E A1502 3

PAPER – II

LIFE SCIENCES

Note : Answer all the questions. Each question carries two (2) marks.

1. What is the relative frequency of occurrence of alanine amino acid residues in the secondary structure of the protein?

Alanine α helix sheet turn

1) 1.29 0.90 0.78

2) 1.11 0.74 0.80

3) 1.30 1.02 0.59

4) 1.47 0.97 0.39

2. For the RNA sequence AUUGGCAUCCGAUAA, draw the secondary structure that maximizes its base pairing

1)

2)

3)

4)

3. Name three enzymatic activities of DNA polymerase I. 1) polymerizing activity, 5’ – 3’ exonuclease, 3’ – 5’ exonuclease 2) polymerizing activity, 5’ – 3’ endonucleases, 3’ – 5’ exonuclease 3) polymerizing activity, 5’ – 3’ exonuclease, 3’ – 5’ endonucleases 4) polymerizing activity, 5’ – 3’ endonucleases, 3’ – 5’ endonucleases

A1502 E 4

4. In E.coli two proteins are necessary for the metabolism of lactose – the enzyme

–––––––––––– and a carrier called ––––––––––––

1) α – galactosidase and lactose permease

2) – galactosidase and lactose permease

3) α – galactosidase and lactose synthetase

4) – galactosidase and lactose synthetase

5. There are five genes which encode the enzymes involved in the tryptophan

biosynthesis. Which arrangement of five cistrons is correct?

1) trp E, trp D, trp C, trp B and trp A 2) trp D, trp C, trp E, trp A and trp B

3) trp C, trp E, trp D, trp B and trp A 4) trp E, trp B, trp A, trp D and trp C

6. For the reaction A B, G° = –7.1 kcal mol-1. At 37°C, –2.303 RT = 1.42 kcal mol–1.

What is the equilibrium ratio of B/A?

1) 1/100,000 2) 100,000/1

3) 1/ 10,000 4) 10,000/1

7. Out of the list given below, which is the correct order of increasing lipid bilayer

permeability?

1) N2 > ethanol > H2O > glucose > Ca2+ > RNA

2) H2O > glucose > ethanol > N2 > Ca2+ > RNA

3) Ca2+ > RNA > N2 > ethanol > H2O > glucose

4) ethanol > RNA > Ca2+ > H2O > glucose > N2

8. The photosynthetic pigment chlorophyll-a differs in its structure from chlorophyll-b

with the

1) pyrrole ring a in chl-a containing a formyl residue instead of the methyl residue

in chl-b

2) pyrrole ring c in chl-b containing a formyl residue instead of the methyl residue

in chl-a

3) pyrrole ring b in chl-b containing a formyl residue instead of the methyl residue

in chl-a

4) pyrrole ring d in chl-a containing a formyl residue instead of the methyl residue

in chl-b

E A1502 5

9. Which one of the following statements on gene families is incorrect?

1) Gene families are groups of related genes that share a common ancestor

2) Gene paralogs are genes with similar sequences from within the same species

3) Gene orthologs are genes with similar sequences in different species

4) Some gene families also contain pseudogenes which are sequences of DNA that closely resemble established gene sequences and are functional

10. According to the Holiday model

I) all four strands are cut at the cross over site and the left side of chromosome I joins the right side of chromosome II and vice versa

II) both strands in each of the resulting duplexes are recombinant

III) both strands in each of the resulting duplexes are non recombinant

Which of the following is true? 1) II is correct III, I are incorrect 2) III is correct I, II are incorrect 3) I, II are correct III is incorrect 4) I, III are correct II is incorrect

11. Reading carefully the statements from the breeders view point, choose which are not developmentally valid.

A) Callus is genetically heterogeneous

B) Embryo rescue offers a way out to assist wide crosses

C) Somatic embryogenesis can be a mass cloning strategy

D) Bud culture technique provides for true to type progenies

Options : 1) A, B and C are correct 2) B is correct and C and D are incorrect 3) C is correct while A and D are incorrect 4) D is correct whereas B and C are incorrect

12. In S allele governed Self Incompatibility pollen with S2 S3 allele will not generate on pistil with similar allele because

A) Pollen and pistil carry similar allelic determinants

B) Pollen secreted RNase that hydrolyses RNA in carpel

C) SRK and SLG interactions do not complement each other

D) Pollen S locus glycoprotein and the recptor like kinase share similar amino acid identities

Options : 1) A, B and C are correct 2) B is correct and C and D are incorrect 3) C is correct while A and D are incorrect 4) D is correct whereas B and C are incorrect

A1502 E 6

13. Investigate statements made on the evolution of pesticide resistance in a population

of insects and pick the most and best suited one.

A) Individual members of the population slowly adapt to the presence of the

chemical by striving to meet the new challenge.

B) All insects exposed to the insecticide begin to use a formerly silent gene to make

a new enzyme that breaks down the insecticide molecules.

C) Insects observe the behavior of other insects that survive pesticide application,

and adjust their own behaviors to copy those of the survivors.

D) Offspring of insects that are genetically resistant to the pesticide become more

abundant as the susceptible insects die and perish

Options :

1) A, B and C are correct

2) A is incorrect C & D are correct

3) C is correct while A and D are incorrect

4) D is incorrect whereas B and C are correct

14. Which of the following is correct for nucleotide bases?

1) A forms 2 hydrogen bonds with G; T forms 3 hydrogen bonds with C

2) A forms 3 hydrogen bonds with T; G forms 2 hydrogen bonds with C

3) A forms 2 covalent bonds with T; G forms 3 covalent bonds with C

4) A forms 2 hydrogen bonds with T; G forms 3 hydrogen bonds with C

15. A gene showing codominance

1) has both alleles independently expressed in the heterozygote

2) has one allele dominant to the other

3) has alleles tightly linked on the same chromosome

4) has alleles expressed at the same time in development

16. A man and a women, who do not show any apparent signs of a certain inherited

disease, have seven children (2 daughter and 5 sons). Three of the sons suffer from

the given disease but none of the daughters are affected. Which of the following mode

of inheritance do you suggest for this disease?

1) Sex linked recessive 2) Sex limited recessive

3) Sex linked dominant 4) Autosomal dominant

E A1502 7

17. The cretaceous period of the late Mesozoic is characterized by

1) Rise of dinosaurs, rise of toothed birds and rise of flowering plants

2) Extreme specialization of reptiles leading to extinction of great reptiles and extinction of toothed birds

3) Rise of archaic mammals, dinosaurs and appearance of first toothed birds

4) Extinction of archaic mammals, rise of birds and appearance of first dinosaurs

18. Choose the correct answer with reference to terms flora and vegetation

A) Both the terms refers to kinds of plants of a region

B) Vegetation emphasize names of different plants

C) Flora is a list of the species of plants in an area

D) Floristic study or vegetational analysis of an area are one and the same

1) All are correct 2) A, B and C only

3) B, C and D only 4) A and C only

19. Biodiversity forms the basis for human existence in the following ways

A) Soil formation

B) Prevention of soil erosion

C) Recycling of waste

D) Pollination of crops

Select the correct answer using the codes given below :

1) A, B and C only 2) B, C and D only

3) A and D only 4) All

20. With reference to Bombay Natural History Society (BNHS), consider the following statements :

A) It is an autonomous organization under the Ministry of Environment and Forests

B) It strives to conserve nature through action-based research, education and public awareness

C) It organizes and conducts nature trails and camps for the general public

Which of the statements given above is/are correct?

1) A and C only 2) B only

3) B and C only 4) A, B and C

A1502 E 8

21. Find the correct chronological order of time scale

1) Era – Period – Epoch – Eon 2) Era – Period – Eon – Epoch

3) Eon – Era- Period – Epoch 4) Epoch – Era – Period – Eon

22. Find the correct answer with reference to Haldane’s genetic load problem.

A) When natural selection is acting to substitute one gene for another, it does so by

means of extra mortality, which occurs on top of the background mortality, a

process called ‘soft selection’

B) In soft selection, the selective deaths are substituted for nonselective

background mortality.

1) A correct B incorrect 2) A incorrect B correct

3) A and B incorrect 4) A and B correct

23. Following is not the consequence of gene flow that enter into a population.

1) It can hinder local evolutionary changes by infusing genes from populations that

are not adapted to local conditions

2) Gene flow results in some mixing of the gene pools and prop up further

differentiation between the populations.

3) Gene flow can have beneficial effects

4) It can produce no phenotypic effect at all

24. Niche segregation is an alternative model to competition where

A) The overlapping species effectively subdivide available niches

B) By random selection of niches that overlap those of other species

C) By reinforcing reproductive barriers to prevent interbreeding or hybridization

1) A and B correct 2) B and C correct

3) A and C correct 4) A, B and C correct

25. Some distasteful or poisonous prey species exhibit conspicuous, recognizable warning

colours makes themselves more susceptible to predation but through their they

protect related genotypes that carry same pattern which is recognized as toxic by

experienced predator. Such type of natural selection is called

1) Disruptive selection 2) Group selection

3) Diversifying selection 4) Kin selection

E A1502 9

26. Which of the following is incorrect?

1) Established cell lines (ECL) have short doubling time

2) ECL are invariably aneuploid

3) ECL grow in higher density

4) ECL do not show much evidence of spatial orientation

27. An optic vesicle transplanted to the vicinity of the posterior epidermis in the same

embryo failed to induce a lens in that tissue. The most probable explanation for this

result is that

1) the vesicle lost its inductive ability

2) the posterior epidermis lacked competence

3) another inductive signal blocked the lens induction

4) the posterior epidermis was already terminally differentiated

28. In extreme antigen excess, immune complexes between IgG and a tetravalent antigen

have the composition:

1) Ag1Ab4

2) Ag4Ab3

3) Ag2Ab1

4) Ag1Ab2

29. In pharmacology, the term “chemical antagonism” means that

1) two drugs combine with one another to form an inactive compound

2) two drugs combine with one another to form a more active compound

3) two drugs combine with one another to form a more water soluble compound

4) two drugs combine with one another to form a more fat soluble compound

30. What factors can be used to identify biodiversity hotspots instead of species richness?

1) number of endemic plant and animal species

2) number of endemic plant species and amount of vegetation lost

3) number of endemic animal species and genetic diversity of the species

4) number of endemic plant and animal species and percent extinct

A1502 E 10

31. Which is the correct structure of a glycerophospholipid that has a saturated C16 fatty acyl group at position 1, a mono unsaturated C18 fatty acyl group at position 2 and an ethanolamine head group

1)

2)

3)

4)

E A1502 11

32 & 33. Patients with Mc Ardle’s disease suffer from painful muscle cramps and are unable to perform strenuous exercises. This disease, also called type V glycogen storage disease, is caused by the absence of muscle phosphorylase, unlike patients with Von Gierke’s disease, Mc Ardle’s patients do not typically suffer hypoglycaemia on fasting. Von Gierke’s patients show lactic academia but Mc Ardle’s patients fail to demonstrate lactic academia following exercise.

32. Mc Ardle’s patients 1) fail to synthesize glycogen appropriately 2) do not respond to glucagons in a normal fashion 3) show a reduced state of glycolysis during exercise 4) have an impaired TCA cycle

33. Glucose – 6 – phosphatase, which is deficient in Von Gierke’s disease is necessary for the production of blood glucose from 1) Liver glycogen 2) Fructose 3) Galactose 4) All of the above

34 & 35. An experiment measuring velocity versus substrate concentration was ran first in the absence of substance A and then in the presence of substance A. The following data were obtained [S] Velocity in absence of A Velocity in presence of A (µM) (µmol min–1) (µmol min–1) 2.5 0.32 0.20 3.3 0.40 0.26 5.0 0.52 0.36 10.0 0.69 0.56

34. Is substance A an activator or an inhibitor 1) activator 2) competitive activator 3) inhibitor 4) competitive inhibitor

35. Calculate the Km and Vmax of the above given data both in the absence and in the presence of substance A.

Km Vmax 1) Absence of A 7.1 1.25 Presence of A 12.5 1.25 Km Vmax 2) Absence of A 6.3 1.25 Presence of A 3.3 2.25 Km Vmax 3) Absence of A 1.25 6.3 Presence of A 1.25 3.3 Km Vmax 4) Absence of A 1.25 7.1 Presence of A 1.25 12.7

A1502 E 12

36 & 37. Hypercholesterolemia is one of the risk factors for cardiovascular disease.

Total cholesterol in blood is not as important in considering risk as distribution of

cholesterol between LDL and HDL particle. Efforts to reduce serum cholesterol are

two pronged dietary and drugs if reducing dietary cholesterol and saturated fat is not

sufficient. The drug of choice is statins, inhibitors of the rate limiting enzyme of

cholesterol biosynthesis.

36. In biosynthesis of cholesterol.

1) 3 – hydroxyl – 3 – methyl glutaryl coA (HMG coA) is synthesized by

mitochondria HMG coA synthetase

2) HMG coA reductase catalyzes the rate limiting step

3) the conversion of mevalonic acid to farnesyl pyrophosphate proceeds via

condensation of 3 moleculaes of mevalonic acid

4) condensation of 2 farnesyl pyrophosphate to form squalene is a feely reversible

reactions

37. Cholesterol present in LDL.

1) binds to a cell receptor and diffuses across the cell membrane

2) when it enters the cell, suppress the activity of ACAT

3) once in the cell is converted to cholesteryl esters by LCAT

4) once it has accumulated in the cell, inhibits replenishment of LDL receptors

38. With reference to the enzymes in mitochondria, match List I with List II :

List I List II

A) Outer membrane (i) Adenylate kinase

B) Inner membrane (ii) Fatty acid CoA ligase

C) Intermembrane space (iii) Malate dehydrogenase

D) Matrix (iv) Succinate dehydrogenase

1) A-(i), B-(iii), C-(ii), D-(iv)

2) A-(iv), B-(iii), C-(i), D-(ii)

3) A-(ii), B-(iv), C-(iii), D-(i)

4) A-(ii), B-(iv), C-(i), D-(iii)

E A1502 13

39. Choose the correct option after going through the following statements.

A) Unlike prokaryotic DNA, eukaryotic chromosomes have ends that are protected by telomeres

B) Replication of DNA in segments of heterochromatin occurs very late in S phase

C) An enzyme called ligase adds new repetitions of the telomeric sequence

D) Replication of DNA in segments of euchromatin occurs early in S phase

Options :

1) Statements A & B are correct whereas C & D are incorrect

2) Statements A &C are correct whereas B & D are incorrect

3) Statements A, B & C are correct whereas D is incorrect

4) Statements A, B & D are correct whereas C is incorrect

40. Replication of double-stranded DNA is a complicated process that is not completely understood, at least in part, an acknowledgement of the importance of the following facts

I) Replication requires a supply of energy to unwind the helix

II) Replication requires a supply of energy to wind the helix

III) Single – stranded DNA tends to form intra strand base pairs

IV) Double – stranded DNA tends to form intra strand base pairs

Which is correct?

1) I is correct II, III, IV is incorrect

2) II is incorrect I, II, IV is correct

3) I and III is correct II and IV is incorrect

4) II and IV is correct I and III is incorrect

41. Okazaki fragments have the following properties,

I) they are initially small and then become large as they attached to previously made DNA

II) they are initially large and then become small as they attached to previously made DNA

III) they are initially small and then become large as they attached to previously made RNA

IV) they are initially small and then become large as they attached to previously made RNA

Which of the following statement is true?

1) I is correct II, III, IV is incorrect

2) II is correct I, III, IV is incorrect

3) III is correct I, II, IV is incorrect

4) IV is correct I, II, III is incorrect

A1502 E 14

42. Intrinsic terminators have characteristics features

I) there is an inverted repeat base sequence containing a central non-repeating segment

II) the second region is near the loop end of the putative stem and is a sequence having a high G+C content

III) the second region is near the loop end of the putative stem and is a sequence having a high A+T content

Which of the following is true,

1) I, III are correct, II is incorrect

2) II, III are correct, I is incorrect

3) I, II are correct, III is incorrect

4) II is correct, II, III are incorrect

43. A particular sequence containing six base pairs is located in ten different organisms the observed sequences are ACGCAC, ATACAC, GTGCAC, ACGCAC, ATACAC, ATGTAT, ATGCGC, ACGCAT, GTGCAT and ATGCGC. What is the consensus sequence?

1) A80 T70 G80 A80 C70

2) A90 T80 G90 C80 A90 C80

3) A70 T60 G80 C90 A70 C80

4) A60 T70 G70 C80 A60 C70

44. CCAGGCTTTACACTTTATGCTTCCGG variable

CTCGTATGTTGTGTGAATTT consensus mRNA start

What is variable and consensus sequence called as

1) -35 sequence and -10 sequence

2) -10 sequence and -35 sequence

3) -15 sequence and -9 sequence

4) -9 sequence and -15 sequence

45. The structure of a tri cistronic mRNA more typically resembles as which one of the following

1) Leader, Start, Protein1, Stop – Spacers – Start, Protein 2, Stop – Spacers – Start, Protein3, Stop-Spacers

2) Start, Protein1, Stop – Start, Protein2, Stop – start, Protein3, Stop

3) Stop, Protein1, Start – Stop, Protein2, Start – stop, Protein3, Start

4) Leader, Stop, Protein1, Start – Spacers – Stop, Stop, Protein2, Start – Spacers –Stop, Protein3, Start – Spacers

E A1502 15

46. After the peptide bond forms, an uncharged tRNA molecule occupies the P site and a dipeptidyl-tRNA occupies the A site. At this point the following movement occurs :

I) the tRNAFmet in the P site, now no longer linked to an amino acid, leave this site

II) the peptidyl-tRNA moves from the A site to the P site

III) the peptidyl-tRNA moves from the P site to the A site

IV) the mRNA moves from a distance of three bases in order to position the next codon.

Which of the following movements are true.

1) I, II, III are correct IV is incorrect

2) II, III, IV are correct I is incorrect

3) III, IV, I are correct II is incorrect

4) I, II, IV are correct III is incorrect

47. The regulatory mechanisms of the lac system in the operon model has the following features

I) the structural genes and regulatory elements comprise the lac operon

II) the transacetylase enzyme mentioned is also encoded in this molecule

III) the lac I gene product is always produced and binds to the operator

IV) inducers stimulate mRNA synthesis by binding to and deactivating the repressor, a process called derepression.

Which one of the following statement is true.

1) I, II are correct and III, IV are incorrect

2) III, IV are correct and I, II are incorrect

3) I, II, III, IV are incorrect

4) Whereas I, II, III, IV are correct

48. The most striking difference exist between prokaryotic and eukaryotic cellular and genome organization is

I) the eukaryotic cell contains a membranous nucleus which includes the chromosomes as carriers of genetic information

II) the chromosomal DNA of eukaryotes is packaged in to a highly regular nucleoprotein complex, chromatin

III) a typical eukaryotic gene is monocistronic

IV) eukaryotic genes have introns.

Which one of the following is true?

1) I, II, III are correct and IV is incorrect

2) II, III, IV are correct and I is incorrect

3) I, II, IV are correct and III is incorrect

4) Whereas I, II, III, IV are correct

A1502 E 16

49. From the developmental standpoint zygote can be regarded as the

A) first cell of the gametophyte

B) fusion product of the last cells formed by the gametophyte

C) first cell of the sporophyte

D) final product of the saprophytic generation

Options :

1) A, B and C are correct

2) A is correct and C and D are incorrect

3) C is correct while A and D are incorrect

4) D is correct whereas B and C are incorrect

50. Nature prefers higher animals and plants to be essentially diploids in their somatic phase for

A) haploid cells are physically and physiologically vulnerable and are prone to mutations which could be lethal

B) the fertilization process has to be internalized

C) embryonic determination of organ initiation is paternally controlled

D) haploids cannot develop parthenogenetically in all cases

Options :

1) A, B and C are correct

2) A is correct and C and D are incorrect

3) C is correct while A and D are incorrect

4) D is incorrect whereas B and C are correct

51. As higher plants prepare for double fertilization and triple fusion

A) A synergid disintegrates

B) Filiform apparatus guides the pollen into embryo sac

C) Polar nuclei fuse to form secondary nucleus

D) Aril disintegrates

Options :

1) A, B and C are correct

2) A is correct and C and D are incorrect

3) C is correct while B and D are incorrect

4) D is correct whereas B and C are incorrect

E A1502 17

52. Relate the regulating factors in column 1 to the developmental event mentioned in column 2.

Column -1 Column-2

I. LONESOEMHIGHWAY LIKE (i) Lateral Root Formation (lhl1-lhl3)

II. DROOPING LEAF (DL) (ii) Floral transition in SAM

III. GNOM (iii) Xylem differentiation

IV. TWINSISITER OF FT (TSF) (iv) Lateral Shoot Development

V. AS1-AS2-EFT (v) Cytokinin biosynthesis

Options :

1) I-(iii), II-(ii), III-(i), IV-(iv), V-(v) 2) I-(iv), II-(i), III-(v), IV-(ii), V-(iii)

3) I-(iii), II-(iv), III-(v), IV-(i), V-(ii) 4) I-(i), II-(v), III-(ii), IV-(iii), V-(iv)

53. Statement that cannot be said of shoot tip in an angiospermic plant

A) Shoot tip is a condensed shoot

B) Tunica layer divides only by anticlinal divisions

C) Shoot meristem can be distinguished into two histogens

D) Organization is explained best by apical cell theory

Options :

1) A & B are correct and C & D incorrect

2) B is correct and C and D are incorrect

3) C is correct while A and D are incorrect

4) D is correct whereas B and C are incorrect

54. Recombination in higher plants and animals actually takes place

A) before syngamy, during Prophsse I of meiosis

B) before synagamy, during Prophsse II of meiosis

C) before synagamy, during metaphase II of meiosis

D) on fertilization as the fetus/embryo does though embryogenic development

Options :

1) A, B and C are correct

2) A is correct and B and C are incorrect

3) B is incorrect while C and D are correct

4) D is correct whereas A and C are incorrect

A1502 E 18

55. From the scrambled observations shown below, organize the correct sequence of events given in options that would lead to fertilization in a mammal like mouse

A) Chemotactic attraction of the sperm to soluble chemicals secreted by the egg

B) Exocytosis of the acrosomal vesicle to eject its enzymes

C) Binding of sperm to vitelline layer or the zona pellucida of the egg

D) Passage of sperm through the extracellular nuclear envelope

E) Syngamy or the Fusion of egg and sperm

Options :

1) BA D E C 2) AB D E C

3) AD BE C 4) AC B D E

56. Which of the following is correct in Drosophila development?

A) Biocid. Oskar and Nano are transcribed in oocytes

B) Hunchback code for transcription factor

C) Bicoid acts as transcriptional activator of hunchback gene in the embryonic nuclei

D) If bicoid is injected into the center of the embryo the middle region will become a head and the region on the other side will turn into a thorax

Options :

1) A and C 2) B and C

3) B, C and D 4) A, B and C

57. Plant development is seen essentially as an elaboration event in time and space can be construed from the fact

A) that all somatic cells are the replica of zygote derived by mitotic cell divisions.

B) plant organs differ only in terms of gene expression not in genomic content.

C) plant system is able to handle all activities including cell death in a programmed manner.

D) totiopotent ability narrows the possibility of organism death in plants unlike in animals.

Options :

1) A, B and C are correct

2) A is correct and C and D are incorrect

3) C is correct while A and D are incorrect

4) D is correct whereas B and C are incorrect

E A1502 19

58. Examine the terms given in each bunch and provide the correct sequence of larvae in liver fluke

A) Miracidium, sporocyst, cercaria, redia, metacercaria.

B) Miracidium, sporocyst, redia, cercaria, metacercaria.

C) Sporocyst, redia, miracidium, cercaria, metacercaria.

D) Cercaria, sporocyst, redia, miracidium, metacercaria.

Options :

1) AB D C 2) AB C D

3) AD B C 4) BA C D

59. Following are the statements related to the organization of the four major protein complexes of thylakoid membrane.

A) Photosystem II is located predominantly in the stacked regions of the thylakoid membrane

B) Photosystem I is found in the unstacked regions protruding into the stroma

C) Cytochrome b6 f complex is confined to stroma only

D) ATP synthase is located in the unstacked regions protruding into the stroma

Which of the following combinations of the above statements is correct?

1) A, B and C 2) B, C and D

3) A, B and D 4) C, D and A

60. Match the terms in Group I with their definitions in Group II.

Group I Group II

A) Ammonification (i) Conversion of atmospheric nitrogen into ammonia

B) Denitrification (ii) Conversion of organic nitrogen into ammonia

C) Nitrification (iii) Conversion of nitrite or nitrate into atmospheric nitrogen

D) Nitrogen fixation (iv) Conversion of ammonia into nitrite and nitrate

Options :

1) A-(ii), B-(iii), C-(i), D-(iv) 2) A-(iii), B-(ii), C-(i), D-(iv)

3) A-(iii), B-(ii), C-(iv), D-(i) 4) A-(ii), B-(iii), C-(iv), D-(i)

A1502 E 20

61. Plants produce several hormones that are important for their growth and

development. Given below are some statements on plant hormones :

A) Auxins are produced primarily in the root apices

B) Gibberellins are a large group of related compounds defined not by their

biological functions but by their structure

C) Cytokinins are a smaller group of related compounds

D) Brassinosteroids are an important class of plant hormones which control a wide

range of developmental processes including growth of pollen tube

Which one of the following combinations of the above statements is correct?

1) A, B and C 2) B, C and D

3) B and D 4) C and D

62. Following are certain statements related to photoreceptors in model plant Arabidopsis

thaliana :

A) Among the five phytochrome genes representing a gene family, PHYB plays a

predominant role in red light perception

B) Cryptochromes are involved in the regulation of flowering time and hypocotyl

length

C) PhyA photoreceptor is predominantly involved in far-red perception

D) The LOV domain of phytochrome C (PHYC) is an important domain for signal

transmission

Which one of the following combinations of the above statements is correct?

1) A, B and C 2) A, C and D

3) B, C and D 4) A, B and D

63. By experiment, it was found that the heat loss per unit weight of a small mammal

was greater than that of a large mammal, although their body temperatures

remained constant. Which one of the following conclusions can be drawn from this

result?

1) Small mammals are more active than large mammals

2) Large mammals are better adapted than small mammals to their physical

environment

3) Small mammals have a higher metabolic rate than large mammals

4) Large mammals have a greater surface area than small mammals

E A1502 21

64. With the scheme of things in nature, study of diversity calls to

A) appreciate nature in its entirety

B) study the uniqueness and deal with the differences among life

C) vouch for the grand unification of life

D) track back and study life forms that one can strategize for sustainable living

Options :

1) A, B and C are correct

2) B is correct C and D are incorrect

3) C is correct while A and D are incorrect

4) D is correct whereas B and C are incorrect

65. With an intent of making classification of organisms more objective and consistent with evolutionary history, phylogenetic system of classification is advanced. Considering this, evaluate the following statements and find the one that is not appropriate :

A) The two main analytical approaches to the study of phylogenetic systematics are phenetics and cladistics although the ground data of both is the same.

B) Phenetic analysis compares as many characters as possible without distinguishing between homologous and analogous characters.

C) Cladistic analysis classifies organisms according to the order in time so that branches that arise gets indicated in the dichotomous phylogenetic tree.

D) Cladistic analysis relies on analogous characters among organisms while ignoring novel homologies unique to the various organisms on a branch.

Options :

1) A, B and C are correct

2) A is incorrect C and D are correct

3) C is correct while A and D are incorrect

4) D is incorrect whereas B and C are correct

66. Diversity is all about the unification of life Comparative morphology helps to decipher affinities between extant groups and inferences drawn help us to appreciate the natural affinities whether or not anthropocentric. Keeping this mind find the odd man out.

A) Structural homologies

B) Vestiges

C) Homoplasies

D) Aesthetic attributes

Options :

1) A, B and C are correct

2) B is correct C and D are incorrect

3) C is correct while A and D are incorrect

4) D is correct whereas B and C are incorrect

A1502 E 22

67. What distinguishes a coelomate animal from a pseudocelomates animal is that

coelomates

A) have a body cavity, whereas pseudocelomate have a solid body

B) contain tissues derived from mesoderm, whereas pseudocelomates have no such

tissues

C) have a body cavity completely lined by mesodermal tissue, whereas

pseudocelomate do not

D) have a complete digestive system with mouth and anus, whereas

pseudocelomate have a digestive tract with only one opening

Options :

1) A, B and C are correct

2) B is correct A and D are incorrect

3) C is correct while A and B are incorrect

4) D is correct whereas B and C are incorrect

68. Identify the correct sequence of events that would have assisted the origin of life

A) formation of protobionts.

B) synthesis of organic monomers.

C) synthesis of organic polymers.

D) formation of DNA-based genetic systems.

1) A→B→C→D 2) A→C→B→D

3) B→C→A→D 4) D→C→A→B

69. Match the following columns and pick the correct answer :

Column-1 column-2

I) Ctenidium (i) Termites

II) Social insect (ii) Nereis

III) Triploblastic metamerically (iii) Taenia solium

segmented

IV) Trochophore larva (iv) Monopectinate gill

V) Mehilis’ gland (v) Sea mouse

1) I-(ii), II-(v), III-(iv), IV-(i), V-(iii) 2) I-(iv), II-(i), III-(v), IV-(ii), V-(iii)

3) I-(iii), II-(iv), III-(v), IV-(i), V-(ii) 4) I-(i), II-(v), III-(ii), IV-(iii), V-(iv)

E A1502 23

70. In algal thallus organization, Scytonema which shows false branching is considered

A) advanced than free single-celled organisms and motile colonies

B) lower than forms that show unbranched filaments

C) equal to heterotrichous forms

D) primitive than those with prosenchymatous sheath-like thallus

Options :

1) A, B and C are correct

2) A is incorrect C and D are correct

3) C is correct while A and D are incorrect

4) D is incorrect whereas B and C are correct

71. Vascularization is the process that the land pants had to willfully adopt for their survival and it invokes

A) structural and functional changes in growth pattern

B) development of axial plant body

C) formation of phloem with cytological modifications

D) programmed cell death in xylem tracheid

Options :

1) A, B and C are correct

2) A is incorrect C and D are correct

3) C is correct while A and D are incorrect

4) D is incorrect whereas B and C are correct

72. Rust and smuts are closely related to mushrooms and puffballs

A) they are disease causing organism which never form any edible fruiting structure

B) both organisms are serious parasites of concern to farmers

C) both produce basidiospores

D) considered evolutionarily as advanced fungi

Options :

1) A, B and C are correct

2) A is incorrect C and D are correct

3) C is correct while A and D are incorrect

4) D is correct whereas B and C are incorrect

A1502 E 24

73. With reference to the International Union for Conservation of Nature and Natural Resources (IUCN) and the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES), which of the following statements is/are correct?

A) IUCN is an organ of the United Nations and CITES is an international agreement between governments.

B) IUCN runs thousands of field projects around the world to better manage natural environments.

C) CITES is legally binding on the States that have joined it, but this Convention does not take the place of national laws.

Choose the correct answer : 1) A only 2) B and C only 3) A and C only 4) A, B and C only

74. Given that a population shows genetic variation, what could be the correct sequence to influence of natural selection

A) Well-adapted individuals leave more offspring than do poorly adapted individuals.

B) The trigger for change is from the environment.

C) Genetic frequencies within the population change.

D) Poorly adapted individuals evince low survivorship.

1) B→D→A→C 2) D→B→A→C

3) D→A→B→C 4) D→B→C→A

75. Choose the correct matches

(i) Podozol = a) Deciduous forest

(ii) Entisol = b) Tropical forest

(iii) Altisol = c) Boreal forest

(iv) Oxisol = d) Tundra soil

1) (i)-b; (ii)- c; (iii)- d ; (iv)-a 2) (i)-a; (ii)-d; (iii)- c ; (iv)-b

3) (i)-d; (ii)- a; (iii)- c ; (iv)-b 4) (i)-c; (ii)- d; (iii)-a ; (iv)-b

76. Red Queen hypothesis states :

A) The niche space occupied by a species is determined by number of conditions that affect the success of one species in competition with another.

B) Organism adapted to a particular environment will maintain perfection with the changing climate or habitat or biotic component

C) Natural selection continuously adapts organisms to meet the changes in the environment

D) The most successful or dominant species preempts the most space and least successful one occupies a little space which is left

1) All correct 2) A, B, C only

3) B and C only 4) A and D only

E A1502 25

77. The difference between the absolute natality and specific natality is

A) Absolute natality refers to addition of new offsprings per unit of time where as specific natality rate is per unit of population

B) Specific natality rate is addition of offsprings per unit of time where as absolute natality rate is per unit of population

C) Specific natality rate helps to determine the growth of a population

D) Absolute natality helps to determine the growth per individual

1) A correct 2) B correct

3) A, C, D correct 4) B, C, D correct

78. Find the wrong statements with reference to Shelford Law of tolerance

A) Organisms have only upper tolerance limit for every factor

B) Most factors act in concert rather than isolation

C) Tolerance level will be determined by examination of morphological features

D) Different species differ from each other in terms of tolerance range

1) A and B only 2) A and C only

3) B, C and D only 4) B and D only

79. Find the wrong statement/s regarding the quantitative characters of community analysis

A) The distribution pattern of different species in the ecosystem can be determined by frequency

B) Basal area shows the actual soil surface area occupied by the plant

C) The numerical strength of a species in relation to unit space is abundance

D) Species area curve will determine the dominant species present in the study area

1) A and B only 2) B and C only

3) C and D only 4) A and D only

80. Find out the correct statement on homeostatic mechanism

A) It is an additional component of energy flow in an ecosystem

B) It is an important feature of an ecosystem capable of self maintenance and self regulation

C) Cybernetics help the ecosystem in achieving homeostasis

D) It is always negative or disruptive

1) A and D only 2) B and D only

3) A and C only 4) B and C only

A1502 E 26

81. Find the correct match/es of hydrophytes

(i) Free floating hydrophyte – A) Trapa

(ii) Rooted hydrophyte with floating – B) Scripus leaves

(iii) Submerged hydrophyte – C) Utricularia

(iv) Rooted emergent type – D) Pistia

1) (i)-D, (ii)-A, (iii)-C, (iv)-B 2) (i)-B, (ii)-A, (iii)-C, (iv)-D

3) (i)-C, (ii)-D, (iii)-B, (iv)-A 4) (i)-D, (ii)-C, (iii)-A, (iv)-B

82. Three of the following criteria have contributed to the recognition of Western Ghats-Sri Lanka and Indo-Burma regions as hotspots of biodiversity :

A) Species richness

B) Vegetation density

C) Endemism

D) Ethno-botanical importance

E) Threat perception

F) Adaptation of flora and fauna to warm and humid conditions

Which three of the above are correct criteria in this context?

1) A, B and F 2) B, D and F

3) A, C and E 4) C, D and F

83. With reference to ‘Forest Carbon Partnership Facility’, which of the following statements is/ are correct?

A) It is a global partnership of governments, businesses, civil society and indigenous peoples

B) It provides financial aid to universities, individual scientists and institutions involved in scientific forestry research to develop eco-friendly and climate adaptation technologies for sustainable forest management

C) It assists the countries in their 'REDD+ (Reducing Emissions from Deforestation and Forest Degradation+)' efforts by providing them with financial and technical assistance

Choose the correct answer :

1) A only 2) A and C only

3) B and C only 4) All

E A1502 27

84. Choose the correct set of matches.

(i) Apomorphy – A) Sharing derived characters from common ancestors

(ii) Synapomorpy – B) Character present in earlier ancestor as well as common ancestor

(iii) Plesiomorphy – C) Newly derived characters

(iv) Synplesiomorphy – D) Inherited ancestral character

1) (i)-A, (ii)-D, (iii)-B, (iv)-C 2) (i)-A, (ii)-C, (iii)-B, (iv)-D

3) (i)-C, (ii)-A, (iii)-D, (iv)-B 4) (i)-B, (ii)-D, (iii)-A, (iv)-C

85. Find the correct set of matches.

(i) Precambrian Eon – A) Age of mammals

(ii) Paleozoic – B) Age of reptiles

(iii) Mesozoic – C) Hadean Era to Proterozoic era

(iv) Cenozoic – D) Age of fishes

1) (i)-D, (ii)-B, (iii)-A, (iv)-C 2) (i)-C, (ii)-D, (iii)-B, (iv)-A

3) (i)-B, (ii)-A, (iii)-C, (iv)-D 4) (i)-A, (ii)-C, (iii)-D, (iv)-B

86. Find the correct match of Era and its period.

(i) Paleozoic – A) Creataceous

(ii) Mesozoic – B) Quaternary

(iii) Coenozoic – C) Permian

(iv) Proteozoic – D) Precambrian

1) (i)-D, (ii)-A, (iii)-B, (iv)-C 2) (i)-D, (ii)-C, (iii)-A, (iv)-B

3) (i)-C, (ii)-A, (iii)-B, (iv)-D 4) (i)-C, (ii)-D, (iii)-B, (iv)-A

87. Choose the correct criteria used to measure the complexity of organism as stated by Cope’s rule.

A) Genome size or the total number of genes in an organism

B) The number of different types of cells possessed by organism

C) Increasing complexity is accompanied by increasing size

D) Increased compartmentalization, specialization or subdivision of function between organisms being compared

1) A only 2) B and D only

3) C only 4) C and D only

A1502 E 28

88. Find the correct match/es.

(i) Paralogues – A) Several tandem duplication of genes with in a species

(ii) Orthologues – B) Duplicated gene which is functionless and retained

(iii) Multigene family – C) Genes in duplication within a species

(iv) Pseudogene – D) Genes shared between species resulting from shared species ancestry

1) (i)-C, (ii)-A, (iii)-D, (iv)-B 2) (i)-D, (ii)-C, (iii)-B, (iv)-A

3) (i)-C, (ii)-D, (iii)-A, (iv)-B 4) (i)-D, (ii)-A, (iii)-C, (iv)-B

89. The reasons for existence of lag phase in a batch cultivation process in a bioreactor could be due to the following reasons. Identify the best combination from the following.

A) low inoculum size

B) low preinoculum size

C) stationary phase inoculum

D) inoculum not having the same medium as in batch reactor

1) A, B, C and D 2) A, C and D

3) A, B and D 4) A only

90. Identify the correct order of events in next generation sequencing technology-based whole genome sequencing project.

1) DNA extraction, shearing, library preparation, adapter ligation, sequencing, assembly, annotation

2) DNA extraction, library preparation, sequencing, adapter ligation, shearing, assembly, annotation

3) DNA extraction, shearing, adapter ligation, library preparation, sequencing, assembly, annotation

4) DNA extraction, adapter ligation, library preparation, shearing, sequencing, assembly, annotation

91. If two distantly related organisms have regions of conserved synteny, what does this mean?

1) The genes examined in the two species are present in the same order as in their most recent common ancestor

2) The genes examined in the two species are identical in sequence to each other

3) The genes examined in the two species are on different chromosomes, but in their last common ancestor, the genes were on the same chromosome

4) The genes examined in the two species contain similar mutations

E A1502 29

92. The order for the construction of a cDNA fragment from mRNA is to

1) bind oligo-dT, treat with reverse transcriptase, digest with RNase, add G residues to the 3' end, bind oligo-dC, treat with DNA polymerase

2) treat with reverse transcriptase, digest with RNase, add G residues to the 3' end, bind oligo-dC, treat with DNA polymerase and bind oligo-dT

3) digest with RNase, add G residues to the 3' end, treat with reverse transcriptase, add G residues to the 3' end and treat with DNA polymerase

4) bind oligo-dC, treat with reverse transcriptase, digest with RNase, add G residues to the 3' end, bind oligo-dT and treat with DNA polymerase

93. Match the downstream processes in Group I with the products in Group II.

Group I Group II

A) Solvent extraction P) Lactic acid

B) Protein-A linked affinity chromatography Q) Penicillin

C) Extractive distillation R) Monoclonal antibody

D) Salting out S) Lipase

1) A-R, B-P, C-S, D-Q 2) A-Q, B-S, C-P, D-R

3) A-Q, B-R, C-S, D-P 4) A-S, A-Q, C-P, D-R

94. An ELISA designed to test for the presence of serum antibody for a new strain of pathogenic bacteria is under development. Initially, a monoclonal antibody specific for a single epitope of the organism was used both to sensitize the wells of the ELISA plate and as the enzyme-labeled detecting antibody in a conventional sandwich ELISA. The ELISA failed to detect the antigen despite the use of a wide range of antibody concentrations. What is the most probable cause of this problem?

1) The antigen is too large

2) The antibody has a low affinity for the antigen

3) The monoclonal antibody used to sensitize the wells is blocking access of the epitope, thus when the same antibody is enzyme-labeled, it cannot bind to the antigen

4) The enzyme-labeled antibody used should have been a different isotype than the sensitizing antibody

95. The distance between the Cα atoms in a sheet is ≈ 3.5Å. Can a single 9 residue

segment with a conformation serve as the transmembrane protein of an integral

membrane protein?

1) not positive 2) partially possible

3) not required 4) partially required

A1502 E 30

96. Calculate the chemical potential difference when intra cellular [Na+] = 10 mM and extracellular [Na+] = 150 mM at 37 °C

1) –14 kJ mol–1 2) –7 kJ mol–1

3) –11 kJ mol–1 4) –16 kJ mol–1

97. How many grams of Sodium succinate (formula weight 140 g mol–1) and disodium succinate (formula weight 162 g mol–1) must be added to 1 L of water to produce a solution with pH 6.0 and a total solute concentration of 50 mM.

1) 5.7 g, 2.1 g 2) 2.1 g, 5.7 g

3) 6.3 g, 3.2 g 4) 3.2 g, 6.3 g

98, 99, 100. Mouse genomic DNA is treated with a restriction endonuclease and electrophoresed in an Agarose gel. The experiment was repeated three times. Explain the results of these repeated experiments.

98. The auto radiogram shows a large smudge at a position corresponding to the top of the lane in which the mouse DNA was electrophoresed

1) the restriction enzyme failed to digest the genomic DNA, leaving the DNA too large to enter the gel

2) the restriction enzyme partially digested

3) the restriction enzyme fully digested the genomic DNA

4) the restriction enzyme failed to digest the genomic DNA, leaving the DNA too small to enter the gel

99. The auto radiogram shows a smudge over the entire lane containing the mouse DNA

1) the hybridization condition were tightly bound

2) the hybridization condition were too relaxed

3) the hybridization condition were too specific

4) the hybridization condition failed

100. The auto radiogram shows three bands of varying intensity

1) the probe hybridized with three different mouse genes

2) the probe hybridized with same mouse genes

3) the probe hybridized developed star activity

4) the probe hybridized were charred

————————

E A1502 31

ROUGH WORK

A1502 E 32

ROUGH WORK