1

Identification of genomic binding sites for Candida glabrata Pdr1 transcription factor in 1 wild-type and ρ0 cells 2 3 4 Sanjoy Paul1, Thomas B. Bair2 and W. Scott Moye-Rowley1,# 5 6 From the Department of Molecular Physiology and Biophysics1 and Iowa Institute of 7 Human Genetics2, Carver College of Medicine, University of Iowa, Iowa City, IA USA. 8 9 Running title: Genomic binding sites of Pdr1 10 11 #Address correspondence to: W. Scott Moye-Rowley, scott-moye-rowley@uiowa.edu. 12 13 Draft version: August 28, 14 14 15

AAC Accepts, published online ahead of print on 8 September 2014Antimicrob. Agents Chemother. doi:10.1128/AAC.03921-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

2

Abstract 16 The fungal pathogen Candida glabrata is an emerging cause of candidiasis in part 17 owing to its robust ability to acquire tolerance to the major clinical antifungal drug 18 fluconazole. Similar to the related species Candida albicans, C. glabrata most typically 19 gains azole tolerance via transcriptional induction of a suite of resistance genes 20 including an ABCG type ATP-binding cassette transporter referred to as CDR1 in 21 Candida species. In C. glabrata, CDR1 expression is primarily controlled by the activity 22 of a transcriptional activator protein called Pdr1. Strains exhibiting reduced azole 23 susceptibility often contain substitution mutations in the PDR1 that in turn lead to 24 elevated mRNA levels of target genes with associated azole resistance. Pdr1 activity is 25 also induced upon loss of the mitochondrial genome status and upon challenge by 26 azole drugs. While extensive analyses of the transcriptional effects of Pdr1 have 27 identified a number of genes that are regulated by this factor, we cannot yet separate 28 direct from indirect target genes. Here we use chromatin immunoprecipitation (ChIP) 29 coupled with high throughput sequencing (ChIP-seq) to identify the promoters and 30 associated genes directly regulated by Pdr1. These genes include many that are 31 shared with the yeast Saccharomyces cerevisiae but others that are unique to C. 32 glabrata including the ABC transporter-encoding locus YBT1, genes involved in DNA 33 repair and several others. These data provide the outline for understanding the primary 34 response genes involved in production of Pdr1-dependent azole resistance in C. 35 glabrata. 36 37 Introduction 38

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

3

Fungal disease is a growing threat to human health as the population of 39 immunocompromised patients grow with time (reviewed in (1). A unique challenge 40 presented by fungi comes from their well-described evolutionary conservation with 41 humans (For example (2)). Unlike the situation with bacterially-based diseases, the 42 number of clinically effective antifungal drugs is quite small with only a few useful 43 pathogen targets (recently reviewed in (3)). The major human fungal pathogens are the 44 Candida species; primarily Candida albicans and Candida glabrata. While C. albicans 45 is still the primary cause of candidiasis, the incidence of infections associated with C. 46 glabrata has grown to the point that this species is the second most-common linked to 47 this class of fungal disease ((4)). One of the likely contributing factors to the emergence 48 of C. glabrata as a pathogen comes from the ability of this yeast to develop resistance 49 to azoles, the major clinical antifungal drug class (reviewed in (5)). 50 C. glabrata can acquire azole resistance in at least two different manners. The 51 primary means are provided by gain-of-function mutations in the gene encoding the key 52 transcription factor Pdr1 (6, 7). These GOF mutants cause Pdr1 to become hyperactive 53 and stimulate expression of downstream genes that in turn lead to dramatic decreases 54 in azole susceptibility (7). A second mechanism is provided by loss of the mitochondrial 55 genome that leads to constitutive activation of otherwise wild-type Pdr1 (8). A critical 56 outcome of either mechanism of Pdr1 activation is the large transcriptional induction of 57 these azole resistance genes including the ABCG class ATP-binding cassette (ABC) 58 transporter-encoding locus CDR1 (9). 59 The work of multiple labs has provided a detailed examination of the collection of 60 genes that are upregulated upon Pdr1 activation in both laboratory and clinical isolates 61

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

4

(10-12). More recently, data have been obtained that C. glabrata strains containing 62 activated Pdr1 also exhibit increased virulence in murine models of infection (13, 14). 63 Increased transcriptional activation by Pdr1 is a serious complicating factor during C. 64 glabrata pathogenesis and understanding the basic mechanisms underlying this 65 transcriptional circuit is a high priority. 66 While the picture of the Pdr1-responsive transcriptome is well-developed, we 67 know very little about the direct targets of this transcription factor. To address this 68 deficiency, we have carried out chromatin immunoprecipitation followed by 69 highthroughput sequencing (ChIP-seq) analyses using two different immunological 70 probes for Pdr1. These experiments were carried out in isogenic ρ+ and ρ0 C. glabrata 71 cells to detect differences in promoter occupancy in these two different states of Pdr1 72 activity. Our data provide the first look across the genome at the repertoire of genes 73 under the direct control of Pdr1. Additionally, our findings support earlier findings that 74 while the S. cerevisiae and C. glabrata Pdr regulons do share striking similiarities, there 75 are remarkable differences that emphasize the unique biology of C. glabrata as a 76 pathogen. 77 78 Materials and methods 79 80 C. glabrata strains and media. The wild-type C. glabrata strain used in these 81 experiments is ATCC2001. A pdr1Δ::natMX version of this strain was obtained from Dr. 82 Karl Kuchler. To construct a strain in which the only source of Pdr1 activity is provided 83 by the TAP-tagged allele, we integrated the pRS425-TAP-PDR1 construct described 84

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

5

below after linearization with the restriction enzyme BclI. This cleavage directs 85 recombination into the genomic PDR1 promoter region of the pdr1Δ::natMX allele and 86 results in the TAP-tagged Pdr1 being produced from its normal genomic promoter 87 elements. Both this initial TAP-tagged transformant and the pdr1Δ::natMX strain were 88 induced to lose their mitochondrial genomes by treatment with ethidium bromde as 89 described (15). Loss of the mitochondrial genome was confirmed by testing 90 representative ethidium bromide resistant cells for lack of DAPI (4',6' diamino-2-91 phenylindole) staining and inability to grown on media containing a nonfermentable 92 carbon source. All C. glabrata strains were maintained on standard YPD (1% yeast 93 extract/0.5% peptone/2% glucose) medium. Where necessary, YPGE medium was 94 used in which glucose was replaced by 3% glycerol/ethanol to evaluate normal 95 mitochondrial function. Drug resistance was assessed by adding 30 μg/ml fluconazole 96 to YPD medium. Fluconazole gradient plates were produced as described before (16). 97 Experiments with S. cerevisiae used standard techniques and media described earlier 98 (17). 99 100 Plasmids. A TAP-tagged allele of PDR1 was constructed by cloning in Saccharomyces 101 cerevisiae. Primers that amplified either upstream of PDR1 102 (gagaattggagctccaccgcggtggcggccgctctagaactagtggatccGTCAAGGTCTGAGCATACTG103 A) or downstream 104 (ccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagCATTCAGAATCGAAGGGTTTTT105 C) were used along with two internal primers (REV2: 106 ATTCTCTCTATTATCTTACTTACCAAGCTCT; FOR3: 107

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

6

GAAAACTGAGGAAGCGATAAAACTGATGAAA) to produce two PCR fragments that 108 corresponded to the 5’ and 3’ halves of the gene. These two PCR products were 109 transformed into S. cerevisiae cells along with BamHI/PstI-cleaved pRS315 vector and 110 Leu2+ transformants selected. Plasmid DNA was recovered from these transformants 111 and confirmed to contain the cloned PDR1 allele that in turn was fully sequenced to 112 ensure its accurate amplification. 113 114 Antibody generation. A rabbit polyclonal antiserum directed against Pdr1 was produced 115 by purifying poly-His-Pdr1 protein from a bacterial subclone described before (15). This 116 recombinant protein was sent to Cocalico Biologicals (Reamstown, PA) for 117 immunization of rabbits. After delivery of the rabbit antiserum, we purified the anti-Pdr1 118 antibodies over a CNBr-activated sepharose column to which recombinant Pdr1 had 119 been covalently linked using standard protocols (15). This affinity-purified antiserum 120 was used for all immunological procedures detailed in this manuscript. 121 122 Chromatin immunoprecipitation-Next Generation Sequencing analysis. Chromatin 123 immunoprecipitation was done as described in (18) with the following modifications. 124 Briefly, 100 ml cell cultures were grown to an A600 of 0.8 to 1 in YPD medium at 30°C. 125 Cells were lysed in ChIP lysis buffer in the presence of 0.5 mm glass beads (BioSpec 126 Products Inc.) for 4 x 5 min with 2 min pauses in between in a Vortex Genie 2 at speed 127 setting of 10 in multiple 1.5 ml microfuge tubes. Shearing of chromatin was done in an 128 E220 Focused-ultrasonicator [Covaris] under following conditions: Peak Incident Power 129 (W): 175; Duty Factor: 10%; Cycles per burst: 200; Treatment Time: 420 sec; 130

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

7

Temperature: 7oC; Sample volume: 130 μl. An AFA Fiber Pre-Slit Snap-Cap [6 x 131 15mm] microTUBE [Covaris] was used for the shearing. For immunoprecipitation, 2μg 132 of TAP polyclonal antibody (Thermo Scientific; Product # CAB1001; Lot # NH77071) or 133 Pdr1 specific polyclonal antibody (described above) was used. The library preparation 134 of ChIP-ed DNA was done on the Nugen Mondrian SP Workstation with the Ovation SP 135 Ultralow DR Multiplex System. The clustering was done on the cBot using the TruSeq 136 PE Cluster Kit v3-cBot-HS kit. DNA sequencing was carried out on an Illumina HiSeq 137 2500 using the TruSeq SBS Kit v3-HS 200-cycle kit. Sequencer output was first 138 assessed for quality using the FastQC tool (v0.11.2). Reads were then aligned to the C. 139 glabrata genome (ASM254v2) using bowtie2 (v2.1.0). The resulting bam files were then 140 assessed for peaks, quality and reproducibility using the spp tool (v1.10.1). Relative 141 strand correlation and normalized strand coefficient values were determined for all 142 samples using the tool ccQualityControl (v 1.1). Where replicate samples were found, 143 an irreproducible discovery rate cutoff of 0.01 was used to establish significance 144 threshold criteria; otherwise significance was not determined but further filtering was 145 done by merging peaks called under different conditions and the overlap between sets 146 was used. Peak annotation was done using both ChipPeakAnno (19) and 147 annotatePeaks.pl (20). These ChIP-seq data have been deposited in the Gene 148 Expression Omnibus site (Accession GSE59839). 149 150 ChIP validation PCR. We used standard single gene ChIP analysis to confirm our 151 ChIP-seq data. CDR1, YBT1, MEC3 and PUP1 were used as control promoters for this 152 assay. DNA recovered by ChIP with anti-Pdr1 antibody was quantitated using an 153

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

8

Agilent 2100 Bioanalyzer. 0.1ng DNA was used as template for 24 rounds of 154 amplification cycles (95°C – 30 sec, 58°C – 30 sec,72 °C – 20 sec) using Taq DNA 155 polymerase under standard PCR conditions. CDR1 primers used were (For: 156 ACATGTTGGCAAACCCAG; Rev: AAGCCATTGCCTCTACAGC) that would generate a 157 product of 292 bp comprising of a region corresponding to 2 PDRE elements in CDR1 158 promoter. YBT1 primers used were (For: TGATCTTCTTACGTCCCATACG; Rev: 159 CAATGCACAGCTGATTGTTC) that would generate a product of 210 bp comprising of 160 a region corresponding to the 2 putative PDRE elements in YBT1 promoter. MEC3 (For 161 GTGTTTCTAAGTGCATACAAGAG; Rev GGTAAAATTGGCTTATATCCAC) and PUP1 162 (For CAAACTGGAAATTGTAGAACC; Rev CACAAACTGATACAGCCTGAG) primers 163 were used that produced amplicons of 221 bp and 235 bp, respectively. 164 165 Results 166 167 Immunological detection of Pdr1. Previous measurements of the expression of Pdr1 168 have utilized either mRNA or reporter gene approaches (6, 15). To directly assay levels 169 of the Pdr1 protein, we wanted to develop antibody-based means of detection. This 170 was accomplished in two different ways. First, we prepared an amino-terminal tandem 171 affinity purification (TAP)-tagged form of PDR1. This TAP-tagged allele was introduced 172 as the sole source of Pdr1 activity in ρ+ and ρ0 cells. Second, we purified a recombinant 173 form of Pdr1 corresponding to the amino-terminal zinc cluster-containing DNA binding 174 domain of the protein (15). This fragment was shown to be able to bind DNA in a 175

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

9

sequence-specific manner indicating that it was likely to fold correctly when produced in 176 bacteria and was used to raise a polyclonal antiserum from rabbits. 177 We first compared the ability of the TAP-tagged Pdr1 to the wild-type gene to 178 support growth on medium containing fluconazole (FLC). Pdr1 activates expression of 179 several genes, including locus encoding the ATP-binding cassette transporter protein 180 Cdr1, that in turn elevate tolerance to this antifungal drug (7). Isogenic ρ+ and ρ0 181 transformants expressing the TAP-tagged Pdr1 were grown to mid-log phase and then 182 placed on media containing a gradient of FLC. Similarly, ρ+ and ρ0 strains containing 183 either a wild-type copy of PDR1 or lacking this gene (pdr1Δ) were also placed on this 184 medium as a control. Plates were incubated at 30° for two days and then photographed 185 (Figure 1A). 186 The TAP-tagged allele of PDR1 drove increased FLC resistance in cells lacking 187 their mitochondrial genome (ρ0) compared to ρ+ cells. Similar behavior was seen in 188 strains containing a wild-type copy of PDR1 as previously reported (7). Loss of PDR1 189 severely reduced FLC resistance. This comparison was taken as evidence that the 190 TAP-tagged version of Pdr1 retains the normal function and regulation of the wild-type 191 Pdr1. 192 Using these same strains, we prepared protein extracts from mid-log phase 193 cultures. Equal amounts of protein extracts were resolved on SDS-PAGE, transferred 194 to nitrocellulose membranes and then probed with the rabbit anti-Pdr1 antiserum 195 (Figure 1B) or antibodies directed against either the TAP tag (Figure 1C). 196 Two important results emerge from use of the anti-Pdr1 antiserum. First, a single 197 immunoreactive species was detected in wild-type cells closely matching the predicted 198

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

10

126 kDa size of full-length Pdr1. Second, levels of this protein rose in the absence of 199 the mitochondrial genome and were only found when the PDR1 gene was intact. The 200 anti-TAP western blotting also detected a single species of protein immunoreactive with 201 this antibody that was consistent with the predicted ~150 kDa size of the full-length 202 TAP-Pdr1 fusion protein. As seen with the native PDR1, the TAP-Pdr1 fusion protein 203 increased in abundance when analyzed in ρ0 cells. 204 These data provide further confirmation for the autoregulation of Pdr1 expression. 205 Previous work found that PDR1 transcription was positively autoregulated when 206 measured by either direct mRNA assay or use of reporter gene fusions (7, 15). Here 207 using these immunological reagents, we confirm the increased expression of Pdr1 208 protein in ρ0 cells compared to ρ+ consistent with positive autoregulation. Importantly, 209 these initial results also provide confidence that these two different antibodies will allow 210 their use in chromatin immunoprecipitation-high throughput sequencing (ChIP-seq) 211 analysis of Pdr1 genomic binding sites. 212 213 Chip-seq analyses of direct Pdr1 target promoters. We carried out ChIP-seq analysis 214 using both the anti-Pdr1 and anti-TAP antibodies in order to enrich for authentic Pdr1 215 target promoters. Additional control experiments included use a pdr1Δ cell as a 216 specificity control for the anti-Pdr1 ChIP reactions as this strain lacks the DNA encoding 217 Pdr1. For the anti-TAP ChIP reactions, we carried out ChIP using no primary antibody. 218 Finally, we performed these reactions on chromatin prepared from ρ+ and ρ0 cells in 219 order to identify promoters that responded to the different levels of Pdr1 present in 220 these strains. 221

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

11

We identified genes with associated promoters that were enriched for Pdr1 222 binding by first relying on statistical considerations described in Material and Methods. 223 Our initial focus was limited to genes that were identified in both experiments using the 224 anti-Pdr1 antibody for the ChIP reaction. We also compared these genes to those 225 detected by use of the anti-TAP antibody and to loci shown to be induced in ρ0 cells (14). 226 These peaks were then compared for their increased formation in ρ0 cells, consistent 227 with the increased levels of Pdr1 expression (Figure 1). Finally, each of these peaks 228 was inspected manually to ensure their location to a likely promoter region. Table 1 229 summarizes this analysis. 230 Our analysis identified a set of 25 genes showing reproducible enrichment using 231 the anti-Pdr1 antiserum in ρ0 cells compared to ρ+. 16/25 genes were similarly enriched 232 when using the anti-TAP antibody in the isogenic ρ0 and ρ+ cells expressing the TAP-233 Pdr1 fusion protein. We also compared these putative Pdr1 target genes to loci 234 identified in Ferrari, et al (14) as being induced in ρ0 clinical isolates of C. glabrata. In 235 cases where homologues could clearly be identified, their S. cerevisiae counterparts 236 were evaluated for regulation by Pdr3-dependent activation in ρ0 cells in this organism 237 (21, 22). 238 The 25 genes considered here represent what we could term a minimal list of 239 Pdr1 target genes. For example, as shown in Figure 2A, we did not include PDR1 itself 240 in this list of genes. While a strong ChIP-seq signal was detected using the anti-TAP 241 antibody, we were not able to reproduce this with the anti-Pdr1 antiserum. It is possible 242 that the epitope used to generate the anti-Pdr1 antiserum (recombinant DNA-binding 243 domain) is occluded at this promoter. Epitope availability is a key factor in any 244

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

12

immunologically-based detection method and ChIP-seq is no exception. Further 245 analyses will be required to confirm that Pdr1 does bind to its own promoter although 246 previous data supports this view (15). 247 We focused on promoters detected by our anti-Pdr1 antiserum for the primary 248 reason that it allowed detection of native Pdr1. As the two representative genes show 249 in Figure 2A, binding of Pdr1 is easily detected in both while binding of the TAP-tagged 250 Pdr1 can be clearly seen upstream of the CDR1 promoter but not for BAG7. From the 251 genes found to contain significant Pdr1 binding to their promoters, a number of 252 important observations emerged. First, there was important overlap between ρ0-253 induced genes in C. glabrata with those identified in S. cerevisiae. Commonly regulated 254 genes included those encoding ABC transporters (CDR1, PDH1, SNQ2, YOR1), a 255 phospholipid biosynthetic enzyme (PDR16), seven transmembrane domain-containing 256 proteins (RTA1, RSB1) and an oxidoreductase (YMR102c-like), sphingolipid 257 biosynthetic enzyme (IPT1) and a transcription factor (RPN4). Second, along with this 258 common core of regulated genes, interesting unique genes were found. These include 259 an ABC transporter likely localized to the vacuolar membrane (YBT1), proteins involved 260 in DNA repair (REV1, MEC3), mitochondrially-targeted proteins (Yim1, Pup1), 261 oxidoreductases (Oye2, Yir036c-like, Ynl134c-like), a major facilitator superfamily 262 member (Qdr2), a carbonic anhydrase (Nce103), an alcohol acetyltransferase (Atf2) 263 and a transcription factor (Hap1). Two other binding sites placed between divergently 264 transcribed genes were also identified. These elements were located between the 265 CAGL0B02101/CAGL0B02079 and CAGL0C02937g/CAGL0C02893g genes. These 266 genes encode a PI3,5-P2-binding protein/MFS transporter or a microtubule-binding 267

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

13

protein/protein kinase, respectively. Since none of these genes were reported to be 268 induced in ρ0 cells (14), the significance of the association with Pdr1 remains to be 269 determined. 270 To validate our ChIP-seq data, we used standard ChIP analysis using PCR 271 primers to detect the presence of promoter DNA in the immunoprecipitated DNA. From 272 independent ChIP reactions, we used primer pairs that would detect either the YBT1 or 273 the CDR1 promoters present in DNA recovered from several different 274 immunoprecipitations performed on formaldehyde-fixed chromatin. These chromatin 275 samples were prepared from ρ0 and ρ+ (wt) strains containing the PDR1 gene or from 276 an isogenic ρ+ pdr1Δ strain. In all cases, the anti-Pdr1 antiserum was used as the 277 immunoprecipitating antibody. We also reserved a fraction of the total fixed chromatin 278 to serve as an input control (Input). Aliquots of each DNA sample were then used in 279 PCR reactions employing primers specific for the CDR1, YBT1, MEC3 or PUP1 280 promoters. The results of a representative assay are shown in Figure 3. 281 As predicted by the ChIP-seq analysis, increased representation of all these both 282 promoters is seen in ChIP sample from ρ0 cells compared to ρ+ cells. No significant 283 amount of promoter DNA could be seen in a similar ChIP reaction performed in samples 284 prepared from a pdr1Δ strain. 285 Having identified these Pdr1-bound promoters, we used software tools to 286 examine their promoters for common elements. Our expectation was that we would 287 discover binding sites related to the previously described Pleiotropic Drug Resistance 288 Response Element (PDRE) (23). The consensus PDRE in S. cerevisiae contains the 289 core element TCCGCGGA and is found in the vast majority of genes under control of 290

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

14

the Pdr regulon (reviewed in (24-26)). In order to minimize bias in our analysis of these 291 C. glabrata promoters, we used the software tool MEME (27) to examine all these DNA 292 regions for common elements. This analysis detected a site (Figure 2B) closely related 293 to the S. cerevisiae PDRE that is also very similar to a site identified earlier in C. 294 glabrata based on expression analyses (11). This extensive conservation argues that 295 this element is likely to be the authentic PDRE used in C. glabrata. The best matches 296 to this PDRE present in the upstream region of the promoters bound by Pdr1 are listed 297 in Table 1. While there is strong similarity between these elements, there are 298 differences that are important to test for their significance on function. For example, in 299 the case of CDR1, we previously analyzed function of the promoter and found that 300 truncation mutant forms of this promoter fused to luciferase were still responsive to ρ0 301 induction as long as the PDRE TTCCACGGAA was present ((15), Table 1). However, 302 in this mutant derivative, the last two PDREs predicted from sequence considerations 303 (TTCCACGGGA; CTCCACGGGA) would still be present yet we saw no ρ0 activation. 304 This complication illustrates the necessity of direct functional validation of PDREs in C. 305 glabrata as has been carried out in S. cerevisiae to avoid assigning spurious function 306 based only on DNA sequence considerations. 307 308 Discussion 309 This analysis provides the first determination of the suite of Pdr1-regulated genes 310 that are bound by Pdr1 in vivo and likely to serve as primary response genes when this 311 factor is activated. The proteins encoded by these genes fit into roughly 7 different 312 categories. The most abundant target gene directs production of membrane transporter 313

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

15

proteins. This is similar to the situation in S. cerevisiae, although there are two unique 314 C. glabrata targets: YBT1 and QDR2. QDR2 has been observed by another group to 315 be under the transcriptional control of Pdr1 (28). These data coupled with our ChIP-seq 316 analysis provide arguably the strongest case for a MFS protein-encoding gene 317 regulated by Pdr1. Other work implicating FLR1 as a target gene for Pdr1/3 in S. 318 cerevisiae lacked demonstration of DNA binding to this promoter (29). YBT1 is an 319 interesting new ABC transporter form controlled via the Pdr regulon in C. glabrata. Ybt1 320 is localized to the vacuolar membrane-localized ABCC type ABC transporter that has 321 been implicated in phosphatidylcholine metabolism in S. cerevisiae (30, 31). While S. 322 cerevisiae has at least 4 other ABCC class vacuolar ABC transporters (reviewed in (32)), 323 there is essentially no data linking any of these with multidrug resistance in this 324 organism. Strikingly, an ABCC transporter required for normal virulence is found in the 325 vacuole of the major fungal pathogen Candida albicans (33). Testing the role of C. 326 glabrata Ybt1 in pathogenesis will be an important goal. 327 The second largest class of Pdr1 targets identified in C. glabrata are genes 328 involved in metabolism at some level. Several genes encoding enzymes generally 329 involved in oxidation/reduction reactions possess significant Pdr1 binding activity on 330 their promoters. Two of these oxidoreductases, YMR102c and YNL134c, were found to 331 be regulated by either Yrr1 or Pdr1 in S. cerevisiae and implicated as part of the Pdr 332 regulon in this organism (34, 35). The remaining enzymes, Oye2 and Yir036c, have not 333 been associated with Pdr regulation in S. cerevisiae and may represent new 334 acquisitions for the C. glabrata Pdr regulon. These oxidoreductases are thought to 335 contribute to drug resistance via detoxification or repair of macromolecules in the cell 336

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

16

(36). A related enzyme that may also function in detoxification is encoded by ATF2. 337 This gene is also outside the S. cerevisiae Pdr regulon and plays an important role in 338 modification of alkyl compounds to ester derivatives (37). 339 The final Pdr1-regulated gene involved in metabolism is the NCE103 gene 340 encoding a carbonic anhydrase homologue. This enzyme plays an essential role in 341 growth in the presence of low CO2 levels; high CO2 levels support growth when 342 NCE103 is deleted from C. glabrata (37) as well as S. cerevisiae (38) or C. albicans 343 (39). CO2 sensing regulates virulence in C. albicans (39) and Cryptococcus 344 neoformans (40) suggesting that NCE103 might be a contributor to the observed 345 increase in virulence in C. glabrata with activated Pdr1. 346 Several other Pdr1 target genes are related at some level to metabolic functions 347 but have additional recognized roles. Two genes encoding membrane biosynthetic 348 enzymes were found to contain significant Pdr1 binding in their promoter regions. 349 These are the mannosyl-(diinositol phosphoryl)-ceramide synthase encoding gene IPT1 350 and the phosphatidylinositol transferase protein-encoding gene PDR16. Ipt1 directs 351 synthesis of the final complex sphingolipid present in the plasma membrane (41) while 352 Pdr16 is involved in lipid droplet mobilization and phosphoinositide signaling (42). Both 353 of these genes were previously shown to be under control of the Pdr regulon in S. 354 cerevisiae (43, 44). Several other membrane-bound or integral membrane proteins are 355 regulated by Pdr1. Two 7 transmembrane proteins, RSB1 and RTA1, are highly 356 responsive to increased Pdr1 transcriptional activation. These membrane proteins are 357 overproduced in azole resistant C. glabrata, C. albicans and S. cerevisiae (12, 45, 46). 358 Their precise biological function is somewhat controversial but evidence exists that 359

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

17

these 7 TM proteins can control internalization of both membrane proteins and 360 sphingolipid intermediates at the level of the plasma membrane (47, 48). A GTPase 361 activating protein called Bag7 is also a Pdr1 transcriptional target. Bag7 controls the 362 activity of the Rho1 GTPase in S. cerevisiae in a manner distinct from its close relative 363 Sac7 (49). We have referred to this gene as BAG7 based on the chromosomal synteny 364 with S. cerevisiae but functional analyses are required to confirm this designation. 365 Genes encoding enzymes with functions associated with the mitochondria are 366 also induced in cells lacking this organellar genome. PUP1 was previously identified as 367 a strong and commonly induced gene in clinical isolates (50) although its function is 368 unknown. Overproduction of Pup1 and Cdr1 was sufficient to partially reproduce the 369 phenotypes of clinical isolates containing GOF forms of Pdr1, consistent with the idea 370 that these two genes are major contributors to the downstream effects of Pdr1 genetic 371 activation (50). A gene encoding a second mitochondrial protein called Yim1 was also 372 induced in ρ0 cells and contained a likely PDRE in its promoter. Yim1 is also an 373 oxidoreductase and may provide a mitochondrial equivalent of proteins like Ynl034c for 374 example. YIM1 is one of a divergently transcribed gene pair with the DNA repair 375 enzyme Mec3 encoded by the neighboring gene. Both of these loci were induced in ρ0 376 cells and seem likely to be coregulated by Pdr1. Another DNA repair enzyme was 377 encoded by a gene exhibiting Pdr1 binding to its promoter. This is the REV1 locus 378 encodes a DNA polymerase important in translesion repair (reviewed in (51)). 379 Activation of the Pdr regulon has been argued to be involved in DNA repair in S. 380 cerevisiae (52). 381

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

18

Pdr1 target genes were also found to include two known transcriptional 382 regulators: RPN4 and HAP1. RPN4 was previously shown to be a member of the S. 383 cerevisiae Pdr regulon and has the interesting dual functionality as both a proteasomal 384 subunit but also a positive regulator of proteasome component-encoding gene 385 transcription (53). HAP1 encodes a zinc finger-containing transcription factor that can 386 function as an activator protein under aerobic conditions and a repressor in the absence 387 of oxygen (54). These transcription factors can amplify the range of genes that are 388 regulated by Pdr1 and may help explain the larger list of genes exhibiting stimulated 389 expression in strains containing GOF alleles of PDR1 (12) (7, 11) (10). 390 Our analysis also identified a unique member of the C. glabrata Pdr regulon that 391 has no apparent homologue in S. cerevisiae or in any other fungus (our unpublished 392 data). This gene called CAGL0A01650g is 12-fold induced in ρ0 cells, making it one of 393 the top 5 genes responding to this regulatory signal (14). This gene encodes a 394 relatively acidic and small protein of 118 residues. This locus was similarly found to be 395 induced in strains containing GOF forms of Pdr1 (7, 10-12). S. cerevisiae expresses a 396 small peptide of 101 amino acids that is a member of its Pdr regulon encoded by the 397 YGR346c gene. However, the protein produced by this gene shares no significant 398 similarity with the C. glabrata protein. Further work is required to determine the role of 399 these factors in their respective Pdr response networks. 400 These experiments point to the unique aspects of the Pdr regulon of C. glabrata 401 compared to S. cerevisiae. While in broad strokes (increased expression of ABC 402 transporters, membrane biosynthetic enzymes, metabolic enzymes) these responses 403 are similar, C. glabrata Pdr1 binds upstream of and regulates novel genes that show no 404

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

19

evidence for coordinate transcriptional control in S. cerevisiae. Given the linkage 405 between Pdr1 activation and pathogenesis shown by others (13), we believe that 406 characterization of the C. glabrata Pdr regulon will provide important insight into fungal 407 disease caused by this pathogen. 408 409

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

20

410 Acknowledgments 411 412 We thank Drs. David Price, Karl Kuchler and Puja Shahi for helpful advice and provision 413 of important reagents used here. This work was supported by NIH GM49825. 414 415

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

21

416 References 417 418 1. Brown GD, Denning DW, Gow NA, Levitz SM, Netea MG, White TC. 2012. 419

Hidden killers: human fungal infections. Science translational medicine 420 4:165rv113. 421

2. Tugendreich S, Bassett DE, Jr., McKusick VA, Boguski MS, Hieter P. 1994. 422 Genes conserved in yeast and humans. Human molecular genetics 3 Spec 423 No:1509-1517. 424

3. Roemer T, Krysan DJ. 2014. Antifungal drug development: challenges, unmet 425 clinical needs, and new approaches. Cold Spring Harbor perspectives in 426 medicine 4. 427

4. Pfaller MA, Andes DR, Diekema DJ, Horn DL, Reboli AC, Rotstein C, Franks 428 B, Azie NE. 2014. Epidemiology and Outcomes of Invasive Candidiasis Due to 429 Non-albicans Species of Candida in 2,496 Patients: Data from the Prospective 430 Antifungal Therapy (PATH) Registry 2004-2008. PLoS One 9:e101510. 431

5. Silva S, Negri M, Henriques M, Oliveira R, Williams DW, Azeredo J. 2012. 432 Candida glabrata, Candida parapsilosis and Candida tropicalis: biology, 433 epidemiology, pathogenicity and antifungal resistance. FEMS Microbiol Rev 434 36:288-305. 435

6. Vermitsky JP, Edlind TD. 2004. Azole resistance in Candida glabrata: 436 coordinate upregulation of multidrug transporters and evidence for a Pdr1-like 437 transcription factor. Antimicrob Agents Chemother 48:3773-3781. 438

7. Tsai HF, Krol AA, Sarti KE, Bennett JE. 2006. Candida glabrata PDR1, a 439 transcriptional regulator of a pleiotropic drug resistance network, mediates azole 440 resistance in clinical isolates and petite mutants. Antimicrob Agents Chemother 441 50:1384-1392. 442

8. Sanglard D, Ischer F, Bille J. 2001. Role of ATP-binding cassette transporter 443 gene in high-frequency acquisition of resistance to azole antifungals in Candida 444 glabrata. Antimicrob. Agents Chemother. 45:1174-1183. 445

9. Sanglard D, Ischer F, Calabrese D, Majcherczyk PA, Bille J. 1999. The ATP 446 binding cassette transporter gene CgCDR1 from Candida glabrata is involved in 447 the resistance of clinical isolates to azole antifungal agents. Antimicrob Agents 448 Chemother 43:2753-2765. 449

10. Caudle KE, Barker KS, Wiederhold NP, Xu L, Homayouni R, Rogers PD. 450 2011. Genomewide expression profile analysis of the Candida glabrata Pdr1 451 regulon. Eukaryot Cell 10:373-383. 452

11. Tsai HF, Sammons LR, Zhang X, Suffis SD, Su Q, Myers TG, Marr KA, 453 Bennett JE. 2010. Microarray and molecular analyses of the azole resistance 454 mechanism in Candida glabrata oropharyngeal isolates. Antimicrob Agents 455 Chemother 54:3308-3317. 456

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

22

12. Vermitsky JP, Earhart KD, Smith WL, Homayouni R, Edlind TD, Rogers PD. 457 2006. Pdr1 regulates multidrug resistance in Candida glabrata: gene disruption 458 and genome-wide expression studies. Mol Microbiol 61:704-722. 459

13. Ferrari S, Ischer F, Calabrese D, Posteraro B, Sanguinetti M, Fadda G, 460 Rohde B, Bauser C, Bader O, Sanglard D. 2009. Gain of function mutations in 461 CgPDR1 of Candida glabrata not only mediate antifungal resistance but also 462 enhance virulence. PLoS Pathog 5:e1000268. 463

14. Ferrari S, Sanguinetti M, De Bernardis F, Torelli R, Posteraro B, Vandeputte 464 P, Sanglard D. 2011. Loss of mitochondrial functions associated with azole 465 resistance in Candida glabrata results in enhanced virulence in mice. Antimicrob 466 Agents Chemother 55:1852-1860. 467

15. Paul S, Schmidt JA, Moye-Rowley WS. 2011. Regulation of the CgPdr1 468 transcription factor from the pathogen Candida glabrata. Eukaryot Cell 10:187-469 197. 470

16. Katzmann DJ, Epping EA, Moye-Rowley WS. 1999. Mutational disruption of 471 plasma membrane trafficking of Saccharmyces cerevisiae Yor1p, a homologue of 472 mammalian multidrug resistance protein. Mol. Cell. Biol. 19:2998-3009. 473

17. Sherman F, Fink G, Hicks J. 1979. Methods in Yeast Genetics. Cold Spring 474 Harbor Laboratory: Cold Spring Harbor, New York. 475

18. Knutson BA, Hahn S. 2011. Domains of Tra1 important for activator recruitment 476 and transcription coactivator functions of SAGA and NuA4 complexes. Mol Cell 477 Biol 31:818-831. 478

19. Zhu LJ, Gazin C, Lawson ND, Pages H, Lin SM, Lapointe DS, Green MR. 479 2010. ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-480 chip data. BMC bioinformatics 11:237. 481

20. Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, Cheng JX, Murre 482 C, Singh H, Glass CK. 2010. Simple combinations of lineage-determining 483 transcription factors prime cis-regulatory elements required for macrophage and 484 B cell identities. Mol Cell 38:576-589. 485

21. Traven A, Wong JM, Xu D, Sopta M, Ingles CJ. 2001. Interorganellar 486 communication. Altered nuclear gene expression profiles in a yeast mitochondrial 487 DNA mutant. J. Biol. Chem. 276:4020-4027. 488

22. Devaux F, Carvajal E, Moye-Rowley S, Jacq C. 2002. Genome-wide studies on 489 the nuclear PDR3-controlled response to mitochondrial dysfunction in yeast. 490 FEBS Lett. 515:25-28. 491

23. Katzmann DJ, Burnett PE, Golin J, Mahe Y, Moye-Rowley WS. 1994. 492 Transcriptional control of the yeast PDR5 gene by the PDR3 gene product. Mol. 493 Cell. Biol. 14:4653-4661. 494

24. Bauer BE, Wolfger H, Kuchler K. 1999. Inventory and function of yeast ABC 495 proteins: about sex, stress, pleiotropic drug and heavy metal resistance. Biochim. 496 Biophys. Acta 1461:217-236. 497

25. MacPherson S, Larochelle M, Turcotte B. 2006. A fungal family of 498 transcriptional regulators: the zinc cluster proteins. Microbiol Mol Biol Rev 499 70:583-604. 500

26. Paul S, Moye-Rowley WS. 2014. Multidrug resistance in fungi: regulation of 501 transporter-encoding gene expression. Frontiers in physiology 5:143. 502

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

23

27. Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L, Ren J, Li WW, 503 Noble WS. 2009. MEME SUITE: tools for motif discovery and searching. Nucleic 504 Acids Res 37:W202-208. 505

28. Costa C, Pires C, Cabrito TR, Renaudin A, Ohno M, Chibana H, Sa-Correia I, 506 Teixeira MC. 2013. Candida glabrata drug:H+ antiporter CgQdr2 confers 507 imidazole drug resistance, being activated by transcription factor CgPdr1. 508 Antimicrob Agents Chemother 57:3159-3167. 509

29. Broco N, Tenreiro S, Viegas CA, Sa-Correia I. 1999. FLR1 gene (ORF 510 YBR008c) is required for benomyl and methotrexate resistance in 511 Saccharomyces cerevisiae and its benomyl-induced expression is dependent on 512 pdr3 transcriptional regulator. Yeast 15:1595-1608. 513

30. Ortiz DF, St Pierre MV, Abdulmessih A, Arias IM. 1997. A yeast ATP-binding 514 cassette-type protein mediating ATP-dependent bile acid transport. J Biol Chem 515 272:15358-15365. 516

31. Gulshan K, Moye-Rowley WS. 2011. Vacuolar import of phosphatidylcholine 517 requires the ATP-binding cassette transporter Ybt1. Traffic 12:1257-1268. 518

32. Paumi CM, Chuk M, Snider J, Stagljar I, Michaelis S. 2009. ABC transporters 519 in Saccharomyces cerevisiae and their interactors: new technology advances the 520 biology of the ABCC (MRP) subfamily. Microbiol Mol Biol Rev 73:577-593. 521

33. Theiss S, Kretschmar M, Nichterlein T, Hof H, Agabian N, Hacker J, Kohler 522 GA. 2002. Functional analysis of a vacuolar ABC transporter in wild-type 523 Candida albicans reveals its involvement in virulence. Mol Microbiol 43:571-584. 524

34. Lucau-Danila A, Delaveau T, Lelandais G, Devaux F, Jacq C. 2003. 525 Competitive promoter occupancy by two yeast paralogous transcription factors 526 controlling the multidrug resistance phenomenon. J Biol Chem 278:52641-52650. 527

35. Hu Z, Killion PJ, Iyer VR. 2007. Genetic reconstruction of a functional 528 transcriptional regulatory network. Nat Genet 39:683-687. 529

36. Riveros-Rosas H, Julian-Sanchez A, Villalobos-Molina R, Pardo JP, Pina E. 530 2003. Diversity, taxonomy and evolution of medium-chain 531 dehydrogenase/reductase superfamily. Eur J Biochem 270:3309-3334. 532

37. Verstrepen KJ, Van Laere SD, Vanderhaegen BM, Derdelinckx G, Dufour JP, 533 Pretorius IS, Winderickx J, Thevelein JM, Delvaux FR. 2003. Expression 534 levels of the yeast alcohol acetyltransferase genes ATF1, Lg-ATF1, and ATF2 535 control the formation of a broad range of volatile esters. Appl Environ Microbiol 536 69:5228-5237. 537

38. Aguilera J, Van Dijken JP, De Winde JH, Pronk JT. 2005. Carbonic anhydrase 538 (Nce103p): an essential biosynthetic enzyme for growth of Saccharomyces 539 cerevisiae at atmospheric carbon dioxide pressure. Biochem J 391:311-316. 540

39. Cottier F, Raymond M, Kurzai O, Bolstad M, Leewattanapasuk W, Jimenez-541 Lopez C, Lorenz MC, Sanglard D, Vachova L, Pavelka N, Palkova Z, 542 Muhlschlegel FA. 2012. The bZIP transcription factor Rca1p is a central 543 regulator of a novel CO(2) sensing pathway in yeast. PLoS Pathog 8:e1002485. 544

40. Bahn YS, Cox GM, Perfect JR, Heitman J. 2005. Carbonic anhydrase and CO2 545 sensing during Cryptococcus neoformans growth, differentiation, and virulence. 546 Curr Biol 15:2013-2020. 547

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

24

41. Dickson RC, Nagiec EE, Wells GB, Nagiec MM, Lester RL. 1997. Synthesis of 548 mannose-(inositol-P)2-ceramide, the major sphingolipid in Saccharomyces 549 cerevisiae, requires the IPT1 (YDR072c) gene. J. Biol. Chem. 272:29620-29625. 550

42. Ren J, Pei-Chen Lin C, Pathak MC, Temple BR, Nile AH, Mousley CJ, 551 Duncan MC, Eckert DM, Leiker TJ, Ivanova PT, Myers DS, Murphy RC, 552 Brown HA, Verdaasdonk J, Bloom KS, Ortlund EA, Neiman AM, Bankaitis 553 VA. 2014. A phosphatidylinositol transfer protein integrates phosphoinositide 554 signaling with lipid droplet metabolism to regulate a developmental program of 555 nutrient stress-induced membrane biogenesis. Mol Biol Cell 25:712-727. 556

43. van den Hazel HB, Pichler H, do Valle Matta MA, Leitner E, Goffeau A, Daum 557 G. 1999. PDR16 and PDR17, two homologous genes of Saccharomyces 558 cerevisiae, affect lipid biosynthesis and resistance to multiple drugs. J. Biol. 559 Chem. 274:1934-1941. 560

44. Hallstrom TC, Lambert L, Schorling S, Balzi E, Goffeau A, Moye-Rowley WS. 561 2001. Coordinate control of sphingolipid biosynthesis and multidrug resistance in 562 Saccharomyces cerevisiae. J. Biol. Chem. 276:23674-23680. 563

45. Rogers PD, Barker KS. 2002. Evaluation of differential gene expression in 564 fluconazole-susceptible and -resistant isolates of Candida albicans by cDNA 565 microarray analysis. Antimicrob Agents Chemother 46:3412-3417. 566

46. DeRisi J, van den Hazel B, Marc P, Balzi E, Brown P, Jacq C, Goffeau A. 567 2000. Genome microarray analysis of transcriptional activation in multidrug 568 resistance yeast mutants. FEBS Lett. 470:156-160. 569

47. Johnson SS, Hanson PK, Manoharlal R, Brice SE, Cowart LA, Moye-Rowley 570 WS. 2010. Regulation of yeast nutrient permease endocytosis by ATP-binding 571 cassette transporters and a seven-transmembrane protein, RSB1. J Biol Chem 572 285:35792-35802. 573

48. Kihara A, Igarashi Y. 2002. Identification and characterization of a 574 Saccharomyces cerevisiae gene, RSB1, involved in sphingoid long-chain base 575 release. J. Biol. Chem. 277:30048-30054. 576

49. Schmidt A, Schmelzle T, Hall MN. 2002. The RHO1-GAPs SAC7, BEM2 and 577 BAG7 control distinct RHO1 functions in Saccharomyces cerevisiae. Mol 578 Microbiol 45:1433-1441. 579

50. Ferrari S, Sanguinetti M, Torelli R, Posteraro B, Sanglard D. 2011. 580 Contribution of CgPDR1-regulated genes in enhanced virulence of azole-581 resistant Candida glabrata. PLoS One 6:e17589. 582

51. Prakash S, Johnson RE, Prakash L. 2005. Eukaryotic translesion synthesis 583 DNA polymerases: specificity of structure and function. Annu Rev Biochem 584 74:317-353. 585

52. Zhu Y, Xiao W. 2004. Pdr3 is required for DNA damage induction of MAG1 and 586 DDI1 via a bi-directional promoter element. Nucleic Acids Res 32:5066-5075. 587

53. Xie Y, Varshavsky A. 2001. RPN4 is a ligand, substrate, and transcriptional 588 regulator of the 26S proteasome: a negative feedback circuit. Proc Natl Acad Sci 589 U S A 98:3056-3061. 590

54. Hickman MJ, Winston F. 2007. Heme levels switch the function of Hap1 of 591 Saccharomyces cerevisiae between transcriptional activator and transcriptional 592 repressor. Mol Cell Biol 27:7414-7424. 593

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

25

55. Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, 594 Mesirov JP. 2011. Integrative genomics viewer. Nat Biotechnol 29:24-26. 595

596 597

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

26

598 Figure Legends 599 Figure 1. Functional and expression analyses of wild-type and TAP-tagged forms 600 of Pdr1. A. C. glabrata cells expressing the indicated forms of Pdr1 were grown to 601 mid-log phase and 1000 cells/spot placed on a YPD plate containing a gradient of 602 fluconazole (FLC). Increasing drug concentration is denoted by the bar of increasing 603 width. The plate was allowed to develop at 30° C for two days and then photographed. 604 B. Isogenic wild-type (ρ+), pdr1Δ or ρ0 cells were grown in rich medium to mid-log 605 phase. Total protein extracts were prepared, equal amounts of protein resolved on 606 SDS-PAGE and transferred to a nitrcocellulose membrane. The membrane was 607 stained with Ponceau S to visualize total protein and then probed with anti-Pdr1 608 antiserum (α-Pdr1). Molecular mass markers are shown on the left. C. This 609 experiment was conducted as in A but either ρ+ or ρ0 cells expressing a TAP-tagged 610 form of Pdr1 were used to prepare protein extracts. The membrane was probed with 611 anti-TAP antibody (α-TAP). 612 Figure 2. Representative ChIP-seq data and potential PDRE consensus for C. 613 glabrata Pdr1. A. Selected genomic regions illustrating different patterns of ChIP 614 detection are presented from output using Integrative Genomics Viewer software (55). 615 The numbers at the top designate nucleotide position along each chromosome. The 616 number of reads recovered in each ChIP-seq track are plotted relative to the coding 617 sequences of the indicated genes. Polarity of each gene is indicated by the directional 618 arrow. Red plots graph ChIP-seq reads from ρ0 cells, green plots graph reads from ρ+ 619 cells and blue plots graph the appropriate negative controls for either anti-Pdr1 (α-Pdr1) 620

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

27

(pdr1Δ) or anti-TAP (α-TAP) in which the primary antibody was omitted (No 1° Ab). 621 Standard names are used to indicate each gene. B. Potential consensus for the C. 622 glabrata PDRE as determined by MEME software suite (27) is presented. Upstream 623 sequences of genes listed in Table 1 were compared via MAST analysis and the 624 predicted consensus sequence most closely related to S. cerevisiae PDRE shown. 625 Figure 3. PCR validation of ChIP-seq data. Primer sets corresponding to the CDR1, 626 YBT1, MEC3 or PUP1 promoters were used to confirm the enrichment predicted by 627 ChIP-seq. ChIP reactions were carried out using anti-Pdr1 antiserum as described 628 above from ρ+, ρ0 or pdr1Δ cells. An aliquot of total fixed chromatin (Input) was 629 reserved to act as an input control. Aliquots of total and immunoprecipitated chromatin 630 were then used as template DNA in PCR reactions in which the appropriate primer pairs 631 were present. 632

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

28

633 634 Tables 635 Table 1. Summary table for ChIP-seq analysis. A table summarizing relevant properties of the genes identified as 636 Pdr1 target loci is presented. Both the systematic and standard names (where known) for the C. glabrata genes are listed. 637 Recognized S. cerevisiae homologues with their standard names are shown. None indicated no recognized homologue. 638 If a C. glabrata gene is known to be a member of the Pdr regulon in S. cerevisiae, this is indicated. The ability of a 639 promoter of interest to be identified in a ChIP reaction using either the anti-TAP or -Pdr1 antibodies is listed. Relevant 640 functions of the encoded gene products are also presented along with the sequences of the putative PDREs in a given 641 promoter. Finally, the fold induction of a gene of interest in ρ0 cells relative to ρ+ cells is listed (Data from (14)). 642

C. glabrata Systematic C. glabrata Standard S. cerevisiae Homologue Pdr-regulated in S. cerevisiae ChIP with anti-TAP ChIP with anti-Pdr1 Function PDRE Induced in r0CAGL0A01650g None None No Yes Yes Unknown CCCCGTGGGA; ATCCATGGGA 12XCAGL0B02101g None HSV2-like; CAGL0B02079 No No Yes ND <2.2CAGL0C02937g None PAC1; HRK1 No Yes Yes TCCCGTGGAC <2.2CAGL0C03289g YBT1 YBT1 No Yes Yes ABC Transporter TTCCGGGGAA; ACCCACGGAA 5XCAGL0D05918g ATF2 ATF2 No No Yes Alcohol acetyltransferase,steroid detoxification TTCCACGGAG 10XCAGL0E05588g REV1 REV1 No No Yes DNA Repair ND 2.2CAGL0F02717g PDH1 PDR15 Yes Yes Yes ABC Transporter TTCCGTGGAA; TTCCACGGAA 18XCAGL0G00242g YOR1 YOR1 Yes Yes Yes ABC Transporter TTCCCCGGGT; TTCCGTGGAA 22XCAGL0G01540g NCE103 NCE103 No Yes Yes Carbonic Anhydrase CCCCGTGGGA 7XCAGL0G05313g IPT1 IPT1 Yes Yes Yes Sphingolipid Biosynthesis ATCCGTGGAA (>1 kb from ATG) <2.2CAGL0G08624g QDR2 QDR2 No Yes Yes MFS ATCCGTGGAG 2.3CAGL0I02574g OYE2 OYE2 No No Yes NADPH oxidoreductase ND <2.2CAGL0I04862g SNQ2 SNQ2 Yes No Yes ABC Transporter CTCCACGGGA; TTCCACGGAA 3XCAGL0I07249g BAG7 BAG7 No No Yes GTPase Activating Protein ND 6XCAGL0J05852g None YIR036c oxidoreductase No No Yes Oxidoreductase TCCCGTGGAA 8XCAGL0J07436g PDR16 PDR16 Yes Yes Yes PI Transfer Protein TTCCGTGGGA 3XCAGL0K00715g RTA1 RTA1 Yes Yes Yes 7 Transmembrane Domains CTCCACGGAA 12XCAGL0K01749g RPN4 RPN4 Yes Yes Yes Transcription Factor CTCCGTGGAC; TTCCGTGGAA 3XCAGL0K03377g None YMR102c-like Yes No Yes Oxidoreductase ATCCGTGGAG; TCCCATGGAA 3XCAGL0K05819g None HAP1 No No Yes Transcription Factor ATCCGTGGAA 3XCAGL0K09702g None QOR oxidoreductase aka YNL1 No Yes Yes Oxidoreductase ND 7.5XCAGL0L10142g RSB1 RSB1 Yes Yes Yes 7 Transmembrane Domains TTCCGTGGAA 7XCAGL0M01760g CDR1 PDR5 Yes Yes Yes ABC Transporter GTCCACGGAA; TTCCACGGAA; TTCCACGGGA; CTCCACGGGA 4XCAGL0M09735g MEC3;YIM1 MEC3; YIM1 No Yes Yes DNA Repair; Mitochondrial protein TTCCACGGAA; TTCCGTGGAA 9XCAGL0M12947g PUP1 None No Yes Yes Mitochondrial Protein ATCCACGGAA; TTCCGTGGAC 57X

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 31, 2018 by guest

http://aac.asm.org/

Dow

nloaded from