ars.els-cdn.com · Web viewSupplementary Material PCR amplification and Illumina MiSeq sequencing...
Transcript of ars.els-cdn.com · Web viewSupplementary Material PCR amplification and Illumina MiSeq sequencing...
Supplementary Material
PCR amplification and Illumina MiSeq sequencing
PCR amplifications were carried out in a total volume of 20 μL using a DNA thermocycler (ABI
GeneAmp® 9700, USA). The PCR mixture contained 0.4 μL of TransStart Fastpfu DNA Polymerase
(TransGen AP221-02, Beijing, China), 4 μL of 5×FastPfu Buffer, 0.8 μL of each primer at a
concentration of 5 μM, 2 μL of each deoxynucleoside triphosphate (dNTP) at a concentration of 2.5
mM, and 10 ng of template DNA. PCR thermal cycling was as follows, initial denaturation at 95C
for 3 min and 27 cycles consisting of denaturation at 95C for 30 s, primer annealing at 55C for 30 s
and extension at 72C for 45 s. The final elongation step was extended for 10 min. The 16S rRNA
genes were amplified from the DNA extracts using primers 338F
(5’ACTCCTACGGGAGGCAGCAG3’) coupled with 806R
(5’GGACTACATCGACGGGTATTCTAAT3’) (Muyzer et al., 1993).
Amplicons were extracted from 2% agarose gels and purified using the AxyPrep DNA Gel
Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to the manufacturer’s
instructions and quantified using QuantiFluor™-ST (Promega, USA). Purified amplicons were
pooled in equimolar amounts and high-throughput sequenced using Illumina MiSeq platform
(Majorbio, Shanghai) according to the standard protocols.
1
Table S1 Compositions of the synthetic wastewater
Main nutrientsConcentration
(mg·L-1)Trace elements
Concentration
(mg·L-1)
CH3COONa 780 H3BO3 0.2
NH4Cl 230 CoCl46H2O 0.2
KH2PO4 43 CuSO45H2O 0.06
FeSO4 8 FeCl36H2O 2
MgSO4 102 MnCl22H2O 0.22
CaCl2 42 Na2Mo7O242H2O 0.14
ZnSO47H2O 0.2
KI 0.06
NiCl2 0.12
2
Tabel S2 Relative abundances of the activated sludge samples at family level
Taxon Stage 1 Stage 2 Stage 3A Stage 3B Stage 3C
A0839 0.51% 0.16% 0.08% 0.13% 0.07%ABS-19 0.07% 0.15% 0.08% 0.09% 0.01%AKYH767 0.00% 0.01% 0.00% 0.02% 0.00%ARKDMS-49_norank 0.02% 0.01% 0.01% 0.01% 0.01%Acetobacteraceae 0.02% 0.03% 0.04% 0.01% 0.01%Acidimicrobiaceae 0.00% 0.03% 0.02% 0.02% 0.01%Acidimicrobiales_unclassified 0.08% 0.02% 0.06% 0.08% 0.03%
Acidimicrobiales_uncultured 0.04% 0.04% 0.01% 0.00% 0.00%
Alcaligenaceae 0.03% 0.03% 0.02% 0.02% 0.00%
Alphaproteobacteria_unclassified 0.06% 0.04% 0.12% 0.07% 0.13%
Anaerolineaceae 1.55% 0.66% 1.31% 2.21% 2.20%Armatimonadaceae 0.01% 0.02% 0.02% 0.01% 0.00%Armatimonadetes_norank 0.04% 1.12% 1.82% 0.41% 0.01%B1-7BS_norank 0.05% 0.04% 0.09% 0.76% 0.21%B79 0.19% 0.13% 0.11% 0.18% 0.09%BD7-11_norank 0.10% 0.07% 0.02% 0.01% 0.00%BIrii41 0.03% 0.02% 0.02% 0.02% 0.00%Bacillaceae 0.13% 1.11% 1.34% 1.39% 0.07%Bacteria_unclassified 21.98% 20.25% 26.03% 29.98% 45.88%Bacteriovoracaceae 0.00% 0.00% 0.00% 0.02% 0.08%Bacteroidetes_unclassified 0.26% 0.06% 0.05% 0.22% 0.03%Bdellovibrionaceae 2.07% 0.94% 0.61% 1.13% 0.47%Blfdi19 0.21% 0.14% 0.01% 0.01% 0.00%Bradyrhizobiaceae 0.04% 0.02% 0.01% 0.03% 0.07%CA002 0.02% 0.04% 0.05% 0.15% 0.03%Caldilineaceae 0.28% 0.23% 0.25% 0.27% 0.10%Campylobacteraceae 0.27% 0.38% 0.85% 0.15% 5.13%Candidate_division_SR1_norank 0.03% 0.43% 0.19% 0.10% 0.00%Candidate_division_WS6_norank 0.00% 0.02% 0.01% 0.01% 0.00%Carnobacteriaceae 0.00% 0.01% 0.01% 0.03% 0.00%Caulobacteraceae 0.03% 0.04% 0.01% 0.00% 0.01%Chitinophagaceae 1.37% 2.59% 1.19% 1.44% 0.39%Chloroflexi_uncultured 0.11% 0.06% 0.06% 0.09% 0.05%Chthoniobacteraceae 0.00% 0.02% 0.03% 0.02% 0.00%Chthonomonadaceae 0.00% 0.01% 0.02% 0.07% 0.00%Clostridiaceae_2 0.00% 0.13% 0.10% 0.14% 0.00%Comamonadaceae 4.67% 2.12% 2.26% 2.69% 2.01%Coxiellaceae 0.05% 0.01% 0.01% 0.00% 0.00%Cryomorphaceae 0.07% 0.01% 0.03% 0.07% 0.18%Cryptosporangiaceae 0.08% 0.05% 0.05% 0.03% 0.08%
3
Cytophagaceae 10.15% 18.43% 14.03% 15.38% 3.02%DB1-14_norank 0.34% 0.14% 0.12% 0.09% 0.05%DEV007 0.05% 0.04% 0.00% 0.00% 0.00%DS-100 0.12% 0.05% 0.13% 0.09% 0.06%Elev-16S-1166 0.01% 0.02% 0.01% 0.03% 0.04%Enterobacteriaceae 0.00% 0.13% 0.15% 0.12% 0.00%Enterococcaceae 0.01% 0.44% 0.49% 0.47% 0.00%Family_XII 0.01% 0.00% 0.00% 0.05% 0.01%Flavobacteriaceae 1.39% 4.16% 6.32% 7.48% 9.14%GR-WP33-30_norank 0.14% 0.18% 0.16% 0.08% 0.03%GR-WP33-58 0.03% 0.06% 0.11% 0.20% 0.08%Gaiellaceae 0.03% 0.03% 0.04% 0.01% 0.01%Gemmatimonadaceae 1.64% 0.89% 1.27% 1.06% 0.56%Gracilibacteria_norank 0.01% 0.01% 0.00% 0.00% 0.00%Haliangiaceae 0.26% 0.21% 0.26% 0.18% 0.13%Holosporaceae 0.01% 0.02% 0.00% 0.01% 0.00%Hydrogenedentes_norank 0.03% 0.02% 0.05% 0.06% 0.02%Hyphomicrobiaceae 0.43% 0.53% 0.36% 0.14% 0.13%Hyphomonadaceae 1.13% 0.88% 0.49% 0.75% 0.25%I-10 0.30% 0.06% 0.07% 0.12% 0.03%Iamiaceae 0.03% 0.01% 0.02% 0.02% 0.01%JG30-KF-CM45_norank 0.44% 0.12% 0.10% 0.20% 0.24%JG30-KF-CM66_norank 0.00% 0.00% 0.01% 0.00% 0.01%JG35-K1-AG5 0.04% 0.09% 0.07% 0.03% 0.02%JG37-AG-20 0.03% 0.02% 0.02% 0.01% 0.01%KD4-96_norank 0.01% 0.02% 0.04% 0.05% 0.01%KI89A_clade_norank 0.05% 0.02% 0.03% 0.08% 0.03%Kineosporiaceae 0.00% 0.02% 0.01% 0.00% 0.00%Latescibacteria_norank 0.17% 0.06% 0.13% 0.12% 0.03%Legionellaceae 0.03% 0.04% 0.00% 0.01% 0.00%Leptospiraceae 0.11% 0.04% 0.16% 0.80% 0.29%MNC12 0.10% 0.30% 0.34% 0.08% 0.05%MND8 0.01% 0.03% 0.02% 0.02% 0.01%MNG7 0.13% 0.10% 0.13% 0.09% 0.07%MVP-88_norank 0.01% 0.01% 0.01% 0.02% 0.00%Methylobacteriaceae 0.10% 0.24% 0.22% 0.11% 0.16%Methylocystaceae 0.00% 0.05% 0.03% 0.01% 0.00%Microbacteriaceae 0.00% 0.00% 0.01% 0.01% 0.02%Mitochondria 0.00% 0.00% 0.00% 0.01% 0.00%Moraxellaceae 1.36% 0.15% 0.11% 0.03% 1.47%Mycobacteriaceae 0.12% 0.04% 0.03% 0.03% 0.16%Myxococcales_uncultured 0.37% 0.14% 0.10% 0.27% 0.23%NKB5_norank 0.05% 0.04% 0.01% 0.01% 0.08%NPL-UPA2_norank 0.09% 0.01% 0.01% 0.06% 0.03%NS11-12_marine_group 0.29% 0.07% 0.13% 0.32% 0.61%NS9_marine_group 4.65% 3.51% 2.16% 3.29% 0.64%
4
Nannocystaceae 0.33% 0.14% 0.06% 0.03% 0.00%Nitrosomonadaceae 0.03% 0.01% 0.03% 0.01% 0.03%Nitrospira_norank 5.41% 6.52% 7.11% 7.33% 5.84%Nocardiaceae 0.01% 0.00% 0.00% 0.00% 0.00%OC31_norank 0.03% 0.00% 0.00% 0.00% 0.00%OM190_norank 1.39% 0.71% 0.81% 1.16% 0.25%OPB35_soil_group_norank 0.08% 0.03% 0.06% 0.09% 0.01%OPB56 2.14% 0.56% 0.26% 0.82% 1.65%Obscuribacterales_norank 0.02% 0.00% 0.00% 0.00% 0.02%Oligoflexaceae 0.03% 0.01% 0.01% 0.00% 0.01%Oligoflexales_norank 0.04% 0.03% 0.01% 0.00% 0.00%Opitutaceae 0.03% 0.02% 0.02% 0.19% 0.04%P3OB-42 0.60% 0.27% 0.31% 0.80% 0.43%PBS-III-20_norank 0.11% 0.06% 0.04% 0.02% 0.00%PHOS-HE36 0.02% 0.02% 0.01% 0.01% 0.01%PHOS-HE51 0.17% 0.25% 0.15% 0.04% 0.02%Paenibacillaceae 0.00% 0.06% 0.04% 0.07% 0.00%Parachlamydiaceae 0.08% 0.00% 0.03% 0.07% 0.00%Parcubacteria_norank 0.16% 0.27% 0.03% 0.07% 0.01%Phaselicystidaceae 2.18% 0.67% 0.79% 0.75% 0.68%Phycisphaeraceae 1.19% 2.38% 0.91% 0.66% 0.07%Phyllobacteriaceae 0.02% 0.04% 0.02% 0.02% 0.01%Pla4_lineage_norank 0.21% 0.01% 0.02% 0.01% 0.00%Planctomycetaceae 0.09% 0.02% 0.05% 0.05% 0.01%
Planctomycetes_unclassified 0.17% 0.08% 0.05% 0.03% 0.01%
Polyangiaceae 0.06% 0.01% 0.00% 0.00% 0.00%Proteobacteria_unclassified 0.00% 0.04% 0.02% 0.02% 0.01%Pseudomonadaceae 0.09% 0.02% 0.02% 0.03% 6.67%Rhizobiaceae 0.03% 0.01% 0.01% 0.00% 0.00%Rhizobiales_rhizobiales_incertae_sedis 0.03% 0.06% 0.02% 0.09% 0.03%
Rhodobacteraceae 1.66% 1.70% 1.28% 0.78% 0.48%Rhodocyclaceae 14.62% 12.64% 14.24% 5.01% 4.26%Rhodospirillaceae 0.27% 0.08% 0.04% 0.03% 0.01%Rhodospirillales_rhodospirillales_incertae_sedis 0.23% 0.12% 0.37% 0.49% 0.13%
Rickettsiaceae 0.00% 0.00% 0.00% 0.01% 0.02%Rickettsiales_rickettsiales_incertae_sedis 0.03% 0.02% 0.04% 0.05% 0.02%
Rickettsiales_unclassified 0.05% 0.01% 0.00% 0.00% 0.00%Rikenellaceae 0.00% 0.01% 0.00% 0.02% 0.00%Roseiflexaceae 0.06% 0.07% 0.06% 0.08% 0.03%SC-I-84_norank 0.48% 0.53% 0.40% 0.28% 0.39%SJA-149 0.01% 0.01% 0.01% 0.03% 0.08%SJA-28 0.82% 2.05% 1.12% 0.70% 0.02%
5
SM1A07_norank 0.06% 0.06% 0.00% 0.00% 0.00%SM2D12 0.03% 0.02% 0.00% 0.00% 0.03%SM2F11_norank 0.02% 0.01% 0.00% 0.00% 0.00%Saccharibacteria_norank 0.02% 0.01% 0.01% 0.01% 0.03%Sandaracinaceae 0.09% 0.01% 0.01% 0.02% 0.00%Saprospiraceae 2.53% 2.88% 0.66% 0.76% 0.20%Sh765B-TzT-29_norank 0.03% 0.03% 0.01% 0.01% 0.00%Simkaniaceae 0.07% 0.04% 0.04% 0.12% 0.02%
Sphingobacteriales_unclassified 0.07% 0.14% 0.03% 0.06% 0.01%
Sphingomonadaceae 0.01% 0.04% 0.07% 0.08% 0.03%Spirochaetaceae 0.05% 0.02% 0.02% 0.00% 0.00%Streptococcaceae 0.05% 0.35% 0.40% 0.31% 0.00%Subgroup_17_norank 0.08% 0.03% 0.03% 0.05% 0.09%Subgroup_3_unclassified 0.03% 0.00% 0.02% 0.03% 0.02%Subgroup_6_norank 0.61% 0.23% 0.46% 0.45% 0.18%TA18_norank 0.13% 0.98% 0.39% 0.12% 0.03%TK10_norank 0.38% 0.17% 0.24% 0.45% 0.15%TK34 0.02% 0.02% 0.00% 0.01% 0.01%TM6_norank 0.06% 0.05% 0.01% 0.00% 0.00%TRA3-20_norank 0.01% 0.01% 0.02% 0.01% 0.01%Unknown_Family 0.19% 0.12% 0.07% 0.08% 0.03%Verrucomicrobiaceae 0.51% 0.52% 0.04% 0.07% 0.03%WCHB1-60_norank 0.00% 0.00% 0.07% 0.87% 1.93%WCHB1-69 0.00% 0.00% 0.00% 0.01% 0.03%Xanthobacteraceae 0.02% 0.03% 0.02% 0.01% 0.00%Xanthomonadaceae 0.74% 0.98% 0.95% 0.61% 0.20%
Xanthomonadales_uncultured 0.48% 0.48% 0.57% 0.48% 0.19%
Xanthomonadales_xanthomonadales_incertae_sedis 0.49% 0.30% 0.39% 0.48% 0.32%
env.OPS_17 1.76% 0.52% 2.32% 1.17% 0.31%
6
Fig. S1 Schematic of the studied lab-scale A/O–MBR system
7
Stirrers
Anoxic Tank
MembraneModules
Air Blower
Feed Tank EffluentResevoir
AutomaticFlow-meter
VacuumGaugePump
PeristalticPump
Flow-meter
Backflow
Overflow
Air Diffuser
InfluentEffluent
Aerobic MBR Tank
Excess Sludge
Fig. S2 Rarefaction curves plotting the number of OTUs (observed species) identified at
the 97% 16S rRNA sequence similarity level
8
Fig. S3 TMP and flux profiles during the experimental period
9