8ο Συνέδριο...

Click here to load reader

  • date post

    31-Jul-2020
  • Category

    Documents

  • view

    0
  • download

    0

Embed Size (px)

Transcript of 8ο Συνέδριο...

  • 8ο Συνέδριο Αγροτεχνολογίας, 2019

  • ΠΡΟΣΦΑΤΑ ΕΠΙΣΤΗΜΟΝΙΚΑ ΠΟΡΙΣΜΑΤΑ ΑΝΑΔΕΙΚΝΥΟΥΝ ΑΓΝΩΣΤΕΣ ΑΞΙΕΣ ΤΟΥ

    οίνου, μελιού, κάνναβης

    Αθανάσιος Τσαυτάρης

  • ΥΠΑΡΧΟΥΝ ΚΑΙ ΠΡΟΒΙΟΤΙΚΟΙ ΜΥΚΗΤΕΣ;;; Μύκητες

    Βακτήρια Ιοί

  • Προβιοτικοί Μύκητες

  • Προβιοτικοί Μύκητες

  • Προβιοτικός μύκητας της ΕΡΓΟΤΙΑΣΗΣ

    Ergot από το γαλλ. “argot”= το νύχι του κόκκορα

  • ΕΡΓΟΤΙΑΣΗ και λυσεργικό οξύ

  • ΕΛΕΥΣIΝΙΑ ΜΥΣΤΗΡΙΑ;;;

  • Οίνοι και… Ξύδια

  • Προβιοτικοί Μύκητες

    Κρασιά

    Ξύδια

  • Προϊόντα Μέλισσας Μέλι και…Βασιλικός Πολτός

  • Cooney et al. J Nutr 132:2393S (2002)

    Maternal Supplements with zinc methionine betaine choline, folate B12

    High risk cancer, diabetes, obesity & reduced lifespan

    Lower risk of cancer, diabetes, obesity and prolonged life

    LTR Hypomethylated LTR Hypermethylated When to Intervene??

    Βασιλικός Πολτός (Royal jelly)

  • Γενετική Επιγενετική Κληρονομήσιμη αλλαγή χαρακτήρων που δεν περιλαμβάνει αλλαγή στην αλληλουχία του DNA

    Κληρονομήσιμη αλλαγή χαρακτήρων που περιλαμβάνει αλλαγή στην αλληλουχία του DNA

    M M M

    M M M

    M

    M

    M

    M M

    M M

    ΚΑΛΟΣ

    ΚΑΚΟΣ

    ΠΑΝΩΡΑΙΑ

    ΩΡΑΙΑ

    Καλός Κάλος

  • Small Seed Large Seed

    Γονική αποτύπωση

  • CH3

    Φολικό οξύ

  • CH3

    Φολικό οξύ σε τρόφιμα ζωϊκής προέλευσης

  • CH3

    Φολικό οξύ σε τρόφιμα φυτικής προέλευσης

  • Caste Differentiation in Bees Royal Jelly

    worker Queen

  • Carbohydrate

    Lipid

    Protein

    Water

    Royal Jelly

    miRNAs

  • miRNAs common in ROYAL JELLY, HUMAN, MILK

    miR-let7 miR-34 miR-375 miR-1 miR-185

    Target important genes expressed in human skin and other human tissues Eg. immune response genes oncogenes membrane genes transcription factors metabolic genes signaling genes (kinases)

  • Συμπέρασμα: Για πρώτη φορά βλέπουμε

    πλέον τα τρόφιμα και ως πηγή πληροφοριών

  • Κάνναβις

  • Οι τέσσερις περίοδοι στη Βελτίωση των Φυτὠν Συμβατική Βελτίωση Μοριακή Βελτίωση Γενετική Μηχανική Επαναστοιχειοθέτησ

    Ν έα

    π οι

    κι λί

    α

    15 χρόνια επιλογής 4 χρόνια επιλογής

     

    Αποκοπή και μεταφορά 1-2 έτη

    Λ

    Λ Λ

    Κ

    Επαναστοιχειοθέτηση του Κ με το Λ 3 μήνες

  • Genome Editing

    Επαναδιατύπωση ή επαναστοιχειοθέτηση

    Σημερινή βελτιωμένη αλλά ευαίσθητη στην ασθένεια ποικιλία

    ATATGCAATTCAGCATCCGAC ATATGCAATTCCGCATCCGAC

    Άγρια ποικιλία ανθεκτική στην ασθένεια

  • Επαναδιατύπωση ή επαναστοιχειοθέτηση

    1. ZFN (Zinc-Finger Nuclease) 2. TALEN (Transcription activator-like effector nuclease) 3. CRISPR/Cas9

  • ΤΕΧΝΙΚΕΣ ΕΠΑΝΑΔΙΑΤΥΠΩΣΗΣ ΓΟΝΙΔΙΩΜΑΤΟΣ

    Αναγνώριση του DNA

    Κοπή του DNA

    Α. Δάκτυλοι ψευδαργύρου 1 δ→ 3 νουκλ

    FokI (διμερής ενδονουκλεάση)

    Β. Πεπτίδιο 1 πεπτ → 1 νουκλ

    FokI (διμερής ενδονουκλεάση)

    C. gRNA

    Cas9 ενδονουκλεάση βακτηριακής προέλευσης

  • Φαρμακευτική ουσία

    Ναρκωτική ουσία

  • Φαρμακευτική ουσία

    Ναρκωτική ουσία

  • 8ο Συνέδριο Αγροτεχνολογίας, 2019 Προσφατα επιστημονικα πορισματα αναδεικνυουν αγνωστεσ αξιεσ του �οίνου, μελιού, κάνναβης Slide Number 3 Slide Number 4 Slide Number 5 Slide Number 6 Slide Number 7 Slide Number 8 Slide Number 9 Οίνοι και… Ξύδια Slide Number 11 Προϊόντα Μέλισσας�Μέλι και…Βασιλικός Πολτός Slide Number 13 Slide Number 14 Slide Number 15 Slide Number 16 Slide Number 17 Slide Number 18 Slide Number 19 Slide Number 20 Slide Number 21 Συμπέρασμα:� Για πρώτη φορά βλέπουμε πλέον τα τρόφιμα και ως πηγή πληροφοριών Κάνναβις� Slide Number 24 Slide Number 25 Slide Number 26 Slide Number 27 Slide Number 28 Slide Number 29 Slide Number 30