Γεωργάτου Μάνια Σχολική Σύμβουλος...

of 76/76
ΜΙΤΩΣΗ ΜΕΙΩΣΗ Γεωργάτου Μάνια Σχολική Σύμβουλος ΠΕ04
  • date post

    27-Apr-2019
  • Category

    Documents

  • view

    227
  • download

    0

Embed Size (px)

Transcript of Γεωργάτου Μάνια Σχολική Σύμβουλος...

04

DNA

:

.

mRNA

.

tRNA,rRNA

&

AUGUUCACCAAAUUGGGACAAGGCAUUUACCGAGGGAACAAC

(

)

.

tRNA

/

Figure 10.11A

Hydrogen bond

Amino acid attachment site

RNA polynucleotide chain

Anticodon

61

tRNAs

tRNA

&

:

mRNA

tRNAs

:

:

1

mRNA

2

tRNA

I.

II.

,,

.

III.

:

,

,

.

12

.

..

,

,

. 13

.

. 14

. 15

)

S

DNA

)

:

))

DNADNA!!!!!!!!

DNA

2

DNA

:

DNA /

DNADNA

.

))

DNA.

:

,

DNA

DNA .

. 18

))

::

. 19

(

)

DNA

DNA

http://www.dnalc.org/resources/3d/08-how-

dna-is-packaged-advanced.html

http://www.dnalc.org/resources/3d/08-how-dna-is-packaged-advanced.html

. 20

:

)

.

)

(

)

::

:

:

(

)

:

. 21

.

.

. 22

;

DNA

DNA

;

;

. 23

. 24

.

;

;

. 25

A B

)

)

. 26

.

..

..

.

:

:

. 27

.

;

(

)

.

.

;

.

. 28

V.

.

. 29

..

..

I.

II.

III.

(

)IV.

V.

VI.

VII.

. 30

..

..

:

.

:

1

.

4

,

. 31

..

..

.

2

1

1

1

2

2

. 32

V. V.

:

,

,

,

.

.

DNA

DNA.

.

(

)

,

.

.

. 33

:

.

. 34

:67

:1.

&:23

2.

:13.

:2

4.

:1

. 35

:

http://www.cellsalive.com/mitosis.htm

http://www.cellsalive.com/meiosis.htm

http://www.cellsalive.com/cell_cycle.htm

http://www.biology.arizona.edu/cell_bio/tutorials/cell_cycle/cells3.html

https://www.youtube.com/watch?v=DwAFZb8juMQ

http://highered.mheducation.com/sites/0072495855/student_view0/chapter2/an

imation__mitosis_and_cytokinesis.html

http://www.sumanasinc.com/webcontent/animations/content/mitosis.html

http://www.wiley.com/college/test/0471787159/biology_basics/animations/ mitosis.swf

https://www.youtube.com/watch?v=VlN7K1-9QB0

http://outreach.mcb.harvard.edu/animations/cellcycle.swf

:

http://goo.gl/dbby54

http://goo.gl/9mDTjb

http://goo.gl/gyhHLW

http://users.sch.gr//dgspanos/Mitosi/M.htm

ppt

. 36

http://photodentro.edu.gr/aggregator/search/all?query=%CE%BC%CE%B9%CF%84%

CF%89%CF%83%CE%B7&ugc=1&ext=1&items_per_page=20#ext=1&items_per_pag

e=20&order=desc&query=%CE%BC%CE%B9%CF%84%CF%89%CF%83%CE%B7&so

rt=changed&ugc=1

http://www.cellsalive.com/mitosis.htmhttp://www.cellsalive.com/meiosis.htmhttp://www.cellsalive.com/cell_cycle.htmhttp://www.biology.arizona.edu/cell_bio/tutorials/cell_cycle/cells3.htmlhttps://www.youtube.com/watch?v=DwAFZb8juMQhttp://highered.mheducation.com/sites/0072495855/student_view0/chapter2/animation__mitosis_and_cytokinesis.htmlhttp://highered.mheducation.com/sites/0072495855/student_view0/chapter2/animation__mitosis_and_cytokinesis.htmlhttp://www.sumanasinc.com/webcontent/animations/content/mitosis.htmlhttp://www.wiley.com/college/test/0471787159/biology_basics/animations/mitosis.swfhttp://www.wiley.com/college/test/0471787159/biology_basics/animations/mitosis.swfhttps://www.youtube.com/watch?v=VlN7K1-9QB0http://outreach.mcb.harvard.edu/animations/cellcycle.swfhttp://goo.gl/dbby54http://goo.gl/9mDTjbhttp://goo.gl/gyhHLWhttp://users.sch.gr/dgspanos/Mitosi/M.htmhttp://photodentro.edu.gr/aggregator/search/all?query=%CE%BC%CE%B9%CF%84%CF%89%CF%83%CE%B7&ugc=1&ext=1&items_per_page=20http://photodentro.edu.gr/aggregator/search/all?query=%CE%BC%CE%B9%CF%84%CF%89%CF%83%CE%B7&ugc=1&ext=1&items_per_page=20http://photodentro.edu.gr/aggregator/search/all?query=%CE%BC%CE%B9%CF%84%CF%89%CF%83%CE%B7&ugc=1&ext=1&items_per_page=20http://photodentro.edu.gr/aggregator/search/all?query=%CE%BC%CE%B9%CF%84%CF%89%CF%83%CE%B7&ugc=1&ext=1&items_per_page=20

..

)

:1.

/

2.

3.

.

37

.

::

;

;

;

;

. 38

;

.;

.;

..;

. 39

.

.

. 40

/

ppt

ppt

.

.

,

.

. 41

. 42

,

,

.

:

. 43

,

,

.

. 44

(

)

:

.

2n 4n

. 45

2n

2n

. 46

. 47

. 48

. 49

. 50

/

()

:

. 51

. 52

, ,

,

,

,

:

. 53

. 54

. 55

. 56

:

(

)

1

2

(

)

. 57

.

ppt

ppt

.

. 58

. 59

. 60

. 61

https://highered.mheducation.com/sites/9834092339/student_view

0/chapter11/stages_of_meiosis.html

https://highered.mheducation.com/sites/9834092339/student_view0/chapter11/stages_of_meiosis.htmlhttps://highered.mheducation.com/sites/9834092339/student_view0/chapter11/stages_of_meiosis.html

. 62

. 63

. 64

. 65

. 66

;

;

. 67

;

. 68

https://highered.mheducation.com/sites/9834092339/student_view0/chapter11/comparison_of_

meiosis_and_mitosis.html

https://highered.mheducation.com/sites/9834092339/student_view0/chapter11/comparison_of_meiosis_and_mitosis.htmlhttps://highered.mheducation.com/sites/9834092339/student_view0/chapter11/comparison_of_meiosis_and_mitosis.html

. 69

https://highered.mheducation.com/sites/9834092339/stude

nt_view0/chapter11/unique_features_of_meiosis.html

:

/

https://highered.mheducation.com/sites/9834092339/student_view0/chapter11/unique_features_of_meiosis.htmlhttps://highered.mheducation.com/sites/9834092339/student_view0/chapter11/unique_features_of_meiosis.html

. 70

https://highered.mheducation.com/sites/983409

2339/student_view0/chapter11/meiosis_with_c rossing_over.html

https://highered.mheducation.com/sites/9834092339/student_view0/chapter11/meiosis_with_crossing_over.htmlhttps://highered.mheducation.com/sites/9834092339/student_view0/chapter11/meiosis_with_crossing_over.htmlhttps://highered.mheducation.com/sites/9834092339/student_view0/chapter11/meiosis_with_crossing_over.html

;

. 71

/:

. 72

(

)

(

)

https://highered.mheducation.com/sites/9834092339/student_view0/chapter11

/random_orientation_of_chromosomes_during_meiosis.html

https://highered.mheducation.com/sites/9834092339/student_view0/chapter11/random_orientation_of_chromosomes_during_meiosis.htmlhttps://highered.mheducation.com/sites/9834092339/student_view0/chapter11/random_orientation_of_chromosomes_during_meiosis.html

,

,

,

,

,

:

. 75

. 76

Growth1 /Gap 1 checkpoint1SynthesisGrowth 2

/ Gap2 checkpoint 2

http://highered.mheducation.com/sites/9834092339/student_view0/chapter10/stimul

ation_of_cell_replication.htmlhttp://highered.mheducation.com/sites/9834092339/student_view0/chapter10/control

_of_the_cell_cycle.html

http://highered.mheducation.com/sites/9834092339/student_view0/chapter10/stimulation_of_cell_replication.htmlhttp://highered.mheducation.com/sites/9834092339/student_view0/chapter10/stimulation_of_cell_replication.htmlhttp://highered.mheducation.com/sites/9834092339/student_view0/chapter10/control_of_the_cell_cycle.htmlhttp://highered.mheducation.com/sites/9834092339/student_view0/chapter10/control_of_the_cell_cycle.html

- tRNA / :Slide Number 7Slide Number 8Slide Number 9Slide Number 10Slide Number 11 . Slide Number 14Slide Number 15 - ) DNA!!!! ) Slide Number 18Slide Number 19 : Slide Number 22Slide Number 23Slide Number 24Slide Number 25Slide Number 26. - . Slide Number 28 . . . . . . V. . : Slide Number 42Slide Number 43Slide Number 44Slide Number 45 Slide Number 47Slide Number 48Slide Number 49Slide Number 50Slide Number 51Slide Number 52 Slide Number 54Slide Number 55Slide Number 56 Slide Number 59Slide Number 60Slide Number 61Slide Number 62Slide Number 63Slide Number 64 Slide Number 66Slide Number 67Slide Number 68Slide Number 69 Slide Number 73Slide Number 74