Alginate Encapsulation Impacts the Insulin-like Growth Factor-I

System of Monolayer-Expanded Equine Articular Chondrocytes

and Cell Response to Interleukin-1b

RYAN M. PORTER, Ph.D.,1 R. MICHAEL AKERS, Ph.D.,2

RICK D. HOWARD, D.V.M., Ph.D.,3 and KIMBERLY FORSTEN-WILLIAMS, Ph.D.1

ABSTRACT

Alginate hydrogel culture has been shown to reestablish chondrocytic phenotype following monolayerexpansion; however, previous studies have not adequately addressed how culture conditions affect thesignaling systems responsible for chondrocytemetabolic activity. Here we investigate whether chondrocyteculture history influences the insulin-like growth factor-I (IGF-I) signaling system and its regulationby interleukin-1 (IL-1). Articular chondrocytes (ACs) from equine stifle joints were expanded by serialpassage and were either encapsulated in alginate beads or maintained in monolayer culture for 10 days.Alginate-derived cells (ADCs) and monolayer-derived cells (MDCs) were then plated at high density,stimulated with IL-1b (1 and 10 ng/mL) or IGF-I (50 ng/mL) for 48 h, and assayed for levels of type I IGFreceptor (IGF-IR), IGF binding proteins (IGFBPs), and endogenously secreted IGF-I. Intermediate al-ginate culture yielded relatively low IGF-IR levels that increased in response to IL-1b, whereas higherreceptor levels on MDCs were reduced by cytokine. MDCs also secreted substantially more IGFBP-2, thepredominant binding protein in conditioned media (CM), though IL-1b suppressed levels for both cellpopulations. Concentrations of autocrine/paracrine IGF-I paralleled IGFBP-2 secretion. Disparate basallevels of IGF-IR and IGFBP-2, but not IGF-I, were attributed to relative transcript expression. Systemicdifferences coincided with varied effects of IL-1b and IGF-I on cell growth and type I collagen expression.We conclude that culture strategy impacts the IGF-I signaling system of ACs, potentially altering theircapacity to mediate cartilage repair. Consideration of hormonal regulators may be an essential element toimprove chondrocyte culture protocols used in tissue engineering applications.

INTRODUCTION

ARTICULAR CARTILAGE SERVES vital biomechanical func-

tions within diarthrodial joints, reducing friction be-

tween joint surfaces and distributing compressive loads

between long bones. Because this specialized connective

tissue lacks vasculature, defects attributed to focal injury or

arthritis are not readily repaired by endogenous mechanisms,

thus necessitating biomedical intervention. Current strate-

gies for cell-based cartilage repair often involve the isolation

and in vitro multiplication of autologous chondrocytes.1–3

However, these methods are limited by the need to expand

chondrocyte numbers in 2-D culture, which leads to a loss of

chondrocytic phenotype (i.e., dedifferentiation) after exten-

sive passaging.4–6 Specifically, the cells take on a fibroblast-

like morphology, and synthesis of type II collagen decreases

1Department of Chemical Engineering, Virginia Polytechnic Institute and State University, Blacksburg, Virginia.2Department of Dairy Science, Virginia Polytechnic Institute and State University, Blacksburg, Virginia.3Arizona Equine Medical and Surgical Centre, Gilbert, Arizona.

TISSUE ENGINEERINGVolume 13, Number 6, 2007# Mary Ann Liebert, Inc.DOI: 10.1089/ten.2006.0345

1333

in favor of types I and III. The formation of a hyaline-like

cartilagenous matrix, as opposed to mechanically inferior

fibrocartilage, is critical for the long-term outcome of repair

protocols.2 In vitro culture strategies must therefore balance

the establishment of sufficient chondrocyte numbers with

the maintenance of cell functionality.

Encapsulation of chondrocytes in alginate hydrogels has

proven to be an attractive alternative to 2-D culture.7,8

Alginate, a linear polysaccharide of L-guluronic and D-

mannuronic acids, polymerizes to form a hydrogel in the

presence of calcium or other divalent cations. Chondrocytes

cultured in calcium alginate beads synthesize a cartila-

genous matrix over an extended culture period,9–11 and

cells dedifferentiated due to monolayer expansion have

been shown to redifferentiate when introduced into alginate

culture.12–16 Encapsulated cells can be readily harvested

from the hydrogels in the presence of a chelating agent.

These properties have made alginate beads a common scaf-

fold for studying chondrocyte physiology in vitro15–23 and a

promising biomaterial for maintaining or restoring chon-

drocytic phenotype prior to reimplantation.14,16,24–29

While investigations of potential substrates for chon-

drocyte culture have focused on phenotypic marker synthesis

(e.g., type II collagen, aggrecan), effects on cell signaling

systems have received little attention. Two of the most pro-

minent signaling systems with regard to cartilage metabolism

are the insulin-like growth factor-I (IGF-I) and interleukin-1

(IL-1) systems. IGF-I enhances production of cartilage ex-

tracellular matrix (ECM) components,30–32 whereas IL-1, an

inflammatory cytokine, inhibits matrix synthesis33–36 and

stimulates secretion of degradative proteases.35,37–39 Elevated

IL-1 levels are thought to induce matrix degradation in os-

teoarthritic cartilage,40 and arthritic chondrocytes demonstrate

reduced responsiveness to IGF-I.41–43 The mechanisms that

lead to IGF-I hyporesponsiveness have not been determined,

though IL-1 is clearly implicated.43 Potential mediators of

altered IGF-I signaling include its type I membrane receptor

(IGF-IR) and a set of high-affinity binding proteins (IGFBPs

1–6). IGF-I dysfunction within osteoarthritic cartilage advo-

cates closer examination of this signaling system for repair

strategies targeting arthritic joints.

We propose that culture history impacts the IGF-I sig-

naling system of articular chondrocytes (ACs) as well as

system responses to IL-1. To test this hypothesis, equine

ACs were expanded by serial passage as monolayers and

subcultured either in 3-D alginate beads or on 2-D tissue

culture plastic (TCP) (Fig. 1). The two cell populations were

then plated at high density for a direct comparison of cell

properties, stimulated with recombinant equine IL-1b or

human IGF-I, and assayed for IGF-I signaling mediators.

Relative to continuous monolayer culture, intermediate sus-

pension in alginate produced distinct mediator profiles at

basal conditions and disparate responses to IL-1b. The re-

sults suggest that culture strategy can alter the IGF-I sig-

naling dynamics of ACs and, perhaps, their effectiveness in

mediating cartilage repair.

~1x105

cells/cm2

passage(x 4)

IL-1β orIGF-I

Monolayer-DerivedCells (MDCs)

Alginate-DerivedCells (ADCs)

Monolayer Alginate Beads

B

C

D

E

equine ACs

~2x104

cells/cm2

A

FIG. 1. Schematic of parallel culture strategy. (A) Equine ACs

were isolated from articular cartilage explants and cultured as de-

scribed in Materials and Methods. (B) Chondrocyte numbers were

expanded for a total of four passages at sub-confluence (2�104 cells/

cm2) on TCP. (C) Cells were then either subcultured on 100-mm

dishes (left) or encapsulated in alginate beads (right). (D) After 10

days, MDCs were lifted by trypsin digestion, whereas ADCs were

collected following bead dissociation, and both chondrocyte popu-

lations were seeded as high-density monolayers for experimental

studies. (E) Phase contrast images from MDC (left) and ADC (right)

cultures (scale bar¼ 200mm). MDCs display a fibroblast-like mor-

phology, whereas ADCs remain relatively rounded.

1334 PORTER ET AL.

MATERIALS AND METHODS

Chondrocyte isolation and parallel culture

Equine ACs were isolated by enzymatic digestion of full-

thickness cartilage from the stifle joints of 3- and 4-year-old

mares, based on an established protocol.44 Diced explants

were digested overnight at 378C in 10 mg/mL collagenase D

(Roche Diagnostics, Indianapolis, IN) with 5 mg/mL dextrose,

1 mg/mL bovine serum albumin (BSA), 60 mM sorbitol,

25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

(HEPES), 30 mM n-p-tosyl-L-lysine-chloromethyl ketone,

70 mM sodium chloride (NaCl), 30 mM potassium chloride

(KCl), 3 mM potassium hydrogen phosphate (K2HPO4),

1 mM calcium chloride (CaCl2), 10 mM sodium bicarbonate

(NaHCO3) (all from Sigma, St. Louis, MO), and 1% antibi-

otics stock (10,000 IU/mL penicillin, 10,000mg/mL strepto-

mycin; MediaTech, Herndon, VA), at pH 7.4. After removing

undigested fragments by filtration through a sterile gauze,

ACs were collected by centrifugation. Viable cells (>95%

by Trypan Blue exclusion) were seeded at 2�104 cells/cm2

and grown at subconfluence for 1 week in 75-cm2 culture

flasks (Corning, Corning, NY) with ‘‘complete medium’’

consisting of RPMI-1640 (MediaTech) supplemented with

10% fetal bovine serum (FBS) (Hyclone, Logan, UT) and 1%

antibiotics stock. Chondrocytes were lifted using 0.05%

trypsin, 0.53 mM ethylenediaminetetraacetic acid (EDTA)

(MediaTech), subcultured in 100-mm dishes (Corning) at

subconfluence (i.e., within 2–10�104 cells/cm2), and cryo-

preserved in complete medium with 10% dimethyl sulfoxide.

For parallel culture studies, AC stocks (passage 2) were

expanded to sufficient numbers by two additional passages

in 100-mm dishes and either encapsulated in alginate beads

or maintained in monolayer culture (Fig. 1). Alginate bead

culture was conducted as previously described,8 with minor

modification. Briefly, trypsinized cells were suspended to

4�106 cells/mL in a 1.2% solution of sodium alginate (65–

75% L-guluronic acid, 25–35% D-mannuronic acid; pro-

vided by FMC BioPolymer, Philadelphia, PA) in 150 mM

NaCl and dispersed drop-wise through a 21-gauge needle

into a well-mixed bath of 102 mM CaCl2. Drops gelled

instantly upon contact with the calcium solution, and the

resulting beads (* 1�105 cells/bead) were cross-linked for

an additional 10 min without mixing. After rinsing twice

with 150 mM NaCl solution and once with complete me-

dium, beads were transferred to 24-well plates (10 beads/

1 mL complete medium) and cultured for 10 days. For

monolayer culture, trypsinized chondrocytes were seeded

in 100-mm dishes at low density (* 3�103 cells/cm2) to

allow subconfluent growth over 10 days.

After 10 days, with change of media every third or fourth

day, the beads were dissociated in 55 mM sodium citrate

and 150 mM NaCl (pH 6.8) for 15 min at 378C, and

chondrocytes were collected at 280 g for 10 min. Cells from

monolayer cultures were collected by trypsin digestion.

ADCs and MDCs were transferred to multiwell plates at

high density (* 1.3�105 viable cells/cm2) for comparable

treatment and analysis. After a 48-h acclimation period in

complete medium, cultures were stimulated for 48 h with

0, 1, or 10 ng/mL recombinant equine IL-1b36 or 50 ng/mL

recombinant human IGF-I (PeproTech, Rocky Hill, NJ) in

‘‘low-serum’’ media (RPMI-1640 with 0.2% FBS and 1%

antibiotics) and assayed as described below.

Radiolabeled ligand binding

IGF-I was radioiodinated by a chloramine-T method and

used in ligand binding experiments as previously de-

scribed.23,45 Briefly, cell monolayers were rinsed once with

phosphate-buffered saline (PBS), and sterile binding buffer

(0.5% BSA, 10 mM dextrose, 25 mM HEPES, 15 mM so-

dium acetate, 1.2 mM Na2SO4.7H2O, 5 mM KCl, 120 mM

NaCl, pH 7.4) was added to each well. To a portion of the

wells, blocking factors, either IGF-I or Y60L-IGF-I (Up-

state, Charlottesville, VA), were added (2 mg/mL) at 48Cfor 15 min, prior to addition of [125I]-IGF-I (2 ng/mL).

After overnight incubation at 48C, cells were rinsed thrice

with ice-cold binding buffer, lysed in 1 N sodium hydroxide

(NaOH) for 1 h, and analyzed for [125I] emissions using a

COBRA II Auto-Gamma counter (Packard, Downers Grove,

IL). Readings were corrected for background, converted to

ng of bound ligand based on counts from radiolabeled stock,

and normalized by cell counts from adjacent wells.

Western blot

Cell monolayers were lysed in 1�Laemmli buffer (Bio-

Rad, Hercules, CA), and protein concentrations were deter-

mined using a RC/DC assay kit (Bio-Rad). Lysate samples

(30 mg/lane) were resolved by sodium dodecyl sulphate-

polyacrylamide gel electrophoresis (SDS-PAGE), and IGF-

IR levels were detected by immunoblotting using a rabbit

antibody against IGF-IR b-subunit (Santa Cruz Biotechnol-

ogy, Santa Cruz, CA), as previously described.23 To exam-

ine IGF-IR phosphorylation, treated cultures were rinsed with

PBS and stimulated with a ‘‘pulse’’ of IGF-I (200 ng/mL

in low-serum media) for 10 min prior to collection of cell

lysate. Phosphorylated IGF-IR levels were detected using a

rabbit antibody specific for phosphorylated IGF-IR (Cell

Signaling Techology, Beverly, MA).23 Blots were then

stripped in Tris-buffered saline Tween-20 (TBS-T; 10 mM

Tris-HCl, 150 mM NaCl, 0.5 mg/mL sodium azide, pH

7.4 with 0.1% Tween-20) containing 10% SDS and b-

mercaptoethanol (Sigma) at 508C for 30 min, rinsed five

times with TBS-T, and probed for total IGF-IR.

Ligand blot

Detection of IGFBPs by Western Ligand blot analysis

was performed as described previously.23,46 Conditioned

media (CM) samples were concentrated 10-fold under vac-

uum and diluted (1:2) in loading buffer (125 mM Tris, 4%

CULTURE STRATEGY IMPACTS IGF-I SYSTEM 1335

SDS, 20% glycerol, bromophenol blue, pH 6.8). Samples

and protein standards were resolved overnight on a 10%

polyacrylamide gel and transferred to nitrocellulose mem-

branes. The membranes were rinsed sequentially in TBSþ3% Nonidet P-40 for 30 min, TBSþ 1% BSA for 2 h, and

TBS-T for 10 min. Blots were incubated overnight at 48Cwith [125I]-IGF-I (* 9�104 cpm/mL in TBS-T with 5%

BSA). The following day, blots were rinsed twice with

TBS-T, rinsed thrice with TBS, and exposed to X-ray film

at� 808C for 3–7 days. Band sizes were identified ac-

cording to protein standards. IGFBP-2 and IGFBP-5 iden-

tities were confirmed by immunoblotting using rabbit

antibovine immunoglobulins (IgGs) (Upstate).

Radioimmunoassay

IGF-I concentrations in CM were measured by radio-

immunoassay, as previously described.23,47 CM samples

were concentrated to pellets under vacuum, resuspended

in extraction buffer (87.5% ethanol, 12.5% 2 N HCl), and

centrifuged at 13,200 g to remove IGFBPs. The supernatant

was pH-neutralized with 0.855 M Tris, chilled at� 208C for

1 h, and centrifuged at 1800 g for 30 min at 48C. The re-

sulting supernatant was concentrated under vacuum and

reconstituted in IGF-I assay buffer (30 mM sodium phos-

phate (Na3PO4), 10 mM EDTA, 0.02% protamine sulfate,

0.05% Tween-20, pH 8.0). Sample aliquots and standards

(0.05–6.5 ng bovine IGF-I; GroPrep, Adelaide, Australia)

were diluted to 0.5 mL in IGF-I assay buffer. After adding

100 mL mouse antihuman IGF-I (1:70,000 dilution; a gift

from Dr. Bernard Laarveld, University of Saskatchewan),

100 mL [125I]-IGF-I stock (* 30,000 cpm) was added and the

tubes were incubated at 48C for 24 h. Goat antimouse sec-

ondary antibody (Sigma) was then added (1:20 dilution) and

the tubes incubated for an additional 72 h at 48C. Samples

and standards were diluted in double-distilled PBS and

centrifuged at 1500 g for 30 min at 48C. The supernatant was

decanted and the resulting pellets analyzed using the gamma

counter.

Northern blot

RNA was isolated from cells using an SV Total RNA

Isolation kit (Promega, Madison, WI) and, following DNase-I

treatment to remove genomic DNA, RNA yields were de-

termined by absorbance at 260 nm. Messenger RNA (mRNA)

expression was analyzed as previously described,23,47 using

0.7 kb ovine IGF-I, 0.69 kb ovine IGFBP-2, and 0.59 kb

equine IGF-IR cDNA probes, all randomly labeled with

[a-32P]-deoxyadenosine triphosphate (dATP) using a Prime-

a-Gene kit (Promega). Following each probe hybridization,

blots were stripped by rinsing twice with preboiled 0.1�saline–sodium citrate (SSC) containing 0.1% SDS and re-

hybridized as needed. Band intensities were quantified by

densitometry and normalized by corresponding 18S rRNA

bands from gel images.

Reverse transcription-polymerase

chain reaction (RT-PCR)

One-mg aliquots of RNA were reverse transcribed using

a Superscript II First-Strand Synthesis kit (Invitrogen,

Carlsbad, CA), following instructions for oligo(dT)-primed

synthesis. The resulting cDNAs were used for PCR with

reagents from a Taq PCR Master Mix kit (Qiagen, Valen-

cia, CA). Primer pairs specific for equine type I procolla-

gen (alpha 1 chain; COL1a1), type II procollagen (COL2),

and glyceraldehyde-3-phosphate dehydrogenase (GADPH)

cDNAs (Table 1) were formulated using Lasergene soft-

ware (DNASTAR, Madison, WI). The sequences and ap-

plied annealing temperature (Tann) for each primer pair are

listed in Table 1. Templates were amplified over 30 thermal

cycles using the following protocol: cycle 1¼ 948C for

2 min, Tann for 1 min, 728C for 2 min; cycles 2–29¼ 948Cfor 1 min, Tann for 1 min, 728C for 1 min; cycle 30¼ 948Cfor 1 min, Tann for 1 min, 728C for 10 min. PCR products

were resolved on 2% agarose gels, stained in 1 mM ethidium

bromide, and photographed. Band intensities were quanti-

fied by densitometry and normalized to GADPH signal.

Statistics

Figure bars represent the mean� standard error of the

mean (SEM) for triplicate samples from a single experiment.

Experiments were repeated at least three times, and repre-

sentative data sets are shown. Differences between treat-

ment means were identified by two-tailed Student’s t-test,

with p values less than 0.05 considered significant.

TABLE 1. PRIMER PAIRS FOR RT-PCR

Target Primer

Sequence

(50–30)Annealing

temp (8C)

Size

(bp)

Genbank

no.

COL1a1 Sense

Antisense

CCCCACCCCAGCCGCAAAGA

GGGGGCCAGGGAGACCACGAG

55.0 617 AF034691

COL2 Sense

Antisense

GAAGAGCGGAGACTACTGGATTGA

AGGCGCGAGGTCTTCTGTGA

58.7 501 U62528

GAPDH Sense

Antisense

AGGGTGGAGCCAAAAGGGTCATCA

GCTTTCTCCAGGCGGCAGGTCAG

61.5 418 AF157626

1336 PORTER ET AL.

RESULTS

Disparate basal levels and IL-1b regulation

of IGF-IR

Chondrocytes respond to IGF-I in the extracellular envi-

ronment via binding of the growth factor to IGF-IR, which in

turn initiates a signaling cascade.48 Binding experiments with

radioiodinated IGF-I were utilized to measure differences in

surface receptor levels between chondrocytes recovered from

alginate beads (ADCs) versus those maintained on TCP

(MDCs). As shown in Figure 2A, there was no clear differ-

ence in [125I]-IGF-I binding between ADC and MDC cultures

at basal conditions. However, these populations responded

differently to exogenous IL-1b and IGF-I. Neither treatment

significantly affected [125I]-IGF-I binding to ADCs, whereas

binding levels on MDCs decreased by about half in response

to either factor. Nonspecific binding of [125I]-IGF-I was

negligible, as determined by incubation in the presence of

excess unlabeled IGF-I (data not shown).

Although secreted as soluble factors, IGFBPs can associ-

ate with the cell surface and function as peripheral binding

elements.48 To help determine the contribution of non-IGF-

IR sites to the overall binding, cultures were incubated in

the presence of [125I]-Y60L-IGF-I. Relative to native IGF-I,

the structural analog Y60L-IGF-I has minimal affinity for

IGF-IR but similar affinity for IGFBPs49 and will preferen-

tially bind to the latter.50 Western Ligand blot experi-

ments confirmed that equine IGFBPs had similar affinity for

[125I]-Y60L-IGF-I and [125I]-IGF-I (data not shown). Incu-

bation with [125I]-Y60L-IGF-I yielded trends similar to that

of [125I]-IGF-I (Fig. 2B), suggesting that IGFBPs repres-

ent a substantial portion of surface binding elements. At

basal conditions, however, binding levels in MDC culture

were*30% lower than for ADCs, indicating that non-

IGFBP sites (e.g., IGF-IR) contribute significantly to overall

IGF-I binding.

To directly detect IGF-IR binding, cells were preincubated

with an excess of unlabeled Y60L-IGF-I, thereby selectively

inhibiting radiolabeled IGF-I binding to surface IGFBPs.50

In the presence of excess Y60L-IGF-I, basal [125I]-IGF-I

binding levels were approximately 2-fold higher on MDCs

than on ADCs ( p< 0.001) (Fig. 2C). Exogenous IL-1bregulated receptor-binding levels, but the response varied

between cell populations: the cytokine decreased Y60L-

blocked binding on MDCs ( p< 0.01) but increased binding

on ADC monolayers ( p< 0.01). We noted that approxi-

mately 90% (ADCs) and 75% (MDCs) of IGF-I binding

sites were blocked by addition of unlabeled Y60L-IGF-I

(Fig. 2C vs. 2A), further suggesting that IGFBPs have a

substantial cell-associated presence under both culture con-

ditions. Western blot analysis of IGF-IR (b-subunit) sup-

ported binding-study results (Fig. 2D). Basal levels of IGF-

IRb in MDC lysate were approximately double that of ADCs,

and IL-1b treatment reduced MDC levels while enhanc-

ing ADC levels. As expected, addition of exogenous IGF-I

(50 ng/mL) down-regulated IGF-IR in both cultures, par-

ticularly for MDCs.51 To determine whether IL-1 effects

translated to altered signaling capacity (i.e., IGF-IR phos-

phorylation), cultures were stimulated with a pulse of IGF-I

(200 ng/mL) for 10 min following removal of CM. Phos-

phorylated IGF-IR levels in response to IGF-I mirrored total

receptor trends for both cell populations (Fig. 2E).

Elevated IGFBP-2 secretion in MDC-CM

As only a portion of the binding proteins within the

culture system would be expected to specifically interact

with the cell surface and ECM, IGFBP levels in CM were

measured by Western Ligand blot analysis (Fig. 3A). Sol-

uble IGFBPs can sequester the unbound growth factor and

determine its availability for receptor binding and signal

transduction.48 Both ADC and MDC media principally

contained doublet bands in the range of 32–34 kDa, which

were confirmed to be alternative glycosylation forms of

IGFBP-2 by Western blot (Fig. 3B). IGFBP-2 levels were

substantially higher in the MDC cultures (nearly 7-fold at

basal conditions). IL-1b treatment suppressed IGFBP-2

levels by approximately 50% and 60% for ADCs and

MDCs, respectively, whereas enhancement by IGF-I was

more pronounced in ADC culture (nearly 5-fold relative to

control). IGF-I treatment also intensified a 28–30 kDa band

doublet identified as IGFBP-5 by Western blot (data not

shown). Faint bands around 38–40 kDa were observed in

longer film exposures, likely corresponding to IGFBP-3

(data not shown). Although ADCs and MDCs expressed the

same predominant IGFBP and displayed similar responses

to exogenous factors, the marked difference in basal

IGFBP-2 levels suggest that extracellular regulation of

IGF-IR binding could be quite distinct between the cell

populations.

IGF-I levels parallel trends for IGFBP-2

IGF-I concentrations in cartilage represent the sum of

endocrine contributions (via synovial fluid) and autocrine/

paracrine production by chondrocytes. IGFBPs can extend

IGF-I half-life in the cartilage matrix by blocking its proteol-

ysis and inhibiting cell uptake via IGF-IR. Consequently, we

hypothesized that elevated binding protein concentrations in

MDC culture could result in higher IGF-I levels relative to

ADCs. To assess whether IGFBP trends impact endogenous

IGF-I concentrations, CM was assayed for total IGF-I (both

unbound and IGFBP-bound fractions) by radioimmunoassay

(Fig. 3C). At basal conditions, MDC media contained 12.1�0.9 ng/mL IGF-I compared to 3.2� 0.1 ng/mL in ADC cul-

tures, a nearly 4-fold difference ( p< 0.001). Exogenous IL-

1b significantly decreased IGF-I levels in MDC culture to

7.2� 0.4 and 8.0� 0.2 ng/mL following stimulation with 1

and 10 ng/mL, respectively. IGF-I reduction in ADC culture

was also significant at 10 ng/mL IL-1b (2.3� 0.1, p< 0.01).

Growth factor concentrations remained substantially higher

CULTURE STRATEGY IMPACTS IGF-I SYSTEM 1337

750ADCs

MDCs

600

450

300

150

450

300

150

450

300

50

00 1 10

IL-1β (ng/mL)

IGF

[125I]

-IG

F-I

Bo

un

d(n

g/c

ell

x 1

09)

[125I]

-Y6

0L

-IG

F-I

Bo

un

d(n

g/c

ell

x 1

09)

[125I]

-IG

F-I

Bo

un

d(n

g/c

ell

x 1

09)

A

B

C

0

IGF-IR

IL-1β (ng/mL)D

IL-1β (ng/mL)

1 10 100 1IGF IGF

ADCs MDCs

IL-1β (ng/mL)

IGF-I "pulse":

0 1 10

ADCs

MDCs

P-IGF-IR

E

FIG. 2. IGF-I binding levels on ADCs and MDCs. (A) [125I]-IGF-I or (B) [125I]-Y60L-IGF-I bound to ADC (open) and MDC (filled)

cultures in the absence of any blocking factors, normalized by cell density and presented as a function of treatment. ‘‘IGF’’ denotes cells

treated with 50 ng/mL IGF-I. Bars represent the mean� SEM for 3 wells per treatment, @ denotes statistically significant differences

compared to no-treatment control ( p< 0.05 by unpaired Student’s t-test), and horizontal bars represent significant differences between

ADC and MDC cultures at a particular treatment. (C) [125I]-IGF-I bound to ADC (open) and MDC (filled) cultures in the presence

of excess unlabeled Y60L-IGF-I (2 mg/mL). * (ADCs) denotes statistically significant differences compared to no-treatment control.

(D) Cell lysate samples (30mg) were resolved by SDS-PAGE and probed for the IGF-IR b-subunit (90 kDa). (E) ADC (top) and MDC

(bottom) lysate samples were probed for phosphorylated IGF-IR. ‘‘þ ’’ indicates treatment with 200 ng/mL IGF-I for 10 min prior to

sample collection (post IL-1b treatment), while ‘‘� ’’ indicates no IGF-I administration. Results are representative of at least three

independent studies.

1338 PORTER ET AL.

in MDC culture regardless of treatment (p< 0.001 for all).

As postulated, IGF-I concentration trends paralleled those for

IGFBP-2, suggesting that the binding protein may extend

IGF-I half-life in these cultures.

Transcription rates reflect differential

IGF-I mediator levels

Clear differences in basal levels of IGF-IR, IGFBP, and

IGF-I (Figs. 2, 3) and varied cell response to IL-1b (Fig. 2)

indicate significant modification to one or both of these sig-

naling systems during alginate bead culture. To examine the

contribution of transcription to protein secretion described

above, IGF-IR, IGFBP-2, and IGF-I mRNAs were evalu-

ated by Northern blot analysis (Fig. 4A). At the message

level, MDC cultures displayed twice as much IGF-IR tran-

script as ADCs, as expected based on protein analysis (Fig.

2). Whereas the IL-1b effect on IGF-IR message appeared

biphasic for ADCs, peaking at 1 ng/mL, the cytokine dose-

dependently suppressed mRNA levels in MDC culture (Fig.

4B). Exogenous IGF-I down-regulated IGF-IR message for

both culture pathways.

Regarding IGFBP-2, basal expression was significantly

higher for MDCs (nearly 9-fold than for ADCs), mirroring

the disparate secretion observed in CM (Fig. 3). IL-1b did

not affect IGFBP-2 transcript in MDCs although decreased

expression (*70% of control) was observed with 10 ng/

mL, but not with 1 ng/mL IL-1b, for ADCs. IGF-I enhanced

IGFBP-2 message for ADC cultures (*60%) but had only

a nominal effect on message from MDC cultures. The two

cell populations also differed with respect to endogenous

IGF-I expression. Basal transcript was detectable only from

ADC lysate and not from MDC lysate. IGF-I message de-

creased in response to IL-1b for ADCs but increased sig-

nificantly for MDCs. These data indicate that many of the

effects observed on the IGF-I system are attributable to

transcriptional regulation, though additional mechanisms

must be considered to account for IL-1b effects.23

Cell populations vary in phenotypic

response to IGF-I and IL-1

Alginate bead culture has been shown to restore the

chondrocytic phenotype of ACs grown for multiple passages

on TCP in vitro,12–16 but we sought to determine if the

culture pathway would alter phenotypic responses to IGF-I

and IL-1. To assay downstream differences between chon-

drocytes suspended in alginate and those grown continu-

ously on TCP, we examined cell growth and collagen

synthesis in response to our selected exogenous factors. As

shown in Figure 5A, MDC numbers increased by approxi-

mately 30% following treatment with IL-1b or IGF-I

( p< 0.01), whereas ADC numbers were not altered signif-

icantly by either factor. These results agree with previous

work demonstrating cell proliferation in response to IL-1 for

human ACs subcultured on TCP but not for primary cells, 52

suggesting both dedifferentiation of equine MDCs and,

possibly, partial redifferentiation of equine ADCs. More

importantly, the difference in response to IGF-I with regard

to cell proliferation also implies that changes measured in

the IGF-I system do alter downstream responses.

IL-1β (ng/mL) IL-1β (ng/mL)

0 1 10 IGF 0 1 10 IGF

ADCs

37 kDa

25 kDa

IGFBP-2(overexposed)

MDCs

A

B

15

12

9

6

3

00 1 10

IGF

-I C

on

ce

ntr

atio

n (

ng

/mL

)

ADCs

MDCs

C

IL-1β (ng/mL)

FIG. 3. Ligand blot analysis of IGFBPs in cell-conditioned media.

(A) Media samples were concentrated, resolved by SDS-PAGE, and

probed for binding proteins using [125I]-IGF-I as described in Mate-

rials and Methods. ‘‘IGF’’ denotes cells treated with 50 ng/mL IGF-I.

(B) Western blot analysis for IGFBP-2 confirmed the identity of the

32–34 kDa doublet from (A). Although MDC bands are saturated

due to film overexposure, this blot demonstrates the effect of IL-1bon ADC cultures. (C) IGF-I concentrations in cell-conditioned me-

dia. Media samples were concentrated, binding proteins were ex-

tracted, and total IGF-I (unbound plus IGFBP-sequestered) was

detected by radioimmunoassay. * (ADCs) or @ (MDCs) denote a

statistically significant difference compared to no-treatment control

( p< 0.05 by unpaired Student’s t-test), whereas horizontal bars re-

present significant differences between ADC and MDC cultures at a

particular treatment. All results are representative of three inde-

pendent experiments.

CULTURE STRATEGY IMPACTS IGF-I SYSTEM 1339

RT-PCR analysis revealed that untreated ADCs and

MDCs expressed type I (COL1a1) and type II (COL2)

collagen mRNAs (Fig. 5B), which are molecular markers

of fibroblastic and chondrocytic phenotypes, respectively.4

ADCs consistently demonstrated higher basal levels of

COL2 (about 3-fold over MDC levels), in agreement with

earlier work,12,13,15,16 but no consistent difference in basal

COL1a1 was observed between ADCs and MDCs over three

independent experiments. IGF-I treatment strongly dimin-

ished collagen I expression for ADCs and nearly tripled the

0 1 10 IGF 0 1 10 IGF

IL-1β (ng/mL)

IL-1β (ng/mL)

IL-1β (ng/mL)

ADCs MDCs

IGR-IR

IGFBP-2

IGF-1

18S rRNA(gel)

A

0

B

0.0

0.2

0.4

0.6

0.8

1.0

1.2

2

4

6

8

10

0.5

1.0

1.5

2.0

2.5

3.0

3.5

IGF

-IR

:18

S r

RN

A(R

ela

tive

to

AD

C C

on

tro

l)IG

F-I

:18

S r

RN

A(R

ela

tive

to

AD

C C

on

tro

l)IG

FB

P-2

:18

S r

RN

A(R

ela

tive

to

AD

C C

on

tro

l)

1 10 IGF

ADCs

MDCs

FIG. 4. Northern blot analysis of IGF-I system transcripts. Total

RNA isolates were resolved on a formaldehyde-agarose gel, trans-

ferred and cross-linked onto a membrane, and probed for various

mRNAs of the IGF-I system using radiolabeled cDNA probes. (A)

Bands for IGF-IR, IGFBP-2, and IGF-I messages were detected by

autoradiography and are presented alongside the gel image for 18S

rRNA bands. ‘‘IGF’’ denotes cells treated with 50 ng/mL IGF-I.

(B) Band intensities from (A) were measured by densitometry and

normalized to corresponding 18S rRNA intensities. Optical density

ratios for ADCs (&) and MDCs (~) are presented relative to ADC

controls (0 ng/mL). The results are representative of three inde-

pendent studies.

0

2.0A

1.5

1.0

0.5

0.0

Cell

Density

(Rela

tive to C

ontr

ol)

ADCs

MDCs

1 10 IGF

ADCs

0 1 10 IGF 0 1 10 IGF

COL2

COL1a1

GAPDH

B

MDCs

IL-1β (ng/mL)

IL-1β (ng/mL) IL-1β (ng/mL)

FIG. 5. Phenotypic differences between ADCs and MDCs. (A)

Cell density as a function of IL-1b concentration. ADCs (open)

or MDCs (filled) were cultured in well plates and treated with

0–10 ng/mL IL-1b or 50 ng/mL IGF-I (‘‘IGF’’) for 48 h. Cell den-

sities are presented relative to respective culture system controls

(0 ng/mL). Bars represent the mean� SEM for 3 wells per treat-

ment. @ denotes a statistically significant difference compared to

no-treatment control ( p< 0.05 by unpaired Student’s t-test). (B)

RT-PCR analysis of collagen synthesis. Total RNA isolates col-

lected after IL-1/IGF-I treatment were reverse transcribed and the

resulting cDNA probed for collagen II (COL2), collagen I alpha1

(COL1a1), and GAPDH messengers by PCR using specific primer

pairs (Table 1). All results are representative of three independent

experiments.

1340 PORTER ET AL.

levels in MDC culture, again illustrating downstream effects

of IGF-I system differences. Exogenous IL-1b suppressed

COL2 dose-dependently for both cell populations, as shown

previously with human53 and equine39 ACs in monolayer

culture. However, the impact of IL-1b on COL1a1 expres-

sion varied markedly between the culture protocols: while

10 ng/mL of IL-1b suppressed COL1a1 mRNA to nearly

undetectable levels in ADC culture, the same concentration

approximately tripled the band intensity for MDCs. Colla-

gen protein levels were also examined; however, substantial

levels were not detectable during the 48-h test period (data

not shown), and extended treatment on TCP would likely

mask differences between ADCs and MDCs. Taken to-

gether, these experiments indicate that alginate culture al-

tered phenotypic responses of ACs to both IL-1b and IGF-I.

Coupled with reports of enhanced chondrocytic response to

IL-1b13,20 and bone morphogenetic protein-215 after redif-

ferentiation in alginate, our results suggest that the chon-

drogenic action of this biomaterial may be associated with

restoration of hormonal signaling.

DISCUSSION

The primary objective of this work was to determine

whether chondrocyte culture protocol impacts the IGF-I

receptor/binding protein system. The IGF-I network is

known to play a key role in maintaining cartilage metabolic

homeostasis,30–32 and its dysfunction is thought to con-

tribute to cartilage deterioration within osteoarthritic

joints.41–43 Changes in network component synthesis fol-

lowing chondrocyte culture in vitro would likely shape the

ability of these cells to adequately repair cartilage defects

in vivo. Nevertheless, previous evaluations of chondrocyte

culture strategies have not addressed the IGF-I system. In

this study, intermediate alginate suspension altered basal

synthesis of IGF-I mediators relative to continuous mono-

layer culture, suppressing both receptor density (Figs. 2CE)

and IGFBP-2 secretion (Fig. 3). These effects were attrib-

uted to disparate mRNA expression between ADCs and

MDCs (Fig. 4). Endogenous IGF-I concentration was also

higher in MDC culture (Fig. 3), despite the fact that ADCs

transcribed more IGF-I messages at basal conditions (Fig.

4). Notably, radioimmunoassay experiments measured total

IGF-I and did not distinguish between unbound and

IGFBP-bound ligand. Collectively, the results confirm that

culture strategy can alter the autocrine/paracrine IGF-I

system in vitro, advocating future studies of signaling dy-

namics in vivo following implantation of tissue-engineered

constructs.

Receptor levels were reduced to a lesser extent than for

IGFBP-2 by intermediate alginate culture, so that the over-

all proportion of surface receptors to extracellular IGFBPs

increased nearly 4-fold. This proportionality could impact

chondrocyte responsiveness to IGF-I, as IGFBPs can atten-

uate IGF-I signal transduction by competing with IGF-IR

for unbound ligand. In osteoarthritic cartilage, elevated con-

centrations of IGFBPs are hypothesized to contribute to the

IGF-I hyporesponsiveness of the tissue.54–57 Given this

inhibitory effect of IGFBPs, alginate culture may augment

chondrocyte responsiveness to IGF-I following extended

monolayer culture, enhancing matrix synthesis by ADCs.

However, IGFBPs can also potentiate IGF-I signaling, de-

pending on the particular homolog and the extracellular

environment, by preventing its proteolysis (i.e., extending

its half-life) or localizing it in the proximity of signaling

receptors on the cell surface.48 While MDCs secreted nearly

an order of magnitude more IGFBPs into the culture me-

dium (Fig. 3), [125I]-Y60L-IGF-I binding levels were lower

relative to those in ADCs at all test conditions (Fig. 2B),

suggesting higher levels of surface-sequestered IGFBPs in

ADC culture. This could be attributed to increased IGFBP

binding elements, including certain membrane receptors

(e.g., a5b1 integrin58) or cell-associated matrix remaining

after nonenzymatic bead dissociation.10 Future studies that

preclude ADC culture with a trypsin digestion step may

help determine the cause of increased surface IGFBPs. The

precise effects of IGFBP localization on IGF-I signaling

dynamics within cartilage have yet to be determined, but

cell surface and ECM association likely have important

contributions.59

In addition to basal component levels, we examined IGF-I

system regulation by IL-1b. This cytokine, which has been

reported to affect IGF-IR, IGFBP, and autocrine/paracrine

IGF-I levels in AC cultures from a number of species,23,60–62

is thought to be an important cofactor in the development of

osteoarthritic chondrocyte hyporesponsiveness to IGF-I.43

IGF-IR regulation by the cytokine was clearly influenced by

culture pathway, as IL-1 increased the receptor levels on

ADCs but decreased the levels on MDCs (Fig. 2C–E). Al-

though the reduction in MDC levels was mediated in part by

mRNA expression, the effects on ADC levels did not cor-

relate with transcription. Interestingly, IGF-I message in

ADC culture decreased dose-dependently in response to

IL-1b (Fig. 4), as did growth factor concentrations in CM

(Fig. 3), suggesting that enhanced receptor levels were a

product of reduced turnover (i.e., endocytosis, proteolysis,

and recycling) in response to ligand binding. Further study

into IL-1 effects on IGF-IR turnover would help clarify the

mechanisms of receptor regulation.

Total IGF-I concentrations were found to parallel IGFBP-

2 levels, which were reduced by IL-1b (Fig. 3), supporting

a possible role for IGFBP-2 in IGF-I signaling dynamics.

Unlike culture system effects, IGFBP-2 regulation by IL-1bcould not be explained by transcription for either cell

population (Fig. 5). In a recent study from our laboratory,23

the suppression of IGFBP-2 by IL-1b for chondrocytes

cultured in alginate beads was reversed by specific inhibi-

tors of the matrix metalloproteinase (MMP) family, whose

members are up-regulated in cartilage and AC cultures by

IL-1.35,37–39 Although IGFBP-2 levels decreased in both cul-

ture systems following IL-1 treatment, due to the marked

CULTURE STRATEGY IMPACTS IGF-I SYSTEM 1341

disparity in basal expression, levels in IL-1-treated MDC

cultures still exceeded those in untreated ADC counterparts.

Given the patterns of receptor and binding protein regula-

tion, alginate culture may enhance AC sensitivity to exog-

enous IGF-I in the presence of IL-1b. Such a function would

prove advantageous when cultivating autologous chon-

drocytes for the repair of osteoarthritic cartilage.

An increasing body of work has demonstrated the po-

tential of using culture-expanded, alginate-redifferentiated

chondrocytes for the development of scaffold-free cartilag-

inous implants from a relatively small biopsy of autologous

cells.24,25,28,29 Recently, Stoddart et al.29 have shown that

ex vivo implant formation using such ‘‘alginate-recovered’’

chondrocytes (ARCs) can be enhanced by exogenous IGF-I

administration. However, chondrocytes that were not sub-

jected to intermediate alginate culture (i.e., ‘‘alginate-ex-

cluded’’ chondrocytes) did not produce a structurally viable

tissue, even in the presence of IGF-I. The authors proposed

that IGF-I increased the size of cell-associated matrix sur-

rounding ARCs, which is thought to be critical for the me-

chanical and biochemical integrity of the eventual implant.

It is also possible, based on our work, that the IGF-I signaling

dynamics of alginate-excluded chondrocytes had been al-

tered such that those cells would not respond to the growth

factor, even when placed in aggregate culture associated

with the ARC method. Future studies using the ARC model

could help determine the importance of IGF-I signaling for

cartilage tissue engineering.

The present findings apply not only to tissue engineer-

ing strategies for cartilage repair but also to in vitro models

for studying chondrocyte biology. Two well-characterized

substrates were selected for use in our culture models: TCP

(2-D) and a calcium-alginate hydrogel (3-D). Both have

their advantages and disadvantages for use in studies of

drug/growth factor delivery and extracellular signaling, as

discussed previously.63 The simpler 2-D culture on TCP al-

lows for a uniform cell distribution and more direct detection

of surface receptors and secreted proteins, but can result in

dedifferentiation.4–6 Alginate hydrogels, on the other hand,

provide a 3-D matrix with a net negative charge that more

closely resembles the glycosaminoglycan (GAG)-rich en-

vironment found in vivo. While this environment yields cells

with a spherical morphology and a dense ECM, which, with

time, can become similar to that found in cartilage,9–11 it can

also complicate detection of secreted proteins and analysis

of ligand-receptor signaling dynamics. In the current study,

ADCs and MDCs were formed into high-density monolayers

after parallel alginate/TCP culture for comparable detection

of IGF-I signaling mediators. However, in an effort to

minimize cell manipulation, ADCs were not subjected to a

trypsin digestion step as were MDCs. The resulting differ-

ence in cell-associated matrix levels could have affected

IGF-I/Y60L-IGF-I binding dynamics, as discussed above.

Our results emphasize the importance of carefully weighing

the pros and cons of available culture models to best suit the

experimental focus. Moreover, they demonstrate the need

for advanced techniques that provide real-time, in situ mo-

lecular detection and eliminate the need for simple 2-D

models.

In summary, chondrocyte suspension in alginate not only

recovers synthesis of cartilage matrix components follow-

ing extensive monolayer culture but also alters basal levels

of IGF-I signaling mediators and their response to IL-1b.

The ultimate impact of these effects on cell signaling dy-

namics and cartilage regeneration capacity is still to be

determined in vivo. However, this study demonstrates the

influence of culture strategy on hormonal signaling networks.

Phenotypic markers alone cannot consistently predict the

ability of culture-expanded chondrocytes to synthesize

functionally viable cartilage in vivo.64 Additional consid-

eration of hormonal mediators may improve the evaluation

of culture protocols for cartilage regeneration.

ACKNOWLEDGMENTS

Recombinant equine IL-1b and primers for RT-PCR

were developed by Dr. Vivian Takafuji as part of her dis-

sertation work. Our sincere thanks goes to Patricia Boyle

for assisting with radioimmunoassay and Northern blot pro-

tocols and Theresa Cassino for helping with chondrocyte

isolation and culture. This work was supported by a grant

from the National Institutes of Health (AR046414).

REFERENCES

1. Brittberg, M., Lindahl, A., Nilsson, A., Ohlsson, C., Isaksson,

O., and Peterson, L. Treatment of deep cartilage defects in the

knee with autologous chondrocyte transplantation. N Engl J

Med 331, 889, 1994.

2. Peterson, L., Minas, T., Brittberg, M., Nilsson, A., Sjogren-

Jansson, E., and Lindahl, A. Two- to 9-year outcome after

autologous chondrocyte transplantation of the knee. Clin

Orthop Relat Res 374, 212, 2000.

3. Litzke, L.E., Wagner, E., Baumgaertner, W., Hetzel, U.,

Josimovic-Alasevic, O., and Libera, J. Repair of extensive

articular cartilage defects in horses by autologous chondrocyte

transplantation. Ann Biomed Eng 32, 57, 2004.

4. von der Mark, K., and von der Mark, H. Immunological and

biochemical studies of collagen type transition during in vitro

chrondrogenesis of chick limb mesodermal cells. J Cell Biol

73, 736, 1977.

5. Benya, P.D., Padilla, S.R., and Nimni, M.E. Independent

regulation of collagen types by chondrocytes during the loss

of differentiated function in culture. Cell 15, 1313, 1978.

6. Benya, P.D., and Shaffer, J.D. Dedifferentiated chondrocytes

reexpress the differentiated collagen phenotype when cultured

in agarose gels. Cell 30, 215, 1982.

7. Guo, J.F., Jourdian, G.W., and MacCallum, D.K. Culture and

growth characteristics of chondrocytes encapsulated in algi-

nate beads. Connect Tissue Res 19, 277, 1989.

1342 PORTER ET AL.

8. Hauselmann, H.J., Aydelotte, M.B., Schumacher, B.L.,

Kuettner, K.E., Gitelis, S.H., and Thonar, E.J. Synthesis and

turnover of proteoglycans by human and bovine adult artic-

ular chondrocytes cultured in alginate beads. Matrix 12, 116,

1992.

9. Hauselmann, H.J., Fernandes, R.J., Mok, S.S., Schmid, T.M.,

Block, J.A., Aydelotte, M.B., Kuettner, K.E., and Thonar, E.J.

Phenotypic stability of bovine articular chondrocytes after

long-term culture in alginate beads. J Cell Sci 107 (Pt 1), 17,

1994.

10. Mok, S.S., Masuda, K., Hauselmann, H.J., Aydelotte, M.B.,

and Thonar, E.J. Aggrecan synthesized by mature bovine

chondrocytes suspended in alginate. Identification of two dis-

tinct metabolic matrix pools. J Biol Chem 269, 33021, 1994.

11. Petit, B., Masuda, K., D’souza, A.L., Otten, L., Pietryla, D.,

Hartmann, D.J., Morris, N.P., Uebelhart, D., Schmid, T.M.,

and Thonar, E.J. Characterization of crosslinked collagens

synthesized by mature articular chondrocytes cultured in al-

ginate beads: comparison of two distinct matrix compart-

ments. Exp Cell Res 225, 151, 1996.

12. Bonaventure, J., Kadhom, N., Cohen-Solal, L., Ng, K.H.,

Bourguignon, J., Lasselin, C., and Freisinger, P. Reexpression

of cartilage-specific genes by dedifferentiated human articular

chondrocytes cultured in alginate beads. Exp Cell Res 212,

97, 1994.

13. Lemare, F., Steimberg, N., Le Griel, C., Demignot, S., and

Adolphe, M. Dedifferentiated chondrocytes cultured in algi-

nate beads: restoration of the differentiated phenotype and of

the metabolic responses to interleukin-1beta. J Cell Physiol

176, 303, 1998.

14. Lee, D.A., Reisler, T., and Bader, D.L. Expansion of chon-

drocytes for tissue engineering in alginate beads enhances

chondrocytic phenotype compared to conventional monolayer

techniques. Acta Orthop Scand 74, 6, 2003.

15. Grunder, T., Gaissmaier, C., Fritz, J., Stoop, R., Hortschansky,

P., Mollenhauer, J., and Aicher, W.K. Bone morphogenetic

protein (bmp)-2 enhances the expression of type ii collagen and

aggrecan in chondrocytes embedded in alginate beads. Osteoar-

thritis Cartilage 12, 559, 2004.

16. Murphy, C.L., and Polak, J.M. Control of human articular

chondrocyte differentiation by reduced oxygen tension. J Cell

Physiol 199, 451, 2004.

17. Beekman, B., Verzijl, N., de Roos, J.A., and TeKoppele, J.M.

Matrix degradation by chondrocytes cultured in alginate: IL-1

beta induces proteoglycan degradation and proMMP synthesis

but does not result in collagen degradation. Osteoarthritis

Cartilage 6, 330, 1998.

18. van Osch, G.J., van den Berg, W.B., Hunziker, E.B., and

Hauselmann, H.J. Differential effects of igf-1 and tgf beta-2

on the assembly of proteoglycans in pericellular and territorial

matrix by cultured bovine articular chondrocytes. Osteoar-

thritis Cartilage 6, 187, 1998.

19. D’souza, A.L., Masuda, K., Otten, L.M., Nishida, Y., Knud-

son, W., and Thonar, E.J. Differential effects of interleukin-1

on hyaluronan and proteoglycan metabolism in two com-

partments of the matrix formed by articular chondro-

cytes maintained in alginate. Arch Biochem Biophys 374, 59,

2000.

20. Thomas, B., Thirion, S., Humbert, L., Tan, L., Goldring, M.B.,

Bereziat, G., and Berenbaum, F. Differentiation regulates in-

terleukin-1beta-induced cyclo-oxygenase-2 in human articular

chondrocytes: role of p38 mitogen-activated protein kinase.

Biochem J 362, 367, 2002.

21. Wang, J., Verdonk, P., Elewaut, D., Veys, E.M., and Ver-

bruggen, G. Homeostasis of the extracellular matrix of nor-

mal and osteoarthritic human articular cartilage chondrocytes

in vitro. Osteoarthritis Cartilage 11, 801, 2003.

22. Phillips, T., Ferraz, I., Bell, S., Clegg, P.D., Carter, S.D., and

Mobasheri, A. Differential regulation of the glut1 and glut3

glucose transporters by growth factors and pro-inflammatory

cytokines in equine articular chondrocytes. Vet J 169, 216,

2005.

23. Porter, R.M., Akers, R.M., Howard, R.D., and Forsten-

Williams, K. Transcriptional and proteolytic regulation of

the insulin-like growth factor-i system of equine articular

chondrocytes by recombinant equine interleukin-1beta. J Cell

Physiol 209, 542, 2006.

24. Masuda, K., Sah, R.L., Hejna, M.J., and Thonar, E.J. A novel

two-step method for the formation of tissue-engineered car-

tilage by mature bovine chondrocytes: the alginate-recovered-

chondrocyte (arc) method. J Orthop Res 21, 139, 2003.

25. Homicz, M.R., Chia, S.H., Schumacher, B.L., Masuda, K.,

Thonar, E.J., Sah, R.L., and Watson, D. Human septal chon-

drocyte redifferentiation in alginate, polyglycolic acid scaf-

fold, and monolayer culture. Laryngoscope 113, 25, 2003.

26. Mandl, E.W., van der Veen, S.W., Verhaar, J.A., and van

Osch, G.J. Multiplication of human chondrocytes with low

seeding densities accelerates cell yield without losing redif-

ferentiation capacity. Tissue Eng 10, 109, 2004.

27. Madry, H., Kaul, G., Cucchiarini, M., Stein, U., Zurakowski, D.,

Remberger, K., Menger, M.D., Kohn, D., and Trippel, S.B.

Enhanced repair of articular cartilage defects in vivo by trans-

planted chondrocytes overexpressing insulin-like growth factor i

(igf-i). Gene Ther 12, 1171, 2005.

28. Klein, T.J., Schumacher, B.L., Blewis, M.E., Schmidt, T.A.,

Voegtline, M.S., Thonar, E.J., Masuda, K., and Sah, R.L. Tai-

loring secretion of proteoglycan 4 (prg4) in tissue-engineered

cartilage. Tissue Eng 12, 1429, 2006.

29. Stoddart, M.J., Ettinger, L., and Hauselmann, H.J. Generation

of a scaffold free cartilage-like implant from a small amount

of starting material. J Cell Mol Med 10, 480, 2006.

30. McQuillan, D.J., Handley, C.J., Campbell, M.A., Bolis, S.,

Milway, V.E., and Herington, A.C. Stimulation of proteogly-

can biosynthesis by serum and insulin-like growth factor-i

in cultured bovine articular cartilage. Biochem J 240, 423,

1986.

31. Luyten, F.P., Hascall, V.C., Nissley, S.P., Morales, T.I., and

Reddi, A.H. Insulin-like growth factors maintain steady-state

metabolism of proteoglycans in bovine articular cartilage

explants. Arch Biochem Biophys 267, 416, 1988.

32. Tyler, J.A. Insulin-like growth factor 1 can decrease degrada-

tion and promote synthesis of proteoglycan in cartilage ex-

posed to cytokines. Biochem J 260, 543, 1989.

33. Tyler, J.A. Articular cartilage cultured with catabolin (pig in-

terleukin 1) synthesizes a decreased number of normal pro-

teoglycan molecules. Biochem J 227, 869, 1985.

34. Fosang, A.J., Tyler, J.A., and Hardingham, T.E. Effect of

interleukin-1 and insulin like growth factor-1 on the release of

proteoglycan components and hyaluronan from pig articular

cartilage in explant culture. Matrix 11, 17, 1991.

CULTURE STRATEGY IMPACTS IGF-I SYSTEM 1343

35. Morris, E.A., and Treadwell, B.V. Effect of interleukin 1 on

articular cartilage from young and aged horses and compari-

son with metabolism of osteoarthritic cartilage. Am J Vet Res

55, 138, 1994.

36. Takafuji, V.A., McIlwraith, C.W., and Howard, R.D. Effects

of equine recombinant interleukin-1alpha and interleukin-

1beta on proteoglycan metabolism and prostaglandin e2 syn-

thesis in equine articular cartilage explants. Am J Vet Res 63,

551, 2002.

37. Gowen, M., Wood, D.D., Ihrie, E.J., Meats, J.E., and Russell,

R.G. Stimulation by human interleukin 1 of cartilage break-

down and production of collagenase and proteoglycanase by

human chondrocytes but not by human osteoblasts in vitro.

Biochim Biophys Acta 797, 186, 1984.

38. Mort, J.S., Dodge, G.R., Roughley, P.J., Liu, J., Finch, S.J.,

DiPasquale, G., and Poole, A.R. Direct evidence for active

metalloproteinases mediating matrix degradation in interleukin

1-stimulated human articular cartilage. Matrix 13, 95, 1993.

39. Richardson, D.W., and Dodge, G.R. Effects of interleukin-

1beta and tumor necrosis factor-alpha on expression of matrix-

related genes by cultured equine articular chondrocytes. Am J

Vet Res 61, 624, 2000.

40. Goldring, S.R., and Goldring, M.B. The role of cytokines in

cartilage matrix degeneration in osteoarthritis. Clin Orthop

Relat Res 427(Suppl.), S27, 2004.

41. Schalkwijk, J., Joosten, L.A., van den Berg, W.B., and van de

Putte, L.B. Chondrocyte nonresponsiveness to insulin-like

growth factor 1 in experimental arthritis. Arthritis Rheum 32,

894, 1989.

42. Dore, S., Pelletier, J.P., DiBattista, J.A., Tardif, G., Brazeau, P.,

and Martel-Pelletier, J. Human osteoarthritic chondrocytes

possess an increased number of insulin-like growth factor 1

binding sites but are unresponsive to its stimulation. Possible

role of igf-1-binding proteins. Arthritis Rheum 37, 253,

1994.

43. Verschure, P.J., Joosten, L.A., van de Loo, F.A., and van den

Berg, W.B. Il-1 has no direct role in the igf-1 non-responsive

state during experimentally induced arthritis in mouse knee

joints. Ann Rheum Dis 54, 976, 1995.

44. Nixon, A.J., Lust, G., and Vernier-Singer, M. Isolation, prop-

agation, and cryopreservation of equine articular chondro-

cytes. Am J Vet Res 53, 2364, 1992.

45. Forsten, K.E., Akers, R.M., and San Antonio, J.D. Insulin-like

growth factor (igf ) binding protein-3 regulation of igf-i is

altered in an acidic extracellular environment. J Cell Physiol

189, 356, 2001.

46. Hossenlopp, P., Seurin, D., Segovia-Quinson, B., Hardouin, S.,

and Binoux, M. Analysis of serum insulin-like growth factor

binding proteins using western blotting: use of the method for

titration of the binding proteins and competitive binding stud-

ies. Anal Biochem 154, 138, 1986.

47. Berry, S.D., McFadden, T.B., Pearson, R.E., and Akers, R.M.

A local increase in the mammary igf-1: igfbp-3 ratio mediates

the mammogenic effects of estrogen and growth hormone.

Domest Anim Endocrinol 21, 39, 2001.

48. Le Roith, D., Bondy, C., Yakar, S., Liu, J.L., and Butler, A.

The somatomedin hypothesis: 2001. Endocr Rev 22, 53,

2001.

49. Bayne, M.L., Applebaum, J., Chicchi, G.G., Miller, R.E., and

Cascieri, M.A. The roles of tyrosines 24, 31, and 60 in the

high affinity binding of insulin-like growth factor-i to the type 1

insulin-like growth factor receptor. J Biol Chem 265, 15648,

1990.

50. Paye, J.M., and Forsten-Williams, K. Regulation of insulin-

like growth factor-i (igf-i) delivery by igf binding proteins

and receptors. Ann Biomed Eng 34, 618, 2006.

51. Watanabe, N., Rosenfeld, R.G., Hintz, R.L., Dollar, L.A., and

Smith, R.L. Characterization of a specific insulin-like growth

factor-i/somatomedin-c receptor on high density, primary mono-

layer cultures of bovine articular chondrocytes: regulation of

receptor concentration by somatomedin, insulin and growth hor-

mone. J Endocrinol 107, 275, 1985.

52. Guerne, P.A., Sublet, A., and Lotz, M. Growth factor respon-

siveness of human articular chondrocytes: distinct profiles in

primary chondrocytes, subcultured chondrocytes, and fibro-

blasts. J Cell Physiol 158, 476, 1994.

53. Goldring, M.B., Birkhead, J., Sandell, L.J., Kimura, T., and

Krane, S.M. Interleukin 1 suppresses expression of cartilage-

specific types ii and ix collagens and increases types i and iii

collagens in human chondrocytes. J Clin Invest 82, 2026, 1988.

54. Chevalier, X., and Tyler, J.A. Production of binding proteins

and role of the insulin-like growth factor i binding protein 3 in

human articular cartilage explants. Br J Rheumatol 35, 515,

1996.

55. Olney, R.C., Tsuchiya, K., Wilson, D.M., Mohtai, M., Mal-

oney, W.J., Schurman, D.J., and Smith, R.L. Chondrocytes

from osteoarthritic cartilage have increased expression of

insulin-like growth factor i (igf-i) and igf-binding protein-3

(igfbp-3) and� 5, but not igf-ii or igfbp-4. J Clin Endocrinol

Metab 81, 1096, 1996.

56. Tardif, G., Reboul, P., Pelletier, J.P., Geng, C., Cloutier, J.M.,

and Martel-Pelletier, J. Normal expression of type 1 insulin-like

growth factor receptor by human osteoarthritic chondrocytes

with increased expression and synthesis of insulin-like growth

factor binding proteins. Arthritis Rheum 39, 968, 1996.

57. Morales, T.I. The insulin-like growth factor binding proteins

in uncultured human cartilage: increases in insulin-like growth

factor binding protein 3 during osteoarthritis. Arthritis Rheum

46, 2358, 2002.

58. Schutt, B.S., Langkamp, M., Rauschnabel, U., Ranke, M.B.,

and Elmlinger, M.W. Integrin-mediated action of insulin-like

growth factor binding protein-2 in tumor cells. J Mol En-

docrinol 32, 859, 2004.

59. Morales, T.I., and Hunziker, E.B. Localization of insulin-like

growth factor binding protein-2 in chondrocytes of bovine

articular cartilage. J Orthop Res 21, 290, 2003.

60. Matsumoto, T., Tsukazaki, T., Enomoto, H., Iwasaki, K., and

Yamashita, S. Effects of interleukin-1 beta on insulin-like

growth factor-i autocrine/paracrine axis in cultured rat artic-

ular chondrocytes. Ann Rheum Dis 53, 128, 1994.

61. Olney, R.C., Wilson, D.M., Mohtai, M., Fielder, P.J., and

Smith, R.L. Interleukin-1 and tumor necrosis factor-alpha

increase insulin-like growth factor-binding protein-3 (igfbp-3)

production and igfbp-3 protease activity in human articular

chondrocytes. J Endocrinol 146, 279, 1995.

62. Sunic, D., McNeil, J.D., Rayner, T.E., Andress, D.L., and

Belford, D.A. Regulation of insulin-like growth factor-binding

protein-5 by insulin-like growth factor i and interleukin-1alpha

in ovine articular chondrocytes. Endocrinology 139, 2356,

1998.

1344 PORTER ET AL.

63. Terry, D.E., Rees-Milton, K., Smith, P., Carran, J., Pezeshki,

P., Woods, C., Greer, P., and Anastassiades, T.P. N-acylation

of glucosamine modulates chondrocyte growth, proteoglycan

synthesis, and gene expression. J Rheumatol 32, 1775,

2005.

64. Dell’Accio, F., De Bari, C., and Luyten, F.P. Molecular

markers predictive of the capacity of expanded human artic-

ular chondrocytes to form stable cartilage in vivo. Arthritis

Rheum 44, 1608, 2001.

Address reprint requests to:

Kimberly Forsten-Williams, Ph.D.

Department of Chemical Engineering

Virginia Polytechnic Institute & State University

133 Randolph Hall

Blacksburg, VA 24061-0211

E-mail: kfw@vt.edu

CULTURE STRATEGY IMPACTS IGF-I SYSTEM 1345