0391-3988/204-08 $15.00/0

Tissue Engineering

The International Journal of Artificial Organs / Vol. 30 / no. 3, 2007 / pp. 204-211

Nanofibrous poly(ε-caprolactone)/poly(vinylalcohol)/chitosan hybrid scaffolds for bone tissueengineering using mesenchymal stem cells

Y. MOHAMMADI1,4, M. SOLEIMANI2, M. FALLAHI-SICHANI1,5, A. GAZME1, V. HADDADI-ASL3, E. AREFIAN1, J. KIANI1, R. MORADI6, A. ATASHI1,2, N. AHMADBEIGI1

1 Stem Cell Technology Co., Tehran - Iran2 Tarbiat Modares University, School of Medical Sciences, Hematology Department, Tehran - Iran3 Polymer Engineering Department, Amirkabir University of Technology, Tehran - Iran4 Biomedical Engineering Department, Amirkabir University of Technology, Tehran - Iran5 Department of Biotechnology, University College of Science, University of Tehran, Tehran - Iran6 Loghman Hospital, Shahid Beheshti University, Tehran - Iran

© Wichtig Editore, 2007

ABSTRACT: In the present study, based on a biomimetic approach, novel 3D nanofibrous hybridscaffolds consisting of poly(ε-caprolactone), poly(vinyl alcohol), and chitosan were developed via amulti-jet electrospinning method. The influence of chemical, physical, and structural properties ofthe scaffolds on the differentiation of mesenchymal stem cells into osteoblasts, and the proliferationof the differentiated cells were investigated. Osteogenically induced cultures revealed that cells werewell-attached, penetrated into the construct and were uniformly distributed. The expression of earlyand late phenotypic markers of osteoblastic differentiation was upregulated in the constructscultured in osteogenic medium. (Int J Artif Organs 2007; 30: 204-11)

KEY WORDS: Bone tissue engineering, Stem cell, Nanofiber, Chitosan, Hybrid scaffold

INTRODUCTION

Bone defects result ing from tumors, diseases,infect ions, t rauma, biochemical disorders, andabnormal skeletal development raise significant healthproblems (1, 2). Traditional biological procedures suchas autografts, allografts, and grafts with nondegradablematerials have been used to overcome bone defectproblems. Bone transplantation by these treatmentmethods, however, is often limited by donor scarcityand is highly associated with the risk of rejection anddisease transfer (3, 4).

In recent years, tissue engineering, as a new disciplineintegrating surgical techniques with the concepts of thelife sciences, such as biology, chemistry, andengineering, has been able to develop approaches for theregeneration of skeletal tissues (5, 6). It is believed thatappropriate strategies for orthopedic tissue engineeringshould ideally contain osteoprogenitor stem cells,

osteoinductive growth factors, and biodegradableosteoconductive scaffolds (7). A successful strategyinvolves in vitro seeding and attachment of humanosteoprogenitor stem cells onto a scaffold. These cellsthen proliferate, migrate, and differentiate into theosteoblasts that secrete the mineral extracellular matrixrequired for the creation of the bone. It is evident that thechoice of the most appropriate scaffolding material iscrucial to enable the cells to behave in the mannerrequired in order to produce bone of the desired shapeand size (8-10).

Over the last few decades, a vast majority of naturaland synthetic scaffolding materials have been studied(11-14). Despite their good formability and suitablemechanical properties, most synthetic polymers lack cell-recognition signals, and have a hydrophobic nature whichprevents uniform seeding of cells and incorporation ofgrowth factors in three dimensions. In contrast, naturalbiopolymers have the potential advantages of specific

Mohammadi et al

205

cell interactions and hydrophilicity. However, they havepoor mechanical strength (15). From the point of view ofengineering and material science, however, no singlebiomaterial provides all acceptable chemical, physical,mechanical, and biological properties, especially,osteogenesis, osteoinduction, and osteoconduction (16,17). Therefore, the concept of hybridization of syntheticpolymers with biopolymers and/or bioresorbablebioceramics seems very promising in combining theiradvantages in order to provide ideal 3D porousbiomaterials for tissue engineering (18).

Among synthetic polymers, poly(α-hydroxy acids),especially poly(L-lactic acid) (PLLA), poly(glycolic acid)(PGA), poly(ε-caprolactone) (PCL), and a range of theircopolymers have a relatively long history of use asbiodegradable scaffolds for cell transplantation. As aclinically approved material, PCL is a semi-crystallinepolymer with rubbery properties which is degraded byhydrolysis of its ester l inkages in physiologicalconditions; it has therefore received a great deal ofattention regarding its use as an implantable biomaterial.Owing to its degradation, which is even slower than thatof PLLA, it is particularly interesting for the preparation oflong-term implantable devices. It has been used in thehuman body as a drug delivery device, for example, assuture, and as an adhesion barrier, and has beeninvestigated as a scaffold for tissue repair via tissueengineering.

Chitosan, on the other hand, has been investigated asa useful and functional biopolymer for a variety of tissueengineering applications because of (i) its structuralsimilarity to naturally occurring glycosaminoglycans(GAGs); and (ii) its enzymatic degradation by lysozyme inthe human body to absorbable oligosaccharides (19-22).It is a linear polysaccharide of (1-4)-linked D-glucosamineand N-acetyl-D-glucosamine residues derived fromchitin, which is found in arthropod exoskeletons. It hasexcellent biocompatibility, bacteriostatic and hemostaticproperties. Furthermore, it can form insoluble complexeswith common connective tissue components such ascollagen and glycosaminoglycans, and can be easilyfabricated into bulk porous scaffolds.

Finally, poly(vinyl alcohol) (PVA) is a semi-crystallinehydrophilic polymer with good chemical and thermalstability. PVA is highly biocompatible and non-toxic.These properties have led to the use of PVA in a widerange of applications in the medical, cosmetic, food,pharmaceutical and packaging industries.

In natural tissues, from a morphological point of view,cells are surrounded by extracellular matrices (ECMs),which have physical structures ranging from thenanometer to the micrometer scale (23). Recent studieshave shown that cells recognize nanometric topologies offibrous or microporous structures, and that suchnanoscale features directly impact different cellularbehaviors (24-26). Therefore, the design and fabricationof submicron to nanoscale structural architectures havereceived much attention in scaffolding technology.Among the different fabrication techniques available,electrospinning represents an attractive approach to thefabrication of nanofibrous scaffolds for tissue engineeringpurposes (27-32). Electrospinning is a fiber spinningtechnique driven by a high-voltage electrostatic field,using a polymeric solution or melt that producespolymeric fibers with diameters ranging from severalmicrometers down to one hundred nanometers or less(33).

In this study, based on a biomimetic approach, novel3D nanofibrous hybrid scaffolds consisting of PCL, PVA,and chitosan were developed via a multi-jetelectrospinning method for bone tissue engineering,especially for non-load bearing applications. Moreover,the influence of chemical, physical, and structuralproperties of the scaffolds on the differentiation ofmesenchymal stem cells (MSCs) into osteoblasts, andthe proliferation of the differentiated cells were the mainfocuses of the present study.

MATERIALS AND METHODS

Materials

Chitosan powder with a viscosity average molecularweight of 2×105 g moL-1 and a deacetylation degree of85% was obtained from Fluka Biochemika (Buchs,Switzerland). PCL with a number average molecularweight of 80000 g moL-1 was purchased from AldrichChemical Co. (Steinheim, Germany) and PVA (98%hydrolyzed, weight average molecular weight of 98000 gmoL-1) was purchased from Merck (Germany). Chloroformand N,N-dimethylformamide (DMF) were obtained fromSigma Chemicals (Steinheim, Germany). Glacial aceticacid and methanol were purchased from Merck. All otherreagents were of analytical grade and used as receivedfrom the manufacturer.

206

PCL/PVA/chitosan nanofibrous scaffolds

Fabrication of nanofibrous hybrid PCL/PVA/chitosan scaffolds

The electrospinning setup util ized in this studyconsisted of an adjustable high DC voltage power supply,two syringe pumps (SP-500, JMS, Tokyo, Japan), and aground electrode (a stainless steel drum with an externaldiameter of 50 mm, length of 10 cm, and variable rotatingspeed). A schematic representation of the multi-jetelectrospinning setup is shown in Figure 1. For thefabrication of PCL, PVA/chitosan hybrid scaffolds, a 5%wt/wt chitosan solution in 0.5 M acetic acid aqueoussolution was mixed with a 10% wt/wt aqueous PVAsolution at a mass ratio of 20:80 under agitation for 12hours at 25oC. PCL was dissolved in chloroform undergentle stirring to obtain a 10% wt/wt solution. Thedesired amount of DMF, chloroform/DMF ratio of 10/1(v/v), was added directly to the PCL/chloroform solution.Uti l izing two separate syringe pumps, PCL andPVA/chitosan solutions were simultaneously delivered tometal capillaries (an internal diameter of 0.8 mm andlength of 2.5 mm) with the constant mass flow rate of 1.5and 0.6 ml/h, respectively. The distance between the tipsand the ground electrode was 7.5 and 10 cm for PCL andPVA/chitosan solutions respectively, while the positivevoltage applied to the polymer solutions was 25 kV.Finally, it should be mentioned that the drum wascontinuously rotated at 250 rpm throughout the course of

electrospinning.Treatment of the nanofibrous mats with methanol for

12 hours stabilized the PVA/chitosan nanofibers againstdisintegration while in contact with culture medium.Afterwards, the nanofibrous scaffolds were rinsed with 1M aqueous sodium hydroxide solution and then washedwith deionized water. The nano-structural hybridscaffolds were then freeze-dried at 0.02 mbar and -10oCfor 48 hours and stored in a desiccator at roomtemperature until use. Finally, for in vitro assays, theelectrospun nanofibrous scaffolds, approximately 500 µmthick, were cut into 1×1 cm2 squares and sterilized bydecreasing concentration of ethanol for 1 to 2 days.

Culture methods

Bone marrow mesenchymal stem cells (MSCs) wereisolated from the femurs of young adult wistar rats, asdescribed by Maniatopoulos et al (34), and maintained inDulbecco’s modified Eagle’s medium (DMEM; Gibco,(GrandIsland, NY, USA) supplemented with 15% fetalbovine serum (FBS; Gibco). After determining theproliferation potentiality of the MSCs, they were culturedin a humidified atmosphere composed of 95% air with5% CO2 at 37oC, extensively propagated, and passagedfrom 15 to 20 times in vitro. The adherent MSCs, with apassage number of 3 to 5, were detached from tissueculture flask with 0.05% trypsin containing 1 mM EDTA(Gibco) and suspended to 3×105 cells/mL in culturemedium. The cell suspension was applied to seed onsterilized nanofibrous scaffolds placed in 12-well tissueculture plates at a density of 1.5×105 cells/scaffold.Following the incubation of the cell seeded scaffolds at37oC for 3 to 4 hours, 2 mL of culture medium was thenadded to each well. MSCs were treated with osteogenicmedium containing DMEM supplemented with 15% FBS,10 nM dexamethasone (Sigma-Aldrich, (St. Louis, MO,USA), 10 mM β-glycerophosphate (Merck), and 0.28 mMascorbic acid two-phosphate magnesium salt n-hydrate(Sigma-Aldrich). The culture media were changed threetimes a week during the two-week differentiationtreatment.

Scanning electron microscopy

The morphology of the electrospun PCL/PVA/chitosannonwoven mats, with and without cells, was observed bymeans of scanning electron microscopy (SEM,

Fig. 1 - Schematic representation of the multi-jet electrospinningsetup.

Mohammadi et al

207

Vega©Tescan, Cranberry Twp., PA, USA) at anaccelerating voltage of 20 kV. Before the observation,samples of cell-scaffold constructs were fixed in 2.5%glutaraldehyde, dehydrated through a graded series ofethanol, and vacuum-dried. All samples were coated withgold using a sputter coater.

Reverse transcription polymerase chain reaction(RT-PCR) analysis

For the RT-PCR analysis, total cellular RNA wasextracted using TRI-reagent (Sigma T-9424) according tothe manufacturer’s protocol. Synthesis of cDNA was

TABLE I - RT-PCR PRIMERS FOR BONE-SPECIFIC GENE EXPRESSION ANALYSIS

Gene Primer sequences (Sense: top, antisense: bottom) Size (bp)

Housekeeping gene

Beta-2-microglobulin (β 2M) TGGAAAGAAGATACCAAATATCGA 201

GATGATTCAGAGCTCCATAGAGCT

Bone-specific genes

Alkaline phosphatase (ALP) TTAAGGGCCAGCTACACCAC 401

GATAGGCGATGTCCTTGCAG

Bone sialoprotein (BSP) CGCCTACTTTTATCCTCCTCTG 795

CTGACCCTCGTAGCCTTCATAG

Osteocalcin (OC) CTAGCAGACACCATGAGGACC 404

ATACTTTCGAGGCAGAGAGAGG

Osteopontin (OP) AGAGGAGAAGGCGCATTACA 497

GCAACTGGGATGACCTTGAT

Fig. 2 - SEM micrographs of the electrospun PCL/PVA/chitosan nanofibrous structure composed of randomly oriented Ultra-fine PCL andPVA/chitosan fibers: (a) low magnification view (700 X); (b) high magnification view (3500 X).

208

PCL/PVA/chitosan nanofibrous scaffolds

Fig. 3 - SEM micrographs of MSCs seeded and differentiated on nanofibrous scaffolds: (a) attachment of anchorage-dependent mesenchymalstem cell on pore structure of nanofibrous scaffold; (b) low magnification view of the cell-polymer constructs after 2 weeks of culture indifferentiation medium. The scaffold surface is partially covered by a layer of attached cells; (c) and (d) high magnification view of the cell-polymer constructs after a 2-week differentiation treatment.

Mohammadi et al

209

carried out with M-MuLV reverse transcriptase (RT) andrandom hexamer as primer, according to themanufacturer’s instructions (Fermentas Inc., Hanover,MD, USA). PCR amplification was performed using astandard procedure with Taq DNA Polymerase(Fermentas Inc., Hanover, MD, USA) with denaturation at94°C for 15 seconds, annealing at 55°C for 30 seconds,and extension at 72°C for 45 seconds. Depending on theabundance of the particular mRNA, the number of cyclesvaried between 25 and 30. The primers and productlengths are listed in Table I.

RESULTS AND DISCUSSION

The natural ECM is a complex mixture of structural andfunctional proteins, glycoproteins, and proteoglycansarranged in a unique, tissue-specific 3D ultrastructure.Structural proteins such as collagen, the most abundantprotein in the ECM, and GAGs are especially important inmechanically supporting tissue reconstruction andproviding attachment sites for cell surface receptors.GAGs play important roles in binding growth factors,water retention, and the gel properties of the ECM. It isworth mentioning that chitosan has a chemical structuresimilar to a repeating unit of GAGs. Hence, PCL andchitosan were chosen as the substitutes for collagen andGAGs in the ECM.

In electrospinning, a solid fiber is generated as theelectrified jet (composed of a highly viscous polymersolution) is continuously stretched due to theelectrostatic repulsions between the surface charges andthe evaporation of solvent. There are some problems inelectrospinning of polyelectrolytes. In the case ofchitosan, for instance, the repulsive interaction amongthe polycations prevents sufficient chain entanglement,necessary for fiber formation. In the present study, PVAwas added to the chitosan solutions to moderate therepelling interaction between polycationic chitosanmolecules and to enhance the molecular entanglement.Scanning electron micrographs obtained prior to cellseeding revealed a three-dimensional scaffold ofnonwoven, randomly oriented nanofibers. Figures 2a and2b show typical SEM micrographs of the hybrid matrixcomposed of PCL and PVA/chitosan nanofibers. Asshown in this figure, PVA/chitosan nanofibers weredistributed uniformly in the PCL nanofibrous structure.The region of distribution of PVA/chitosan nanofibers

ranged from 100 to 400 nm and the majority was in therange of 100 to 200 nm. However, the diameters of purePCL nanofibers were broadly distributed in the range of200 to 1500 nm. Furthermore, the hybrid matricesproduced were approximately 500 µm thick, which canbe changed by increasing the volume andelectrospinning time. It is also worth mentioning that thenano-structural matrices prepared in this study are easilycompressible.

In this work, osteogenic differentiation of adult ratbone marrow-derived MSCs was investigated on thenanofibrous hybrid scaffolds. Cell-scaffold constructscultured for two weeks in osteogenic mediumcontaining β-glycerophosphate, ascorbic acid anddexamethasone were analyzed using SEM (Fig. 3).Osteogenically induced cultures revealed that cellswere well-attached, penetrated into the constructs,and uniformly distributed. In constructs cultured in

Fig. 4 - RT-PCR analysis of osteogenic differentiation of rMSCsseeded in nanofibrous scaffolds. The addition of osteogenicsupplements to cellular constructs led to increased expression ofALP, OC, OP and BSP compared to control cultures.

210

PCL/PVA/chitosan nanofibrous scaffolds

the presence of osteogenic medium, the formation ofmineralized nodules in the MSC-derived osteoblast-like cells was observed. As can be seen in Figure 3,the high surface-area-to-volume ratio and the highporosity of 3D nanof ibrous scaffolds supportattachment and migration of anchorage-dependentMSCs inside the scaffolds with interconnected poresas well as their differentiation into osteoblast-likecells. In contrast with tissue culture plates, the cellsgrow and develop more extensively with appropriateinteractions inside the 3D medium of randomlyoriented nanofibers. This is mainly due to theirchemical and morphological similarity to naturalextracellular matrices.

To confirm the osteogenic differentiation of MSCson the nanofibrous scaffolds, RT-PCR analysis wasutilized to detect the expression of mRNA transcriptsof bone-specific molecules by the second week ofculture (F ig. 4) . The expression of markers ofosteoblast ic di fferent iat ion, including alkal inephosphatase (ALP), osteocalcin (OC), osteopontin(OP), and bone sialoprotein (BSP) was upregulated inconstructs cultured in osteogenic medium. ALP is aprotein localized on the cellular membrane of theosteoblasts and has been used as a marker for earlyosteogenic differentiation cascade. Osteocalcin is abone-specific protein which has been used as a latemarker of osteogenic differentiation. This protein isexclusively produced by osteoblasts andaccumulated in the bone matr ix, which is alsoproduced by the osteoblasts. OP and BSP are otherlate phenotypic markers of osteoblast icdifferentiation. By contrast, untreated control culturesfailed to express either gene by the second week.

CONCLUSION

The capability of MSCs to expand and differentiate intodifferent lineages makes them a highly promising cellsource for tissue engineering and regenerative medicine.Specific cellular differentiation and expression of cellularphenotypes in cells seeded within the scaffolds isrequired for its application in tissue engineering. In thepresent study, nanofibrous PCL/PVA/chitosan hybridstructures were obtained by multi-jet electrospinning. Theresults obtained suggest that these nanofibrous scaffoldsare fully capable of supporting attachment andosteogenic differentiation of rat MSCs. The ability ofcultured stem cells to self-renew and differentiate intolineage-committed osteoblast-like cells on nanofibrousscaffolds may be beneficial for tissue engineering.

ACKNOWLEDGEMENTS

This work was supported by the Stem Cell Technology

Company. We would like to express our sincerest gratitude to

our distinguished sponsors.

Address for correspondence:Masoud Soleimani, PhDTarbiat Modares University School of Medical Sciences Hematology DepartmentP.O. Box 14115-111, Tehran, Irane-mail: soleim_m@modares.ac.ir

REFERENCES

1. Goldberg VM, Caplan AI. Orthopedic tissue engineering.New York: Marcel Dekker Inc.; 2004. .

2. Hollinger JO, Einhorn TA, Doll BA, Sfeir C. Bone Tissueengineering. New York: CRC Press; 2005.

3. Betz RR. Limitations of autograft and allograft: Newsynthetic solutions. Orthopedics 2002; 25: 561-70.

4. Spitzer RS, Perka C, Lindenhayn K, Zippel H. Matrixengineering for osteogenic differentiation of rabbit periostealcells using α-tricalcium phosphate particles in a three-dimensional fibrin culture. J Biomed Mater Res 2002; 59:690-6.

5. Atala A, Lanza RP. Methods of tissue engineering. NewYork: Academic Press; 2002.

6. Lewandrowski KU, Wise DL, Trantolo DJ, Gresser JD,

Mohammadi et al

211

Yaszemski MJ, Altobelli DE. Tissue engineering andbiodegradable equivalents: Scientif ic and clinicalapplications. New York: Marcel Dekker Inc.; 2002.

7. Helm GA, Dayoub H, Jane JA. Bone graft substitutes for thepromotion of spinal arthrodesis. Neurosurg Focus 2001; 10:1-5.

8. Salgado AJ, Coutinho OP, Reis RL. Bone tissue engineering:State of the art and future trends. Macromol Biosci 2004; 4:743-65.

9. Dillow AK, Lowman AM. Biomimetic materials and design.New York: Marcel Dekker Inc.; 2002.

10. Elices M. Structural biological materials: Design andstructure-property relationship. New York: Pergamon; 2000.

11. Burg KJL, Porter S, Kellam JF. Biomaterials development forbone tissue engineering. Biomaterials 2000; 21: 2347-59.

12. Gunatillake PA, Adhikari R. Biodegradable synthetic polymersfor tissue engineering. Eur Cell Mater 2003; 5: 1-16.

13. Shin H, Jo S, Mikos AG. Biomimetic materials for tissueengineering. Biomaterials 2003; 24: 4353-64.

14. Hutmacher DW. Scaffolds in tissue engineering bone andcartilage. Biomaterials 2000; 21: 2529-43.

15. Drury JL, Mooney DJ. Hydrogels for tissue engineering:scaffold design variables and applications. Biomaterials2003; 24: 4337-51.

16. Chen G, Ushida T, Tateishi T. Scaffolds design for tissueengineering. Macromol Biosci 2002; 2: 67-77.

17. Yin Y, Ye F, Cui J, Zhang F, Li X, Yao K. Preparation andcharacterization of macroporous chitosan-gelatin/B-tricalcium phosphate composite scaffolds for bone tissueengineering. J Biomed Mater Res 2003; 67A: 844-55.

18. Chen G, Ushida T, Tetsuya T. Poly(DL-lactic-co-glycolicacid) sponge hybridized with collagen microsponges anddeposited apatite particulates. J Biomed Mater Res 2001;57: 8-14.

19. Nettles DL, Elder SH, Gilbert JA. Potential use of chitosanas a cell scaffold material for cartilage tissue engineering.Tissue Eng 2002; 8: 1009-16.

20. Lahiji A, Sohrabi A, Hungerford DS, Frondoza CG. Chitosansupports the expression of extracellular matrix proteins inhuman osteoblasts and chondrocytes. J Biomed Mater Res2000; 51: 586-95.

21. Zhang Y, Zhang M. Synthesis and characterization ofmacroporous chitosan/calcium phosphate composite

scaffolds for tissue engineering. J Biomed Mater Res 2001;55: 304-312.

22. Martino AD, Sittinger M, Risbud MV. Chitosan: A versatilebiopolymer for orthopaedic tissue-engineering. Biomaterials2005; 26: 5983-90.

23. Ma PX. Scaffolds for tissue fabrication. Mater Today 2004;7: 30-40.

24. Flemming RG, Murphy CJ, Abrams GA, Goodman SL,Nealey PF. Effects of synthetic micro- and nano-structuredsurfaces on cell behavior. Biomaterials 1999; 20: 573-8.

25. Li WJ, Laurencin CT, Caterson EJ, Tuan RS, Ko FK.Electrospun nanofibrous structure: a navel scaffold fortissue engineering. J Biomed Mater Res 2002; 60: 613-21.

26. Xu C, Yang F, Wang S, Ramakrishna S. In vitro study ofhuman vascular endothelial cell function on materials withvarious surface roughness. J Biomed Mater Res 2004; 71A:154-61.

27. Yoshimoto H, Shin YM, Terai H, Vacanti JP. A biodegradablenanofiber scaffold by electrospinning and its potential forbone tissue engineering. Biomaterials 2003; 24: 2077-82.

28. Subbiah T, Bhat GS, Tock RW, Parameswaran S.,Ramkumar SS. Electrospinning of nanofibers. J Appl PolymSci 2005; 96: 557-69.

29. Matthews JA, Wnek GE, Simpson DG, Bowlin GL.Electrospinning of collagen nanofibers. Biomacromolecules2002; 3: 232-8.

30. Li WJ, Tuli R, Okafor C, Derfoul A, Danielson KG, Hall DJ,Tuan RS. A three-dimensional nanofibrous scaffold forcartilage tissue engineering using human mesenchymalstem cells. Biomaterials 2005; 26: 599-609.

31. Wutticharoenmongkol P, Sanchavanakit N, Pavasant P,Supaphol P. Preparation and characterization of novel bonescaffolds based on electrospun polycaprolactone fibersfilled with nanoparticles. Macromol Biosci 2006; 6: 70-77.

32. Fujihara K, Kotaki M, Ramakrishna S. Guided boneregeneration membrane made of polycaprolactone/calciumcarbonate composite nano-fibers. Biomaterials 2005; 26:4139-47.

33. Li D, Xia Y. Electrospinning of Nanofibers: Reinventing theWheel. Adv Mater Deerfield 2004; 16: 1151-70.

34. Maniatopoulos C, Sodek J, Melcher AH. Bone formation invitro by stromal cells obtained from bone marrow of youngadult rat. Cell Tissue Res 1988; 254: 317-30.