assay demonstrates that cell migration is strongly enhanced in siKLK6 cells

compared with control cells at 24 h (Mann–Whitney U-test, *p < 0.05). Scale bars: 200 μm.

(E) The invasion assay demonstrates that the invasive activity of siKLK6 cells increase

nearly two-fold compared with control cells (Mann–Whitney U-test, *p < 0.05). Scale bars:

50 μm.

Supplementary Figure S 3. Effects of exogenous KLK6 on KLK6 knockdown SQUU-A

cells.

(A) Real-time PCR analyses demonstrate that epithelial cell markers (E-cadherin and CK15)

are up-regulated, while mesenchymal markers (vimentin and N-cadherin) and EMT markers

(ZEB1, ZEB2, Snail, and Slug) are down-regulated in shKLK6-silencing SQUU-A cells by

adding rhKLK6 proteins (0.1 μg/ml) for 24 h (Mann–Whitney U-test, *p < 0.05). (B) The

migration and (C) invasion are inhibited in KLK6-silencing cells by the treatment with

rhKLK6 proteins compared with control cells (Mann–Whitney U-test, *p < 0.05).

Supplementary Figure S 4. Effects of exogenous KLK6 on KLK6 knockdown SQUU-BO

cells.

(A) Real-time PCR analyses demonstrate that epithelial cell markers (E-cadherin ) are up-

regulated, while mesenchymal markers (vimentin and N-cadherin) and EMT markers (ZEB1,

Snail, Slug, and twist) are down-regulated in KLK6 knockdown SQUU-BO cells by adding

rhKLK6 proteins (0.1 μg/ml) for 24 h (Mann–Whitney U-test, *p < 0.05). (B) The

migration is inhibited in KLK6 knockdown SQUU-BO cells by the treatment with rhKLK6

proteins compared with control cells (Mann–Whitney U-test, *p < 0.05). (C) In the invasion

assay, the number of invaded cells is down-regulated in KLK6 knockdown SQUU-BO cells

by the treatment with rhKLK6 proteins compared with control cells, though no significant

difference is shown.